ID: 935192189

View in Genome Browser
Species Human (GRCh38)
Location 2:100787054-100787076
Sequence AAGCTGATCTCTAGAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935192180_935192189 29 Left 935192180 2:100787002-100787024 CCCAAGCTGAGCCCATCAGAGAC No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192182_935192189 18 Left 935192182 2:100787013-100787035 CCCATCAGAGACCTTTCAAAGCC No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192188_935192189 -8 Left 935192188 2:100787039-100787061 CCACAAAAGTGGAGGAAGCTGAT No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192181_935192189 28 Left 935192181 2:100787003-100787025 CCAAGCTGAGCCCATCAGAGACC No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192183_935192189 17 Left 935192183 2:100787014-100787036 CCATCAGAGACCTTTCAAAGCCA No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192187_935192189 -3 Left 935192187 2:100787034-100787056 CCAGACCACAAAAGTGGAGGAAG No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data
935192184_935192189 7 Left 935192184 2:100787024-100787046 CCTTTCAAAGCCAGACCACAAAA No data
Right 935192189 2:100787054-100787076 AAGCTGATCTCTAGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935192189 Original CRISPR AAGCTGATCTCTAGAAGAGA AGG Intergenic
No off target data available for this crispr