ID: 935197041

View in Genome Browser
Species Human (GRCh38)
Location 2:100822980-100823002
Sequence TCTTTGCTACAAATAGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935197041_935197046 -10 Left 935197041 2:100822980-100823002 CCTCGTTCTATTTGTAGCAAAGA 0: 1
1: 0
2: 0
3: 6
4: 121
Right 935197046 2:100822993-100823015 GTAGCAAAGATGGGAGGTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935197041 Original CRISPR TCTTTGCTACAAATAGAACG AGG (reversed) Intronic
914672840 1:149885039-149885061 TTTTTGCTACAAAGAGGAGGTGG - Exonic
915257948 1:154649631-154649653 TCTTTTCAACAAATAGTACTGGG - Intergenic
915832127 1:159140881-159140903 TCTGTCCTACAAACAGAAAGGGG + Intronic
916172372 1:162010711-162010733 TCGTTTTTACAAATAGAACCAGG + Intronic
918019004 1:180666038-180666060 TCTTTTCAACAAATAGTACTGGG - Intronic
922381044 1:225026486-225026508 TCTTTTCAACAAATAGTACTGGG - Intronic
923100563 1:230811717-230811739 TCTTTTCAACAAATAGTACTGGG - Intergenic
923120735 1:230987967-230987989 TAATTGCTACAAATTGAAAGTGG + Intronic
923322617 1:232849796-232849818 TCTTTTCAACAAATAGTACTGGG - Intergenic
923971874 1:239212636-239212658 TATGTGCTACAAATATAAAGAGG - Intergenic
1065478424 10:26166076-26166098 TCTCTGCTACAAGTCGAGCGAGG + Exonic
1065810868 10:29442408-29442430 TCTTTGTTAAAAATAAAAAGGGG - Intergenic
1065908425 10:30280187-30280209 TCTTTGCTAAAAATAAAGAGGGG - Intergenic
1067968730 10:50944225-50944247 GCTTTGGTACAAATGGAAAGTGG + Intergenic
1068365464 10:56044056-56044078 TCTCTCCTACACATAGAAGGAGG - Intergenic
1068468876 10:57434346-57434368 TCTTTTATACAAATAGAAGCTGG - Intergenic
1068509019 10:57939677-57939699 TATTGGCTACTAATAGAAGGTGG + Intergenic
1072966516 10:99978224-99978246 TGTTTGCCATAAAAAGAACGTGG - Intronic
1074128188 10:110547150-110547172 TTTTAGCTACAAATAGACCCTGG + Intergenic
1076129143 10:128000743-128000765 TCTTTCCTACAAAGTGAAGGAGG + Intronic
1078308162 11:10211882-10211904 TCTTTGCTAGAAACAGAACTTGG - Intronic
1078478923 11:11659307-11659329 ACCTTGCTACAACTAGAACCAGG + Intergenic
1078845024 11:15112801-15112823 TATATGCTAGAAATAGAATGAGG - Intronic
1080864861 11:36184729-36184751 TCTTTGCAACAAATTCAACAAGG - Intronic
1089835935 11:121370676-121370698 TCTTTGCTAAAAAAAAAATGAGG - Intergenic
1090633144 11:128668363-128668385 TCTTTACCTCAAATAGAATGAGG + Intergenic
1091816446 12:3442549-3442571 TCTATGCTGCAAAGAGAATGGGG + Intronic
1093837261 12:23848943-23848965 TCTTTGCAACCAATAGAAAAAGG + Intronic
1095042494 12:37457800-37457822 TCTTTGCAACAAAAATAATGTGG + Intergenic
1098960990 12:76739515-76739537 ACTTTGCAACAATTTGAACGGGG - Intergenic
1099417773 12:82414477-82414499 TTTTTGCGACTAATAGAAAGTGG + Intronic
1099569031 12:84291303-84291325 TCTTTACTTCAAATAGAGCTTGG + Intergenic
1108782847 13:53857758-53857780 TCTTTGCCCCAAATAAAATGGGG + Intergenic
1119175644 14:72566007-72566029 TCTTTGCTACATATTCAACTTGG - Intronic
1121875719 14:97449617-97449639 TGTTTGCTACAAATATCAGGAGG - Intergenic
1202941028 14_KI270725v1_random:145530-145552 TCTTTGCAACAAAAATAATGTGG + Intergenic
1127266827 15:57369094-57369116 AATTTGCTACAAATAAAATGTGG + Intergenic
1127928492 15:63571914-63571936 TATTTGCTACAACTAGAAAAAGG + Intronic
1128084527 15:64876720-64876742 TCTTTGCCACAACCAGGACGGGG + Intronic
1128561534 15:68671822-68671844 TCTGTGTTACTAATAGAATGTGG - Intronic
1133000314 16:2847567-2847589 TCTCTGCTAAAAAGAGAATGTGG + Intergenic
1133479271 16:6153932-6153954 TATTTGATAAAATTAGAACGAGG - Intronic
1137400417 16:48148659-48148681 TCAATGGTACAAATAGAAGGTGG - Intronic
1141418515 16:83896312-83896334 TCTTTTCAACAAATGGGACGGGG - Intergenic
1144492134 17:15722331-15722353 GCTTTGCTATTAATAGATCGAGG + Intergenic
1144908338 17:18656869-18656891 GCTTTGCTATTAATAGATCGAGG - Intronic
1146532511 17:33621394-33621416 CCTCTTCTTCAAATAGAACGGGG + Intronic
1147465512 17:40607791-40607813 TCTTTGCTGCAAAGAGCACTCGG + Intergenic
1149044812 17:52232443-52232465 TCTTTGGTTCAAATAGATCAAGG - Intergenic
1149718884 17:58822572-58822594 TGTTTACTAAAAATAGAACGGGG + Intronic
1152520092 17:80850678-80850700 TTTTTTTTACAAATAGAATGTGG + Intronic
1152715340 17:81897298-81897320 TCTCTGCTAAAAATACAACAAGG - Intronic
1156892618 18:42207279-42207301 TCTTTTCTATGAATAGAATGAGG + Intergenic
1158076203 18:53532669-53532691 TGTTTGCTAGAATTAGAAAGGGG - Exonic
1159157411 18:64601992-64602014 TCTTTGCTAAAAACATAACAAGG + Intergenic
1159301076 18:66568705-66568727 TCTTAGCTGCAAATGGAAAGAGG + Exonic
1159597394 18:70395495-70395517 TCTTTGCTACCAAAAGACTGAGG + Intergenic
925114380 2:1366260-1366282 TCTTTTCTACCAATAGAATGGGG + Intronic
928817251 2:35312988-35313010 TCTTTAAAACAAATAGAACAAGG + Intergenic
931167361 2:59762455-59762477 TCTTTTCTACCAATAGCACAGGG + Intergenic
931315949 2:61131930-61131952 TCTTTTCTACAAATGGCACTAGG + Intronic
933141775 2:78800262-78800284 TTATTGCTACAAATAAAATGAGG - Intergenic
933287438 2:80399726-80399748 TCTTTGCTAAAAATAGAAGAAGG - Intronic
935197041 2:100822980-100823002 TCTTTGCTACAAATAGAACGAGG - Intronic
937521247 2:122714875-122714897 TCTTTGAAACTAATAGAACAAGG + Intergenic
938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG + Intronic
940617299 2:156064998-156065020 TCCTTGCTAGAAGCAGAACGTGG - Intergenic
941200702 2:162505484-162505506 TCTTTCCTACAAAGATAACTTGG + Intronic
944714780 2:202367559-202367581 TCTTTACTAAAAATACAACCCGG - Intergenic
947290272 2:228565993-228566015 TCTTTCCTAGTAATAGAACCTGG + Intergenic
1171536923 20:25900868-25900890 TCTTTGCAACAAAAATAATGTGG + Intergenic
1171804182 20:29660283-29660305 TCTTTGCAACAAAAATAATGTGG - Intergenic
1171839869 20:30196140-30196162 TCTTTGCAACAAAAATAATGTGG + Intergenic
1173441035 20:43076620-43076642 TCTTTGCTCCAACTAGTAGGTGG - Intronic
1176582133 21:8541413-8541435 TCTTTGCAACAAAAATAATGTGG - Intergenic
1177564443 21:22800485-22800507 TCTTTTCAACAAATAGTACTGGG - Intergenic
1177677619 21:24322309-24322331 TGTGTGCTATAAATAGAACAAGG - Intergenic
1180264968 22:10518461-10518483 TCTTTGCAACAAAAATAATGTGG - Intergenic
952661789 3:35859666-35859688 TCAATGCCACAAATAGAAGGGGG + Intergenic
955336891 3:58094233-58094255 TCTCTACTAAAAATACAACGTGG - Intronic
955875151 3:63481192-63481214 TACTTGCTACAAAGAGAAGGAGG + Intronic
960503289 3:118463545-118463567 TCTATGCTACAAATATAAGGTGG + Intergenic
965799388 3:172476140-172476162 TCTTTCCTAAAAATAGGATGTGG - Intergenic
969408466 4:7011486-7011508 TCTATGCTACAGAAAGAACAAGG - Intronic
970720028 4:18976009-18976031 TCTTTCCTACAAATATAATAAGG + Intergenic
976096174 4:81510489-81510511 TCTGTGCTACCAATAGAATCCGG - Intronic
976117098 4:81739397-81739419 TCTTTGCTCCAAGAAGAAAGAGG - Intronic
978726765 4:111978002-111978024 ACTTTGCAACAATTTGAACGGGG - Intergenic
979930571 4:126624776-126624798 TATTTGCTACAGTTTGAACGTGG - Intergenic
981078226 4:140612217-140612239 TCTTTGCTCCAAATGGGAAGGGG - Intergenic
982698545 4:158632223-158632245 TCTTTGCTGCAAACTGAACCTGG - Intronic
986103897 5:4641580-4641602 TCTTTGGGACAAATAAAACATGG - Intergenic
987956151 5:24743205-24743227 TCTTTGAAAGAAATAGAACATGG - Intergenic
996818593 5:127600253-127600275 TCCCTGACACAAATAGAACGTGG - Intergenic
997515008 5:134481812-134481834 TCTCTACTAAAAATACAACGTGG + Intergenic
998268247 5:140682959-140682981 TCTTTGCTCCAATAAGAAGGGGG - Intronic
1000851344 5:166343600-166343622 TCTTTGCTACAAAGAGAGATTGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1010902935 6:81450161-81450183 TCTTTCCTAAAAATAGCAAGAGG - Intergenic
1015162548 6:130169603-130169625 CCTTTGCTACAGAAAGAACAGGG - Intronic
1017514863 6:155147046-155147068 TCTTTTATACAAATAGTATGTGG + Intronic
1018568229 6:165180573-165180595 TCTCTTCTACAAAGAGAACCAGG + Intergenic
1019781552 7:2943202-2943224 TCTTTACTAAAAATAGAAAAAGG + Intronic
1020404486 7:7816566-7816588 TCTTTGGGACAAAGAGAATGTGG + Intronic
1021281175 7:18719850-18719872 ACTTTGTAACAAATAGAACAGGG - Intronic
1022586450 7:31617919-31617941 TCTTTACTACAAATAGAAAAGGG - Intronic
1025030966 7:55556406-55556428 TCTTTATTATAAATAGAATGTGG - Intronic
1025288391 7:57687579-57687601 TCTTTGCAACAAAAATAATGTGG + Intergenic
1027442726 7:78237393-78237415 TCTTTAATACAAAAAGAACCAGG - Intronic
1032734215 7:134675482-134675504 TCTTTTCAACAAATAGTACTGGG - Intronic
1037280267 8:17233347-17233369 TCTGCGCTAAAAATAGCACGAGG + Intronic
1042625883 8:70756101-70756123 TCTTTTCAACAAATGGTACGGGG - Intronic
1043342098 8:79252269-79252291 AATTTGCTACAAACAGAATGTGG - Intergenic
1045064719 8:98435176-98435198 TCTGGGCTACAAACAGAAAGAGG + Intronic
1046197010 8:110878489-110878511 TCTTTTCTACAAAAAGTACTCGG + Intergenic
1050274894 9:3986510-3986532 TCATTGGTACAAATGGAACTGGG - Intronic
1052050595 9:23843670-23843692 TCTGGGCTACAATTAGAAAGGGG - Intergenic
1055915696 9:81397858-81397880 TCTTGGCTACAACTAGGACTAGG - Intergenic
1056818129 9:89816482-89816504 ACTTGTCTACAAATAGAACATGG - Intergenic
1058807604 9:108607307-108607329 ACTTTGGTACAATTAGAAGGTGG - Intergenic
1203612150 Un_KI270749v1:19429-19451 TCTTTGCAACAAAAATAATGTGG - Intergenic
1187673734 X:21694722-21694744 TAATGGCTACAGATAGAACGTGG + Intergenic
1187995804 X:24925167-24925189 TCTATGCTTCTACTAGAACGTGG + Intronic
1189862259 X:45285601-45285623 TCTTTTCTACAAATGGCACTGGG - Intergenic
1195118531 X:101725144-101725166 TCTTTGCAACAAATGGTACTGGG - Intergenic
1197431910 X:126376961-126376983 TCTATGCTTCAAACAGCACGGGG + Intergenic
1198134545 X:133735367-133735389 TCTTTTCAACAAATGGAACTTGG + Intronic
1201956663 Y:19632077-19632099 TCTTTGCAACCAACAGAACAAGG - Intergenic