ID: 935194211

View in Genome Browser
Species Human (GRCh38)
Location 2:100802389-100802411
Sequence CCAGGCTCACGAAAGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935194211_935194217 -2 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194217 2:100802410-100802432 GGAGCCACATCTGACAAGATGGG No data
935194211_935194221 14 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194221 2:100802426-100802448 AGATGGGATAACTGTGGGATTGG No data
935194211_935194220 9 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194220 2:100802421-100802443 TGACAAGATGGGATAACTGTGGG No data
935194211_935194219 8 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194219 2:100802420-100802442 CTGACAAGATGGGATAACTGTGG No data
935194211_935194222 15 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194222 2:100802427-100802449 GATGGGATAACTGTGGGATTGGG No data
935194211_935194216 -3 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194216 2:100802409-100802431 TGGAGCCACATCTGACAAGATGG No data
935194211_935194223 16 Left 935194211 2:100802389-100802411 CCCCAGGGCTTTCGTGAGCCTGG No data
Right 935194223 2:100802428-100802450 ATGGGATAACTGTGGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935194211 Original CRISPR CCAGGCTCACGAAAGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr