ID: 935193109

View in Genome Browser
Species Human (GRCh38)
Location 2:100794056-100794078
Sequence GACACAGCTGTGACTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935193109_935193119 23 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193119 2:100794102-100794124 GGCCGGGGAAGGCTCCTCCCCGG No data
935193109_935193114 6 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193114 2:100794085-100794107 GAGGCGCCTGCTGGAGCGGCCGG No data
935193109_935193113 2 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193113 2:100794081-100794103 GTGTGAGGCGCCTGCTGGAGCGG No data
935193109_935193115 7 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193115 2:100794086-100794108 AGGCGCCTGCTGGAGCGGCCGGG No data
935193109_935193118 12 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193118 2:100794091-100794113 CCTGCTGGAGCGGCCGGGGAAGG No data
935193109_935193116 8 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193116 2:100794087-100794109 GGCGCCTGCTGGAGCGGCCGGGG No data
935193109_935193111 -3 Left 935193109 2:100794056-100794078 CCGGCAGGAGTCACAGCTGTGTC No data
Right 935193111 2:100794076-100794098 GTCCAGTGTGAGGCGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935193109 Original CRISPR GACACAGCTGTGACTCCTGC CGG (reversed) Intergenic
No off target data available for this crispr