ID: 935199683

View in Genome Browser
Species Human (GRCh38)
Location 2:100845417-100845439
Sequence CTGAATGTACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 2, 1: 17, 2: 53, 3: 92, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935199683_935199685 2 Left 935199683 2:100845417-100845439 CCATTGTCCATTTGTACATTCAG 0: 2
1: 17
2: 53
3: 92
4: 431
Right 935199685 2:100845442-100845464 TCTCAGTGCCAATGTAGCACTGG 0: 1
1: 0
2: 0
3: 14
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935199683 Original CRISPR CTGAATGTACAAATGGACAA TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906374442 1:45283744-45283766 CTAAATTTAAAAATGGGCAAAGG - Intronic
906508780 1:46399097-46399119 CTGCATGTACAAAGGCATAAGGG - Intronic
907887650 1:58608115-58608137 CTGATTGTATAAATGAACATTGG - Intergenic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
908235488 1:62143813-62143835 CTGAGTGTGCAAGTGGATAATGG + Intronic
908578313 1:65485725-65485747 CTGACTGTACAAATTGGTAATGG - Intronic
908635830 1:66163928-66163950 CTGAGAGTACAAATGCACATAGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914906624 1:151751445-151751467 CTGATTTTAAAAATGGGCAACGG - Intergenic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
921546452 1:216480740-216480762 CTCAATTTAAAAATGGGCAAAGG + Intergenic
921809126 1:219491793-219491815 CTAAAAGTGCAAATGGGCAAAGG + Intergenic
921900565 1:220445818-220445840 CTCAATTTAAAAATGGGCAATGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923304704 1:232677531-232677553 CTGGATTTAAAAATGGGCAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063438323 10:6052464-6052486 CTGAATGAATGAATGAACAAAGG + Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1065978225 10:30863101-30863123 TTGTAAGTACAAATGCACAAGGG + Intronic
1066181622 10:32967327-32967349 CTCAATTTAAAAATGGGCAAAGG + Intronic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1067975450 10:51019816-51019838 CTCAATTTAAAAATGGGCAAAGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069165357 10:65151418-65151440 CTGATTTTAAAAATGGGCAAAGG + Intergenic
1069234747 10:66056815-66056837 TTAAATGTATAAATGAACAATGG + Intronic
1069440168 10:68421286-68421308 CTGGGTTTACAAATGGACAGAGG - Intronic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069866028 10:71503373-71503395 CTGTGTGCACAAATGGACAGGGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071282768 10:84117552-84117574 GTGAATGCACACTTGGACAAGGG - Intergenic
1071282869 10:84118667-84118689 GTGAATGCACACTTGGACAAGGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071991378 10:91103750-91103772 CTGAAGGTACTCATGGCCAAAGG - Intergenic
1072086326 10:92082960-92082982 CAGAATGTACAAAGGGTGAAGGG + Intronic
1074053241 10:109899017-109899039 CTGAATGAATAAATGGCCATCGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077728933 11:4707351-4707373 CTCAATTTAAAAAGGGACAAAGG - Intronic
1078493824 11:11796243-11796265 CTGATTGTAAAAAGGGCCAATGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078778599 11:14416045-14416067 CTGACTGTAGGACTGGACAAAGG - Intergenic
1078947435 11:16085447-16085469 TTTAATGCTCAAATGGACAAAGG - Intronic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1079663840 11:23078261-23078283 TTGAAAGTAAAAATGGAGAAAGG + Intergenic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080726696 11:34905284-34905306 CTTGTTGTACAAATGGACCATGG - Intronic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1080972532 11:37295505-37295527 CACAATTTAAAAATGGACAAAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG + Intergenic
1083837370 11:65280156-65280178 TTGAATGTAAACATTGACAAAGG - Intronic
1084063531 11:66690515-66690537 CTGAAAGTTCAACTGGCCAATGG - Intronic
1084195399 11:67521689-67521711 CTGAATGAACAAATATAAAAGGG + Intronic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1085528619 11:77178523-77178545 CTGAATGTAGAAATAAATAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087456994 11:98399111-98399133 CAGAATGTAGATATGGGCAAAGG + Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087711925 11:101563884-101563906 CTAAATGTACAAGTAGAAAATGG - Intronic
1087882903 11:103439780-103439802 CTGAATGAATGAATGAACAAAGG + Intronic
1088308889 11:108439150-108439172 CTCAATGTAAAAATGGGCAAAGG + Intronic
1088968326 11:114748275-114748297 CTGCATGTACTAGGGGACAAAGG - Intergenic
1090254159 11:125271520-125271542 CTGAATGAACAAATGAAAACAGG - Intronic
1090567605 11:128012382-128012404 TTGAATGTACATATACACAATGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095318275 12:40793318-40793340 CTTAATGTGCATATGGACACCGG - Intronic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097556886 12:61149671-61149693 CTTGTTGTACAAATGGACCATGG - Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098280125 12:68854278-68854300 CTGAATGAATGAATGAACAAGGG - Exonic
1098484380 12:71003893-71003915 TTGAATGTACAAAGGCAAAATGG + Intergenic
1100459248 12:94782480-94782502 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106327527 13:28708453-28708475 CTCAATTTAAAAATGGGCAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107122149 13:36807685-36807707 ATGAAAGTATAATTGGACAAAGG + Intergenic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108556046 13:51593711-51593733 TTCAATGGAGAAATGGACAAAGG - Intronic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1111157430 13:84346799-84346821 TTGAATGGATAAATGTACAATGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112762630 13:102708499-102708521 ATGAATGTACGAATGAACACTGG + Intergenic
1113529019 13:111006331-111006353 CGAAATGTACACATGGACAGTGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115211632 14:30972423-30972445 GTGAACGTACACTTGGACAAGGG - Intronic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1115794672 14:36921303-36921325 CTGTATGAACAAATGAACTATGG - Intronic
1116104332 14:40480872-40480894 CTGAATTTAAGAATGGCCAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116111415 14:40590267-40590289 CTGATTGTACAAATGTTCAAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124433512 15:29628295-29628317 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1126915886 15:53466005-53466027 CTGATTGTAGAAATGGGAAAAGG + Intergenic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1127620589 15:60729999-60730021 ATAAATGTAAAAAGGGACAAGGG - Intronic
1128455442 15:67829000-67829022 CTGAATCTACAAGGGGGCAAGGG + Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131912284 15:97221090-97221112 GTGAATGAAGAAATGAACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1132913017 16:2325406-2325428 CTGATTGTACAATGGGACCAGGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134172666 16:11980821-11980843 CCGAATGTTAAAATGGCCAAAGG - Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134811767 16:17173575-17173597 CTCAATGCACACAGGGACAAAGG + Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1140223583 16:73061467-73061489 CTGAAGGTAAAAATATACAATGG - Intergenic
1140572179 16:76120352-76120374 CTGAATGGACAAATAGAATAAGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140866653 16:79068062-79068084 CTGCATGTACAAGTGCACAGGGG + Intronic
1141134446 16:81456544-81456566 ATGAATGTACATCTGCACAAAGG - Intronic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1141789860 16:86227105-86227127 CTCAAGGTACAAAATGACAATGG - Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1142678483 17:1530966-1530988 TTGAAAGTCCAAATGGAGAACGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1146246623 17:31290046-31290068 CTCAATGAATAAATGGGCAAAGG - Intronic
1146670430 17:34733738-34733760 TTGAAAGAACAAATGAACAAAGG - Intergenic
1146978702 17:37139369-37139391 CTGGAGGTGGAAATGGACAATGG + Intronic
1149508857 17:57220200-57220222 CCGAATTTAAAAATGGGCAAAGG + Intergenic
1149619902 17:58036302-58036324 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1150033124 17:61762542-61762564 CTCAATTTAAAAATGGGCAAGGG + Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1150565384 17:66334445-66334467 CTCAATTTAAAAATGGGCAAAGG + Intronic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151483860 17:74386558-74386580 CTGACTCTACAAATGGCCAGCGG - Intergenic
1153286392 18:3458825-3458847 CTAAATGTACCACTGAACAAAGG - Intronic
1153293471 18:3523540-3523562 CTCAATTTAAAAATGGGCAAAGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154988257 18:21575798-21575820 TTTAATGTTCAAAAGGACAAAGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156973614 18:43189275-43189297 ATGAATGTAAAAAAGTACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162829146 19:13273468-13273490 CTCAATGGATAAATGGGCAAAGG - Intronic
1163510284 19:17730617-17730639 CTCAATTTAAAAATGGGCAAAGG - Intronic
1164398064 19:27883430-27883452 CTTATTGTACAAATGGGCTATGG - Intergenic
1166576043 19:43838877-43838899 CTGATTGTAAAACTAGACAAGGG - Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1168479727 19:56709561-56709583 CCCAATGAAAAAATGGACAAAGG - Intergenic
1168514329 19:56998363-56998385 CCGAATGTGCAAATGCACAAGGG + Intergenic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925841071 2:7992882-7992904 CTGGATGTACAAGTGAATAAAGG + Intergenic
926040370 2:9667880-9667902 CTGCAGGAACAAATGGACACAGG + Intergenic
926507204 2:13731903-13731925 ATTAATGTAGAAATGGTCAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930008684 2:46917445-46917467 TTGAATGAATAAATGAACAAAGG - Intronic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
934891276 2:98071932-98071954 TTAAATGTGCAAATGGACACAGG - Intergenic
934928653 2:98401161-98401183 CCCAATGTAAAAATGGGCAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938640504 2:133273363-133273385 CCCAATGTGAAAATGGACAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939082700 2:137682351-137682373 CTGAATGTTTAAAAGCACAAAGG + Intergenic
939164499 2:138626102-138626124 GTGAATGTAAGAATGGAGAAGGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942538346 2:176989139-176989161 CCTCATGTACCAATGGACAAAGG - Intergenic
942832778 2:180256286-180256308 CTGAATGTCAAAAAGGACATGGG - Intergenic
943687432 2:190833451-190833473 CTCAATTTAAAAATGGGCAAAGG - Intergenic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944117102 2:196200284-196200306 CTGAATGTACCAAAGGTGAAGGG - Exonic
944939458 2:204607932-204607954 CTAAATGTCCAAATTGTCAAAGG - Intronic
945231103 2:207591234-207591256 CTGAAAGGAGAAATGAACAAAGG - Intronic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945684647 2:212954258-212954280 CTGATTTTAAAAATGGGCAAAGG + Intergenic
946042269 2:216792480-216792502 CTGAATGAATTAATAGACAAAGG + Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
948016005 2:234691127-234691149 CAAACTGTAAAAATGGACAAAGG + Intergenic
948611798 2:239174264-239174286 CAGCATGTACAACTGGCCAAGGG + Intronic
1168823340 20:792164-792186 GTGAGTGTACACCTGGACAAGGG - Intergenic
1168893590 20:1309255-1309277 CTGTCTGAACAAAAGGACAAAGG - Exonic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169643976 20:7788655-7788677 CCTGATGTAAAAATGGACAAAGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173762242 20:45572943-45572965 CTCAATTTAAAAATGGGCAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177446791 21:21208234-21208256 TGGAATGTAACAATGGACAATGG + Intronic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178333742 21:31725459-31725481 CTTAATGTACGAATTGACATTGG - Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180910400 22:19446150-19446172 CAGAATGGAAAAATGGCCAAAGG - Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183582420 22:38733847-38733869 TTGAATGTACAGATGGGCAGAGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184966962 22:47983859-47983881 CACAATTTACCAATGGACAAAGG - Intergenic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949477076 3:4458051-4458073 CTCAATTTAAAAATGGGCAAAGG + Intronic
950104334 3:10378718-10378740 CTGAATGTGGGAAAGGACAAGGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952047871 3:29345876-29345898 CAGACTGTACAAATGGCCAGAGG + Intronic
952462673 3:33545571-33545593 CTCAATGTAGAAATTGAGAAAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953576518 3:44117066-44117088 TAGAATCTACAAATGCACAAAGG - Intergenic
954253349 3:49385517-49385539 CTGAGTTTAAAAATGGGCAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958745010 3:98123377-98123399 CTGATTTTAAAAATGGGCAAAGG + Intergenic
958776667 3:98492373-98492395 TTGATTTTACAAGTGGACAAAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960324343 3:116276869-116276891 CTGAATGGACCAATTAACAAGGG + Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960482200 3:118205644-118205666 CTTAATGAATAAATGGGCAAAGG - Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961247310 3:125466621-125466643 CTCAATTTAAAAATGGGCAAAGG + Intronic
961700012 3:128736318-128736340 CTGAATGATAAAATGTACAAAGG - Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965315568 3:167185821-167185843 ATTAATGTACATATGGAAAATGG - Intergenic
965396629 3:168166911-168166933 CTAAATGTAGAAATGGAGAGTGG + Intergenic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970083818 4:12322319-12322341 CAGAATGTATTAATGGATAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970632760 4:17969712-17969734 CTGAGTTTACGAATGAACAAAGG - Intronic
971224893 4:24742898-24742920 CTGAATGTACACGTGAACAGTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975204916 4:71634501-71634523 GTGAGTGTACACTTGGACAACGG + Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977189581 4:93982920-93982942 CTGAATGCACAGTTGGCCAATGG - Intergenic
978400815 4:108328662-108328684 CTGAGTGTCCAAAGGCACAAAGG - Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
980208367 4:129752206-129752228 CTGAATGTGTAAAAGCACAAAGG + Intergenic
980332574 4:131428429-131428451 ATAAATGTATAAATGGCCAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983581527 4:169314211-169314233 CTCAATTTAAAAATGGGCAAAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984757905 4:183341062-183341084 CCGAATTTAAAAATGGGCAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988337067 5:29920932-29920954 CTTATTGTACAAATGGGCCATGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
990349529 5:54901729-54901751 CTGAATGGCCAAATGGACTTAGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990979659 5:61591352-61591374 CTGAGGGTACAAGTGGACAGAGG + Intergenic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
995704867 5:114977844-114977866 CTGATTTTATAAATGGGCAAAGG + Intergenic
995860384 5:116634696-116634718 CTGAACGTATAAGTGGGCAAGGG - Intergenic
996117466 5:119634139-119634161 ATGCAGGTACAAATGAACAAAGG + Exonic
996296504 5:121923282-121923304 CAACATGTACAAATGTACAAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997869481 5:137494808-137494830 ATGAAGGTACAAATGAACAGAGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999204362 5:149837378-149837400 CAAAAAGTACAAATGGATAAGGG - Intronic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
999858832 5:155623669-155623691 GGGAATGCACAAATGGACAGAGG - Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004887737 6:20067982-20068004 CTCCATGTACCACTGGACAAAGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005536494 6:26762415-26762437 ATGCATGTACACATGCACAAAGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1007859943 6:44898267-44898289 CTGAATGTAACAATGGTGAAAGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009327331 6:62369290-62369312 AAGAATGTTCAACTGGACAAGGG - Intergenic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011755024 6:90489737-90489759 CTTAATTTAAAAATGGGCAAAGG - Intergenic
1012515663 6:100055863-100055885 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1012948193 6:105490054-105490076 CTGAATGTACACATCTACATAGG - Intergenic
1013299464 6:108790281-108790303 CACAATTTAAAAATGGACAAAGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013986845 6:116204315-116204337 TTGAATGTAGAAATGTAAAAGGG + Intronic
1014198851 6:118587066-118587088 CTTACTGTACAAATGGGCCATGG - Intronic
1014605495 6:123469010-123469032 CTGAAAGAACAAATTGACACAGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015207947 6:130662085-130662107 CTGAATGTGCAACGGAACAAAGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1020605228 7:10328477-10328499 TTGAATGTCAAAAAGGACAAGGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021322025 7:19224069-19224091 CAAAATGTAGATATGGACAACGG - Intergenic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1023799768 7:43823754-43823776 GTGAATGCACACCTGGACAAGGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024189550 7:46992228-46992250 ATACATGTACAAATGGATAATGG + Intergenic
1024646640 7:51376472-51376494 ATGAATGTGCAAATGGAAACTGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027971110 7:85083358-85083380 ATGCATGGACCAATGGACAATGG + Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029930732 7:104367927-104367949 CTTAAAGTTCAAAAGGACAAGGG - Intronic
1030322149 7:108180276-108180298 CTGAATGTCCGAGTGGTCAATGG - Exonic
1030463124 7:109865810-109865832 CTCAGTGTACAAATAGAAAAAGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1034061050 7:148090425-148090447 CTTGATTTAAAAATGGACAAAGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035114224 7:156509295-156509317 CTGACTGAATAAATGGACAGTGG - Intergenic
1038274763 8:26111977-26111999 CTCAATTTAAAAATGGGCAAAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039006106 8:33038850-33038872 GTGAATGCACACCTGGACAAGGG - Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041185398 8:55294922-55294944 CTTAATGTGCAAAGGGACACTGG - Intronic
1041282138 8:56221064-56221086 CTCAATTTAAAAATGGGCAAAGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042074262 8:64972441-64972463 CCCAATGAAAAAATGGACAAAGG - Intergenic
1043103692 8:76081618-76081640 CATAATTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046151086 8:110227076-110227098 CCCAATTTACAAATGGTCAAAGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047789503 8:128188279-128188301 CTCAATTTACTAATGGTCAATGG - Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050609277 9:7334586-7334608 CTTAATGTGCAAATGGGCCACGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1053111272 9:35461732-35461754 GTGAATGCACACTTGGACAAGGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG + Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057239237 9:93393383-93393405 CTGACTGTTGAAAGGGACAAGGG - Intergenic
1057425683 9:94947542-94947564 CTGAATGTAAAAATGAAATATGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060770884 9:126331439-126331461 CTTAATTTAAAAATGGGCAAAGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187201881 X:17142524-17142546 CTCAATTTAAAAATGGGCAAAGG + Intronic
1187420913 X:19132988-19133010 TTGAGTGTACAGATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187516246 X:19974039-19974061 CTGAGTGTACCAAGGGGCAATGG - Intergenic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188047607 X:25445681-25445703 CTCCATCTAAAAATGGACAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1189361178 X:40353221-40353243 CTGATAGTACAAACAGACAAAGG + Intergenic
1189760486 X:44316797-44316819 TTGAATTTAAAAATGGGCAAAGG + Intronic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1194805708 X:98325035-98325057 CTGAATGTACATCTGTACTATGG + Intergenic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1196398555 X:115290688-115290710 CTGACTTTAGAAATGGAGAAGGG + Intronic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197847636 X:130820129-130820151 CCGATTTTAAAAATGGACAAAGG + Intronic
1197971147 X:132116412-132116434 TTTCATGTACAAATGGAAAATGG - Intronic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199888665 X:152051074-152051096 CTCCATTTACAAATGGTCAATGG - Intergenic
1199901005 X:152172126-152172148 CTCAATTTAAAAATGGGCAAAGG + Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200362020 X:155617056-155617078 AAGAATGTATAAATGCACAAGGG - Intronic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic