ID: 935200871

View in Genome Browser
Species Human (GRCh38)
Location 2:100855549-100855571
Sequence TTGTGGAATAAATGCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 11, 3: 82, 4: 479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935200871_935200875 17 Left 935200871 2:100855549-100855571 CCCATCATGCATTTATTCCACAA 0: 1
1: 0
2: 11
3: 82
4: 479
Right 935200875 2:100855589-100855611 ACTTCAGAGCCTAATCAAAATGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935200871 Original CRISPR TTGTGGAATAAATGCATGAT GGG (reversed) Intronic
900573429 1:3371264-3371286 ATGTGGAATGAATGGATGAATGG - Intronic
902973693 1:20073548-20073570 TTGTGGAATAAAAGAATGATGGG - Intronic
903099234 1:21013802-21013824 TTGTGGACTGATTCCATGATGGG - Intronic
903542296 1:24103339-24103361 TTTTGGAATAAATGCCAGCTGGG + Intronic
903766388 1:25737524-25737546 TTGTTGAATGAATGAATGAATGG - Intronic
905078405 1:35294985-35295007 TTGTTGAATGAAAGCATGAATGG - Intronic
905108578 1:35578130-35578152 TTGTTGAATGAATGAGTGATGGG + Intronic
905631679 1:39522286-39522308 TTGTCAAATAAATGAATGACAGG - Intronic
905666074 1:39763886-39763908 TTGTCAAATAAATGAATGACAGG + Exonic
905801801 1:40848924-40848946 TTGTAGAATAAGTGAATGAAGGG - Intergenic
905989583 1:42323335-42323357 TTGTTGAATGAATGAATGAATGG - Intronic
906716321 1:47972309-47972331 TTGTTGAATGAGTGAATGATTGG - Intronic
907183223 1:52588967-52588989 TTGTGGAATAAATGAATGAATGG + Intergenic
907420100 1:54341492-54341514 TTGTGGAATGAATGGATGGCAGG - Intronic
907436833 1:54455175-54455197 TTGTTGAATGAATGAATGAATGG + Intergenic
908053001 1:60253181-60253203 TTGTTGAATAAATACAGGAGTGG + Intergenic
908123689 1:61009034-61009056 TTGTTGCATAAATGAATGACTGG + Intronic
909507374 1:76408802-76408824 TTGTGTAATAAAAGCATGGTTGG - Intronic
910071102 1:83214200-83214222 ATGTTGAATAAATGAATGAATGG + Intergenic
910090449 1:83456750-83456772 TTGTTGAATAAATGAATGAATGG - Intergenic
910206492 1:84753619-84753641 ATTTTGAATAAATGCATGTTAGG + Intergenic
910433582 1:87182344-87182366 TTGTGAAATAAATGAATGCATGG + Intergenic
910536905 1:88309024-88309046 TTGTTGAATAAATGAATGAATGG - Intergenic
910580756 1:88821834-88821856 TTGTGAAATAAATTAATGATAGG + Intronic
911165065 1:94717542-94717564 TTGTAGAATAAAAGAATGAAAGG + Intergenic
911378061 1:97075926-97075948 TTGTTGAATAAATAAATGGTTGG + Intergenic
911721114 1:101192213-101192235 TTGTTGAATAAATGAGTGAATGG - Intergenic
911773531 1:101778294-101778316 ATGTGAAATAAGTGCATCATGGG + Intergenic
911894643 1:103416653-103416675 TTGTTGAATAAACGAATGAATGG - Intergenic
912554006 1:110503132-110503154 TTGTGGAATAAAGGAAGGAAAGG - Intergenic
913523453 1:119668132-119668154 ATGTGTAAAATATGCATGATTGG + Intronic
913711571 1:121489342-121489364 TTGTGAAATATATCCCTGATAGG + Intergenic
914984542 1:152444625-152444647 TGGTAGAATAAATGGATGAATGG + Intergenic
915228961 1:154431636-154431658 TTGTGAAATGCCTGCATGATGGG + Intronic
915579922 1:156807464-156807486 TTGTTGAATTAATGAATGAGAGG - Intronic
916010945 1:160705191-160705213 TTGTTGAATAGATGGATGAATGG - Intronic
916804897 1:168249901-168249923 TTGTTAAATAAATTAATGATCGG - Exonic
917729982 1:177865424-177865446 TTATTGAATAAATGAATGATGGG - Intergenic
917792329 1:178506968-178506990 TTGTGGAAAAAAATCATGAGAGG + Intergenic
918111504 1:181458869-181458891 TTGTTGAATAAATGGATGGGTGG - Intronic
918370947 1:183860908-183860930 TGATGGAATAAATGAATGAAAGG + Intronic
918522842 1:185433384-185433406 TGGTAGATTAAATGCATTATCGG - Intergenic
918535719 1:185572403-185572425 TTGAGGAAAACATTCATGATAGG + Intergenic
918880408 1:190112020-190112042 TTGTGGAATAAATAGATAAAAGG + Intronic
919535735 1:198785694-198785716 TTATTGAATAAATGAATGAATGG - Intergenic
920097357 1:203495186-203495208 TTGTTGAGCAAATGCATGAATGG + Intronic
920186478 1:204162444-204162466 TTACGGAATAAATGAATGAACGG - Intronic
920966062 1:210701669-210701691 ATGTGAAATAAATTCATGATGGG - Intronic
921468614 1:215521721-215521743 TTAGGGAATGAATGAATGATTGG + Intergenic
921627910 1:217398862-217398884 TTGTTGAATGAATAAATGATTGG + Intergenic
921905574 1:220492235-220492257 TTGTGGCAAAGATGGATGATGGG + Intergenic
921992152 1:221378660-221378682 TTGTGTAATAGATGCAAAATTGG + Intergenic
922436761 1:225614906-225614928 TTGTGGAATAGAGGTAGGATTGG - Intronic
924599069 1:245472279-245472301 TTGAGGAATAAATGAGTGAATGG + Intronic
1062940324 10:1416274-1416296 TTTTTGAATAAATGAATTATTGG + Intronic
1063808278 10:9673268-9673290 TGGTTGAATAAATGGATGAATGG + Intergenic
1064964759 10:21003856-21003878 TTGGGGAAGAAATGTATGAAAGG + Intronic
1065059348 10:21882315-21882337 TTGAGGAACAAATGGATGATTGG - Exonic
1065242414 10:23720033-23720055 TGGTGGAATAATTGCTTAATAGG + Intronic
1065245196 10:23749152-23749174 TGGTAGTATAAATGCTTGATTGG - Intronic
1065338972 10:24685106-24685128 TTGAGGAAGAAATACATGAATGG - Intronic
1065687518 10:28301584-28301606 TTTTGGATTAAATCCATTATAGG + Intronic
1066005075 10:31139504-31139526 TTTGGGAATTAATGGATGATTGG + Intergenic
1066349061 10:34619962-34619984 TTGTTGAGTGAATGCATGAAGGG - Intronic
1066354502 10:34668912-34668934 TTGTTGAATGAATGAATGAATGG - Intronic
1066753884 10:38689871-38689893 TTTTGGCATAAATGTATTATAGG + Intergenic
1067482352 10:46611172-46611194 TTTTGAAATAAATGAATGACAGG - Intergenic
1067612397 10:47730492-47730514 TTTTGAAATAAATGAATGACAGG + Intergenic
1068587378 10:58814415-58814437 TTGTGAAATGAATGCATGAATGG + Intronic
1070525666 10:77293805-77293827 TTTGGGAAAGAATGCATGATGGG - Intronic
1071338657 10:84622654-84622676 TTGTTGAATAAATGGATGGATGG - Intergenic
1071627818 10:87190739-87190761 TTTTGAAATAAATGAATGACAGG + Exonic
1072628020 10:97126711-97126733 TTGTGGAATACATGAATGAGTGG + Intronic
1072951966 10:99855478-99855500 TTCTAAAATAAATTCATGATCGG - Intergenic
1072978435 10:100079343-100079365 TTGTGGAATGAATGAATTAAAGG + Intronic
1073226754 10:101927429-101927451 TTGGAGAAGAAATGGATGATTGG - Intronic
1073375097 10:103026968-103026990 TTGTTGAATGAATTCATGACTGG + Intronic
1073631169 10:105150617-105150639 GTGTGGAATAAATGCTTGTCAGG + Intronic
1073711414 10:106046900-106046922 TTGTGCAATGAATAAATGATGGG - Intergenic
1074799507 10:116985221-116985243 ATGTTGAATAAATGAATGAATGG + Intronic
1075831878 10:125419010-125419032 TTGTTGAATAAATGAATGAATGG - Intergenic
1076124236 10:127961882-127961904 CTGTGGAATGAATGAATGAGTGG + Intronic
1076540643 10:131212411-131212433 ATCTAGAACAAATGCATGATGGG + Intronic
1077646266 11:3928081-3928103 TTGTGGAATGAAAGAATGATGGG + Intronic
1078093466 11:8282292-8282314 TTGAGAAATAAATGGATGAATGG + Intergenic
1078844752 11:15111004-15111026 TGGTGGAACAAATGCAGGAGAGG + Intergenic
1078871184 11:15346474-15346496 TTGTGGACTAAATACACAATTGG - Intergenic
1078958940 11:16240127-16240149 TTGAGTAAAACATGCATGATCGG + Intronic
1079045008 11:17094062-17094084 TTGTTGAATGAATAAATGATCGG - Intronic
1079154235 11:17929587-17929609 TTGCTGAACAAATGCATGAATGG - Intronic
1079299883 11:19268588-19268610 TTGTTGAATGAATGAATGAAGGG + Intergenic
1080768695 11:35320741-35320763 TTGTGGAATAAATGCACGAATGG - Intronic
1081434042 11:43007344-43007366 TTGTGGAATAAACGAATAAATGG - Intergenic
1081493902 11:43587175-43587197 TTGTTGAACGAATGCATGAATGG - Intronic
1082231047 11:49767006-49767028 TTGTTGAATAAATACATTTTAGG - Intergenic
1082852220 11:57775582-57775604 TTGTGGAACAAATTCAGGAGAGG + Intronic
1083471465 11:62887059-62887081 CTGTGGAATAAATGAATAACTGG - Intronic
1084177634 11:67431676-67431698 TTGCTGAATGAATGAATGATGGG - Intronic
1084185838 11:67470525-67470547 TTGTGGCAGAAATGAATGAGGGG - Intergenic
1084409228 11:68996880-68996902 CTGAGGTATAAATGCAGGATGGG + Intergenic
1085065799 11:73494625-73494647 TTGGGGAAAAAATGGAGGATGGG + Intronic
1086402529 11:86472376-86472398 TTCTGGCAGAAATGGATGATGGG + Intronic
1087040755 11:93797219-93797241 TTGTGGTTCAAAAGCATGATTGG + Intronic
1087142941 11:94783818-94783840 TTGTGGAATGAATGACTGAATGG + Intronic
1087273121 11:96132258-96132280 TTGTTGAATAAATGAATTAAAGG - Intronic
1087864600 11:103208309-103208331 TTGTGGAATGAAGAAATGATTGG + Intronic
1088081679 11:105924292-105924314 ATGTAGAATAAACGCATGACTGG + Intronic
1088537056 11:110872828-110872850 TTGTGGAATTATTGAATGAGAGG + Intergenic
1088947290 11:114527258-114527280 TTGTGGAATAAATGAATAAATGG + Intronic
1091620687 12:2086234-2086256 TTGTTGAAAAAATGGATGAATGG + Intronic
1091936304 12:4436934-4436956 TTGTGGAATGGATGAATGAAGGG + Intronic
1093186944 12:16030855-16030877 TTGTTGAACAAATGCATGCATGG + Intronic
1093803872 12:23408810-23408832 TTGTGGAATAAATAAATGAATGG - Intergenic
1093909348 12:24727868-24727890 TTGTTGAATGAATGAATGAATGG + Intergenic
1093950550 12:25161306-25161328 TTGTTGAATGAATGCATGAAAGG - Intronic
1094118279 12:26940377-26940399 TAGTGGAATGAATACATGTTTGG - Intronic
1094416230 12:30218033-30218055 TTATAGAATAACTGCATGTTGGG + Intergenic
1096440290 12:51636693-51636715 TTGTGGCATAAATGAAAGAATGG - Intronic
1096454845 12:51776260-51776282 TTGTGAAATAAATGCTGGCTTGG - Intronic
1097000600 12:55873257-55873279 TATTGGAATAAATGCATCATTGG - Intergenic
1097801435 12:63918760-63918782 TTATGGAATAAATGAATAAATGG - Intronic
1097940000 12:65293802-65293824 GTGAGGAATAAATGCAGCATGGG + Intronic
1098169758 12:67735623-67735645 TTGTTGAATAAATGAATCAAGGG - Intergenic
1098617749 12:72551590-72551612 ATGTGGAATAAATGAATGACTGG - Intronic
1098749317 12:74275055-74275077 TTGAGGAACAAATGGATGATTGG + Intergenic
1099010387 12:77284681-77284703 TTGTTGAATGAATAAATGATAGG + Intergenic
1099041682 12:77662579-77662601 TTGTTTAATAAATGCTTGTTGGG + Intergenic
1099728546 12:86466759-86466781 TTGAGGAGTCTATGCATGATTGG + Intronic
1100103504 12:91139828-91139850 TAGTGGAGTAAATGAATGAATGG + Intergenic
1100216923 12:92460305-92460327 TTGTTGAATGAATGAATGAATGG + Intergenic
1100543376 12:95578966-95578988 TTGTTGGATAGATGCATGAATGG + Intergenic
1100580191 12:95931576-95931598 TTGTTGAATGAATGAATGAGTGG - Intronic
1101181576 12:102224385-102224407 TTGTGGAGAAAAAGCAGGATGGG + Intergenic
1101672837 12:106892690-106892712 TTGTTGAATGAATGAATGAATGG - Intergenic
1101905282 12:108820177-108820199 TTGTGGAAAGAATGCTTAATTGG - Intronic
1101925067 12:108964967-108964989 TTATTGAATAAATGAATGAATGG - Intronic
1102710479 12:114921804-114921826 TTGTTGAATAAATGAATACTTGG - Intergenic
1103162224 12:118739118-118739140 TTGCTGAATGAATGAATGATGGG - Intergenic
1103192610 12:119014921-119014943 TTGTGGAAGAATTGAGTGATTGG + Intronic
1103221718 12:119251896-119251918 TTGTTGAATGACTGCTTGATTGG + Intergenic
1103334616 12:120179850-120179872 TTGTGGAATTAATGAAGGACAGG - Intronic
1103971367 12:124674721-124674743 TTGTTGAATGAATGAATGTTGGG - Intergenic
1104465965 12:128990882-128990904 TTGTAGAATGAATGAATGAATGG - Intergenic
1104512935 12:129398029-129398051 TTGTGGCATAAAAGCAACATGGG - Intronic
1104642383 12:130475701-130475723 TTGGGGAACAAAGGAATGATGGG + Intronic
1105653812 13:22411276-22411298 TTGTTAAATAAATGCATAAATGG - Intergenic
1106104269 13:26720163-26720185 TTTAGGATAAAATGCATGATCGG + Intergenic
1106567223 13:30896682-30896704 TTATGGAATGAATGAATGACTGG + Intergenic
1106774693 13:32997522-32997544 GTGTTGACTAAAAGCATGATTGG + Intergenic
1107004760 13:35596864-35596886 TTGTGGAATTAATGAATGCCAGG + Intronic
1107781512 13:43908447-43908469 TTGTAGAATAAATGGATGAGTGG - Intergenic
1108027934 13:46198253-46198275 TTGTTGAACAAATGAATGAATGG - Intronic
1109218215 13:59614362-59614384 TTGTGGAATAAGTCAATGAATGG - Intergenic
1109387935 13:61657024-61657046 ATGTGGTATATATACATGATGGG - Intergenic
1110187881 13:72695784-72695806 TTGTGGACTGAATGAATGATGGG + Intergenic
1111682776 13:91464350-91464372 TTGTCCAATAAATGCACGCTTGG + Intronic
1111839685 13:93434383-93434405 TGGTGGAATAAGTGTATAATTGG + Intronic
1112071691 13:95858880-95858902 TTAAGGAATAAAAGCATGCTTGG + Intronic
1112372439 13:98805732-98805754 TTATGGGAAAAATGAATGATAGG - Intronic
1112427492 13:99316396-99316418 TTGTTGAATGAATGAATGAATGG + Intronic
1113401060 13:109993681-109993703 TTGTAGAATTAATGAATGAAAGG + Intergenic
1114164546 14:20206604-20206626 TTGTTGAATAAATTAATGGTTGG - Intergenic
1114320485 14:21543241-21543263 TTGTGCAAGCAATGCCTGATTGG + Intergenic
1114349890 14:21838092-21838114 TTGTTGATTAAATGTATGCTTGG - Intergenic
1114363499 14:22002287-22002309 TGGTGGAAAAAATGAATGAATGG - Intergenic
1114810592 14:25894557-25894579 TTGGAGAATAAAGGCAAGATGGG - Intergenic
1115466890 14:33725104-33725126 TAGGGGAATAAATGGATGTTGGG - Intronic
1118233782 14:63980370-63980392 TTGTGGAAAAAAGGCAAGTTAGG - Intronic
1118442336 14:65823054-65823076 GTATGAAATAAATACATGATTGG - Intergenic
1118910549 14:70058742-70058764 TGGTGGAATAAAGGCATGTATGG + Intronic
1120354985 14:83421015-83421037 TTGTGGAATAAATAAATAAATGG + Intergenic
1120382443 14:83798114-83798136 ATGTGTAATAAATGAATGAATGG - Intergenic
1120575800 14:86179655-86179677 TTGTTAAATAAATGCTTGTTTGG - Intergenic
1121811610 14:96896182-96896204 TTGTTGAATAAATGAATGAATGG + Intronic
1121981219 14:98456170-98456192 TTGTGGATTAAGTGAATGAAAGG + Intergenic
1122037475 14:98959156-98959178 TTGCAGAATAAATGAATGAGTGG + Intergenic
1124931992 15:34129466-34129488 TTGTGGAGTAAGTCAATGATTGG - Intergenic
1125310097 15:38370022-38370044 TTGCGGAATAAATGAATGATTGG + Intergenic
1125863527 15:43020538-43020560 CTGTGGAGTAAATGGATTATGGG - Intronic
1126258567 15:46658178-46658200 TTGTGGAATGAATGAATGATTGG + Intergenic
1126276553 15:46890323-46890345 TTGTAGACTAAATGAAGGATTGG - Intergenic
1126301842 15:47206083-47206105 TTTTGGAATACATGGATGACTGG + Intronic
1126335276 15:47580628-47580650 TTGTTGAATAAATGAATGAATGG - Intronic
1126465670 15:48959461-48959483 TTGTTAAATAAATGGATGAATGG + Intronic
1126594423 15:50371353-50371375 TTGATGAATAAATGCATAAGTGG - Intergenic
1127353885 15:58179751-58179773 CTGTGGAATAAGTGCAGCATAGG - Intronic
1129353700 15:74973270-74973292 TTGTGGAGTGAATGAAGGATAGG + Intronic
1129407125 15:75327338-75327360 TTGGTGAATAAATGAATGATTGG + Intergenic
1129492514 15:75942565-75942587 TTGTGAAATGAGTGAATGATGGG + Intronic
1130403212 15:83576368-83576390 TTGTGGAATGAATGAATGAATGG - Intronic
1130631326 15:85571758-85571780 TTGCTGAATGAATGGATGATGGG + Intronic
1131105563 15:89731703-89731725 TTGTTGAATAAATGAATGAGAGG - Intronic
1133423414 16:5666245-5666267 GTGTGGAGTAAATGCATGATTGG + Intergenic
1133617113 16:7487497-7487519 TAGTTGAGTAAATGCATGAATGG + Intronic
1133920203 16:10146104-10146126 ATGTTGAATAAATGGATGAGTGG - Intronic
1134133698 16:11666533-11666555 ATGTTGAATGAATGAATGATCGG - Intergenic
1134347386 16:13403408-13403430 TTGTGGAATGAATGAATGGATGG + Intergenic
1134358015 16:13502450-13502472 TTGTTGAATAAATAAATGATTGG - Intergenic
1135197179 16:20404153-20404175 TTGTTGAATGAATGAATGAATGG + Intronic
1135851746 16:25970013-25970035 TTGTGGACTAAATGAATGCATGG + Intronic
1135898501 16:26432825-26432847 TTGTTGAATGAATGAATGAATGG + Intergenic
1137570418 16:49562638-49562660 TTGTGGAAGAGATTCATGAACGG + Intronic
1138629674 16:58283125-58283147 TGGTAGAATAAAGGCAGGATGGG + Exonic
1138932004 16:61670353-61670375 TTGTTGAATAAATACATAATAGG + Intronic
1139066452 16:63321506-63321528 TTGTGGAATATATACATGGTGGG - Intergenic
1139604951 16:68011551-68011573 TTGTTGAATAAATGAATGAATGG + Intronic
1140378545 16:74465346-74465368 ATGTGCAATAAATAAATGATTGG - Intronic
1140403576 16:74692003-74692025 TTGTTGAATGAATGAATGAGTGG + Intronic
1140631160 16:76854218-76854240 TTCTGGAAAAAATGCATCCTAGG + Intergenic
1140879399 16:79184298-79184320 TTGTTGAATAAATGAATGGTAGG - Intronic
1140978057 16:80079739-80079761 TTGTTGAATGAATGAATGAATGG - Intergenic
1141433812 16:83986430-83986452 TTGGTGAATAAATGCATGAATGG + Intronic
1144235031 17:13252078-13252100 TTGTTGAATAAATGAATAAATGG + Intergenic
1144359979 17:14482831-14482853 TTGTGCAATATGTGCAGGATAGG + Intergenic
1145011011 17:19367937-19367959 TTGTTGAGTGAATGCATGAGTGG + Intronic
1146894215 17:36529562-36529584 TTTTGGAAGAAATGCATTACTGG - Intronic
1147895215 17:43746165-43746187 TTGTTGAATTAATGGATGTTTGG - Intergenic
1147904467 17:43813854-43813876 TTGTGGGACAAAGGCATGATGGG - Intronic
1148430165 17:47636307-47636329 ATGGAGAATAAATTCATGATTGG - Intergenic
1148459973 17:47833982-47834004 TTGTGGAATGAATGAATGGGTGG + Intronic
1148897349 17:50846559-50846581 TTGTCGAATGAATGAATGAATGG + Intergenic
1149781861 17:59403996-59404018 GTGCTGAATAAATGCTTGATGGG + Intergenic
1149842061 17:59974123-59974145 TTATGGAATAAACGAATGAATGG + Intergenic
1150177212 17:63071202-63071224 GTGGGGAATAGATGCATGATAGG + Intronic
1150988122 17:70222731-70222753 TTATTGAATAACTCCATGATTGG - Intergenic
1151219495 17:72601923-72601945 TTGTTGAACAAATGAATGAATGG - Intergenic
1152461019 17:80442512-80442534 CTGTGGAATGAATGAATGAATGG - Intergenic
1153093359 18:1373176-1373198 GTGTTGAATAAATGAATGAATGG - Intergenic
1153244549 18:3060972-3060994 TTGTTGAATGAATGAATGAATGG + Intergenic
1153277115 18:3378352-3378374 TTGGGGAATGAATGGATGACTGG + Intergenic
1153484987 18:5588587-5588609 TTGTTGAATAAATGAATGGATGG - Intronic
1153799444 18:8656604-8656626 TTGTGGTCTAAATGATTGATTGG + Intergenic
1155366397 18:25053200-25053222 GTGTTGAATAAATGCATGTTAGG - Intergenic
1155876431 18:31095635-31095657 TTGTTGAATTCATGCATGAATGG - Intronic
1156693570 18:39738205-39738227 TTGTGTTATATATGCATGTTTGG + Intergenic
1156776142 18:40791570-40791592 TTGTTGAATAAAAAAATGATTGG + Intergenic
1157149857 18:45205783-45205805 TTGTTGAATAAAAGAATGAATGG - Intergenic
1157176465 18:45456875-45456897 CTTTGGAATAAATGCAAGTTGGG + Intronic
1158821705 18:61166942-61166964 TTGATGAATAAATGAATGGTAGG + Intergenic
1159013517 18:63081935-63081957 TTGAGGAACAACTGCTTGATAGG + Intergenic
1159326467 18:66925851-66925873 TTGTTGAATAAATGATTGAAAGG + Intergenic
1159645128 18:70909418-70909440 TTGTTGAATAAATATTTGATCGG + Intergenic
1160335846 18:78038552-78038574 TTGTTGAATAAATGAAGGAATGG - Intergenic
1160687093 19:442147-442169 CTGTTGAATGGATGCATGATGGG + Intronic
1160962521 19:1729878-1729900 TTATGAAATAAATGCATGAGTGG - Intergenic
1161468602 19:4445481-4445503 TTGTGAAATAAAAGCAGGGTTGG - Exonic
1161861414 19:6801199-6801221 TTGCTGAATTAATGCATGACCGG + Intronic
1162535295 19:11260051-11260073 TTGTGGAATAAATGACTGAATGG + Intronic
1164574375 19:29397184-29397206 TTGTTGAATGAATGAGTGATTGG - Intergenic
1164811962 19:31164514-31164536 TTGTTGAATAAATGAATGAATGG + Intergenic
1164887622 19:31795864-31795886 TTGTGTTCTAAATGCATGGTGGG - Intergenic
1165335175 19:35164715-35164737 TTGTTGAATGAATGGATGAATGG - Intronic
1166041071 19:40203351-40203373 ATGTTGAATGAATGCATGAGTGG + Intronic
1166536203 19:43576497-43576519 TTGTGGAAGAACTCCAGGATAGG - Intronic
1166575278 19:43831511-43831533 TTATGGAATTAATGCAGGCTTGG + Intronic
1166938264 19:46347800-46347822 TTGTTGAATTAATGAATGAATGG - Intronic
1168247217 19:55118478-55118500 TTTTGGAATGAATGAATGAATGG + Intergenic
925196115 2:1927247-1927269 TTGTAGAATAACTGGCTGATAGG - Intronic
926222144 2:10943305-10943327 TTGTTGAATGAATGCATGTTAGG + Intergenic
926385332 2:12330236-12330258 TTGTTGAATTAATGAATGAATGG - Intergenic
926547306 2:14257414-14257436 TTCAGGAATAAAAGCATAATAGG - Intergenic
926577061 2:14593991-14594013 TTGAGGAAAAAATACCTGATGGG + Intergenic
926851052 2:17197642-17197664 TTGTTAAATAAATGAATGAATGG + Intergenic
927502515 2:23592047-23592069 TTGTTGAATGAGTGAATGATGGG + Intronic
928066456 2:28169425-28169447 TTGGGGAATAAATGCTTGTCAGG - Intronic
928739551 2:34334041-34334063 ATGTGAAATAAATGCATGATGGG - Intergenic
929297741 2:40267619-40267641 TTGTGGAATGAATGAATGAATGG + Intronic
929644041 2:43609725-43609747 TTGTTGAATAAATGGATGAATGG - Intergenic
930093813 2:47551559-47551581 TTGTTGAATAAATGGATCAATGG + Intronic
930589678 2:53312437-53312459 TGATGGAATGAATGAATGATGGG + Intergenic
930954511 2:57189232-57189254 TTGTGAAATAACTGCCTGAGTGG + Intergenic
931113855 2:59143358-59143380 TTGAGGAAAGAATGCAAGATAGG + Intergenic
931181123 2:59901742-59901764 TTGTTGAATAAATGAATGGATGG + Intergenic
931243582 2:60474742-60474764 TTGTTGAATGAATGCATGAGAGG - Intronic
931803850 2:65785723-65785745 TTGTTGAATGAATGCATGAATGG + Intergenic
931835779 2:66097124-66097146 TGGTGGAATAAATTAATGAATGG - Intergenic
933196660 2:79397951-79397973 TTGTGGAACAAATGAATAAGTGG + Intronic
933328751 2:80870950-80870972 CTGTGGAATAAATGCTTAATTGG + Intergenic
935092790 2:99912527-99912549 TTTTGAAATCACTGCATGATTGG - Intronic
935200871 2:100855549-100855571 TTGTGGAATAAATGCATGATGGG - Intronic
935396007 2:102609975-102609997 TTGTTGAATAAATGAATCAATGG + Intergenic
936720206 2:115242367-115242389 CTGTGGGATATATACATGATGGG - Intronic
937160238 2:119753733-119753755 TTCTTGAATAGATGCATGAATGG - Intergenic
937230856 2:120397391-120397413 TTGTGGAATAAATGAACGAGTGG - Intergenic
939603307 2:144220972-144220994 TTTTGGAGTAAATGCCTGCTGGG + Intronic
940290295 2:152071954-152071976 TTATGGAATAAATGAATGAATGG - Intronic
940466927 2:154042741-154042763 TTATTGAATAAATGAATGAAAGG + Intronic
940844421 2:158624309-158624331 TTGTGGAATAAATGAACATTTGG - Intronic
941101257 2:161298053-161298075 TTGAGTAATAAATGGAAGATAGG + Intergenic
942282411 2:174378941-174378963 TTCTGGAATCAATGCAAGTTCGG - Exonic
943332890 2:186581256-186581278 TTGTGGAATAAATGTAAAAGGGG + Intergenic
943712554 2:191113202-191113224 TTGTGGAACAAATGAATGAGTGG - Intronic
943725034 2:191244781-191244803 TTGTGTTATAAATACATGAGAGG - Intergenic
943936922 2:193930965-193930987 TTGAGGAGTAAAAGCATGTTAGG + Intergenic
944545014 2:200790541-200790563 TTGTGAAATAAATACATATTAGG + Intergenic
944648623 2:201806036-201806058 TTTTTGAATAAATGAATGAATGG + Intronic
946029480 2:216693386-216693408 GTGTGGATTAAGTGCATGAGGGG - Intronic
946504177 2:220281319-220281341 TTGTTGAACAAATGAATGAAGGG - Intergenic
946575173 2:221067722-221067744 TTATAGAATAAAGGCCTGATAGG - Intergenic
947464947 2:230335312-230335334 TTTTCTAATAAATGCATGTTAGG + Intronic
948050847 2:234978317-234978339 TTGTTGAATGAATGAATGAATGG - Intronic
949078525 2:242077555-242077577 TTGGTGAATAAATGAATGAATGG - Intergenic
1169245233 20:4019628-4019650 TTGTTGAATGAATGCCTGACTGG + Intergenic
1169530446 20:6479643-6479665 TTGTTGAATAAATAAATGAATGG - Intergenic
1170339167 20:15304169-15304191 TTTTGGAATAAATGCATGACTGG + Intronic
1170406757 20:16046012-16046034 CTATGGAATAAATGAATCATGGG + Intronic
1170978554 20:21189445-21189467 TGGAGGAACAAATGCGTGATGGG + Intronic
1171959045 20:31480727-31480749 TTGTGCAATGAATGAATGAATGG + Intronic
1172343317 20:34176768-34176790 CTGAGGAACAACTGCATGATGGG + Intergenic
1172944357 20:38675805-38675827 TTGCTCAATAAATGCATGAATGG + Intergenic
1173208633 20:41014470-41014492 TTGTTGAATAAATGAATTATGGG - Intergenic
1173361593 20:42349609-42349631 TTGTTGAATGAATGAATGAATGG + Intronic
1173565327 20:44034447-44034469 TTATGGAATGAATGAATGAATGG + Intronic
1174215886 20:48915905-48915927 TTGTGGAATGAATGAATGAATGG - Intergenic
1174780014 20:53381164-53381186 CTGTGGACTAACTTCATGATTGG - Intronic
1175065777 20:56286504-56286526 TTGTGGAATGAATGACTGAATGG + Intergenic
1175412279 20:58778081-58778103 TTGTTGAATGAATGAATGAATGG + Intergenic
1175562477 20:59941786-59941808 TTGTTGCATGAATGAATGATTGG + Intronic
1175936577 20:62517011-62517033 TGGTGGAATGAATGAATGAGTGG + Intergenic
1177518937 21:22192256-22192278 TTGTTGAATAAATGAATAAAAGG - Intergenic
1177853437 21:26376096-26376118 TTGTTGAATAAATGAATGAATGG - Intergenic
1178193287 21:30312216-30312238 TGATGAAATAAATGCATGAATGG + Intergenic
1178549190 21:33521128-33521150 TTCTGGAAGAAATAGATGATTGG + Intronic
1179511598 21:41877399-41877421 TGGTGGAAAGAATGCATGAATGG + Intronic
1182009360 22:26987408-26987430 TTGTTGAATGAATGGATGAATGG + Intergenic
1182093366 22:27610808-27610830 TTGTTGAATGAATAAATGATTGG + Intergenic
1182864896 22:33595514-33595536 TTGTGGAATAAATGCCTTCCAGG - Intronic
1184260404 22:43312145-43312167 TTGTAGAATAAATGAATGAATGG - Intronic
1185027163 22:48421517-48421539 TTGTGGAATGAATGAAAGGTTGG + Intergenic
1185304501 22:50106609-50106631 TTGTGGAATAAATGAAGGCATGG + Intronic
1185403638 22:50632262-50632284 TATTGGAATAAATACATCATTGG + Intergenic
949288483 3:2434768-2434790 TCGTGGAAGAAATGGATGATAGG - Intronic
949793093 3:7814981-7815003 TGGTAGAATAAATGCATGAATGG + Intergenic
950150064 3:10680073-10680095 TTGTTGAATGAATGAATGAATGG + Intronic
950941069 3:16892069-16892091 TTGTTGAATAAATGTGTGAATGG + Intronic
951382150 3:21996489-21996511 TTGTGGAAGAAATAAATGACGGG + Intronic
951456411 3:22896886-22896908 TTGTTGAATTAATGAATGAGTGG + Intergenic
951542497 3:23795490-23795512 ATGTGCAATAAATAAATGATAGG + Intergenic
952018226 3:28985102-28985124 GTGTGGGATAAATGCTTTATAGG + Intergenic
952664758 3:35891056-35891078 CTGTAAAATAAATGCATAATAGG + Intergenic
953544529 3:43854645-43854667 TTATAGAATAAATGCTTGAAAGG + Intergenic
953672979 3:44978045-44978067 TTGTGAAATAAATGAAAGATAGG + Intronic
954071453 3:48145960-48145982 ATGTGAAATAAGTGCATCATGGG + Intergenic
955136551 3:56224715-56224737 ATGTAGAATACATGCATGTTTGG - Intronic
955264203 3:57425784-57425806 TTGTTGAATAAATAAATGAATGG - Intronic
955311061 3:57886933-57886955 GTGGGGAATAAATGCTTAATGGG + Intronic
955639245 3:61064389-61064411 TGGTGGAATGAAAGCATGAAAGG + Intronic
955848232 3:63191637-63191659 TGGTTGAATAAATGGATGGTTGG - Intergenic
956387810 3:68739334-68739356 TTGTAGAGTATATGCCTGATTGG - Intronic
957551311 3:81709131-81709153 TTCTTGAATAATTACATGATTGG - Intronic
959112362 3:102136928-102136950 TTGTTGAATGAATAAATGATAGG + Intronic
959289908 3:104460551-104460573 TTGTGTAGCAAATGGATGATAGG - Intergenic
959342871 3:105153042-105153064 TTGTGCCATAAAGGCATAATGGG + Intergenic
960273064 3:115695688-115695710 TTGTGGATTAAACGCAGAATAGG - Intronic
960352774 3:116613202-116613224 TTGTGGAATGAATGCATGAATGG + Intronic
960452815 3:117831324-117831346 TTGTGGAGTAAATGAATGAGTGG - Intergenic
961771059 3:129250144-129250166 TTGCTGAATAAATGAATGATGGG - Intronic
961901698 3:130219213-130219235 TTGTGGATTGAATTCCTGATAGG + Intergenic
961995575 3:131238421-131238443 TTGTGGAATACGTGAATGAATGG + Intronic
962149482 3:132877938-132877960 TAGTAGAATTATTGCATGATGGG + Intergenic
962715271 3:138120269-138120291 TTGTGGCATACATTCATAATTGG + Intergenic
963617362 3:147558871-147558893 TTGAGGAATATATGCATGCTTGG + Intergenic
965329007 3:167346218-167346240 ATGAGGCATAAATGCATGAGAGG - Intronic
965467949 3:169055808-169055830 TTGTAGAATAAATGAATTATTGG + Intergenic
965594403 3:170395737-170395759 ATGTGGATTAAATGCATAAAGGG - Exonic
966268951 3:178081849-178081871 TTGTTGAATAAATGGATGACTGG + Intergenic
966700608 3:182845902-182845924 TTGTTGAATGAATGTATGAATGG - Intronic
967834454 3:193949167-193949189 TTGTGGAATTAATCAATGAATGG + Intergenic
968309116 3:197668147-197668169 TTGTGGAAAGAATGCAGGCTAGG + Intergenic
968347471 3:198022544-198022566 TTATTGAATAGATGAATGATGGG - Intronic
969264178 4:6054422-6054444 TTGCTGAATAAATGAATGATGGG + Intronic
969668133 4:8573959-8573981 TTGTGGAATAAGTGGGTGAAAGG + Intronic
969687402 4:8683391-8683413 TTGTTGAATAAATCCATGGATGG + Intergenic
969693515 4:8721632-8721654 TTGTTGAATAAATAGATGAGTGG + Intergenic
970302889 4:14700349-14700371 TTGTTGAATAAATGAATTAGTGG - Intergenic
970329652 4:14966404-14966426 TTGGTGAATAAATAAATGATAGG - Intergenic
971058806 4:22943634-22943656 TTGTTGAATGAATGAATGAAGGG + Intergenic
971322234 4:25614944-25614966 TTGGTGAATATATGCATGAGAGG + Intergenic
971823759 4:31594461-31594483 TTGTGGAATAATTAAATGAATGG - Intergenic
971834036 4:31738177-31738199 CTGTGGAATAAATGGATGGATGG + Intergenic
971867732 4:32193994-32194016 TTTTTGAATAAATGAATGAATGG + Intergenic
972584628 4:40426190-40426212 TTGTTGAATGAATGGATGATAGG - Intronic
973261914 4:48173698-48173720 CTATGGAATAAATGAATGAGTGG - Intronic
973651615 4:53002531-53002553 ATGCTGAATAAATGCAAGATTGG - Intronic
973659679 4:53090644-53090666 TTGTTGAATAAGTGAATGAATGG - Intronic
973725337 4:53770104-53770126 TTGTGGAATAAATGAATGGATGG + Intronic
975471681 4:74776242-74776264 TTGTGAAATATTTGAATGATAGG - Intronic
975765324 4:77661541-77661563 TTGGGGAATGAAAGCATGAAGGG + Intergenic
975973290 4:80068351-80068373 TTGTTGAATGAATGAATGAGTGG - Intronic
976085924 4:81407129-81407151 TTATTGAATAAATGCGTGATTGG + Intergenic
976513413 4:85936328-85936350 TTATGGAATAAATGCATGCATGG - Intronic
976593253 4:86870364-86870386 TTCTGGAATACATGGCTGATTGG - Intergenic
976740940 4:88357046-88357068 TATTGGAATAAATGCACCATTGG - Intergenic
977180582 4:93868481-93868503 TTGTCAAATAAATGAATGAATGG + Intergenic
977924991 4:102689960-102689982 ATGTGGAATAAATGTAAGCTCGG - Intronic
978110554 4:104959664-104959686 TTTTGGAATAATTTCAGGATTGG + Intergenic
978115505 4:105015777-105015799 TTATGGAATACATACATGGTGGG - Intergenic
978395490 4:108275026-108275048 TTGTTGAATGAATGCATCAAAGG + Intergenic
978559300 4:110015001-110015023 TTATGTAATAAATGAAAGATTGG + Intergenic
978762634 4:112371088-112371110 CTGGGGAATAAATGCAATATTGG - Intronic
979363502 4:119792698-119792720 CCGTGGAATAAAAGTATGATTGG + Intergenic
979439812 4:120737816-120737838 TTGTTGAATAAATAAATGAATGG + Intronic
979783756 4:124689228-124689250 TTATGGAATGAATGAATGAATGG + Intronic
980251054 4:130315228-130315250 TTGTGGATTAAATGAAAGAAAGG + Intergenic
980308567 4:131098527-131098549 TTGTTGAATGAATGAATGAGTGG - Intergenic
981187824 4:141825179-141825201 TTGAGGAATAACTGCATATTAGG + Intergenic
981531871 4:145761573-145761595 TGGTGGAATAAATGCAGAATGGG + Exonic
982694690 4:158586020-158586042 TTTTGGAAGAACTGCATTATGGG - Intronic
983022974 4:162701140-162701162 TTGTGGAAGAAGTGAATGTTCGG + Intergenic
983614338 4:169685115-169685137 TGGTGGAATAAATAAAGGATAGG - Intronic
984959182 4:185077970-185077992 TTATGGAATAATTGCACGGTAGG + Intergenic
986778433 5:11041550-11041572 TGGCTGAATAAATGCATGACAGG - Intronic
987106375 5:14643797-14643819 ATGTGAAATAAATACATCATGGG + Intergenic
988480649 5:31627655-31627677 TTATTGAATAAATGGATGATTGG - Intergenic
990356872 5:54976242-54976264 TTCTGGAATGAATGGATGATTGG - Intergenic
990546170 5:56823556-56823578 TTATTGAATAAATGAATGAGAGG + Intronic
990554649 5:56918870-56918892 TTGTGAAATAATGGCAAGATAGG + Intergenic
992136860 5:73754569-73754591 TTGTTGAATGAATGAATGAATGG - Intronic
992229273 5:74647828-74647850 TTGTTGAATGAATGACTGATTGG - Intronic
993740099 5:91528301-91528323 TTGAGGACTAAACGTATGATTGG - Intergenic
994136447 5:96292973-96292995 TTGTTGAATAAATGTTTGAATGG + Intergenic
994314055 5:98311671-98311693 TGACTGAATAAATGCATGATTGG - Intergenic
994611927 5:102053297-102053319 TTGTGTAACAAATGAATGATGGG - Intergenic
994715380 5:103315367-103315389 TTGTAGAATGAATGAATGAATGG + Intergenic
994942502 5:106342769-106342791 TTTTGGAAAAAAAGCATTATTGG + Intergenic
995001400 5:107135055-107135077 TTGTTGAATAAATGAGTGAAAGG + Intergenic
995634459 5:114170261-114170283 TTGTGAGGTAAATGAATGATTGG - Intergenic
996185769 5:120473631-120473653 TTGTTGAATAAATGAATAAAGGG - Intronic
996190236 5:120531427-120531449 TTGTGACCTAAATGCAGGATGGG + Intronic
996681627 5:126233753-126233775 TTGTTGAATAAATGCACGGAAGG - Intergenic
997160536 5:131604561-131604583 TTGGTGAATAAATGAATGAATGG + Intronic
997909997 5:137862360-137862382 TTGTTGAATGAATGAATGTTGGG - Intergenic
998550128 5:143069355-143069377 TTGTTGAATAAGTGAATGAGTGG + Intronic
999119308 5:149196796-149196818 TTGTGAAATCAACACATGATGGG - Intronic
999562361 5:152818420-152818442 TTGTGGAATAAATGAATAAATGG + Intergenic
999741679 5:154559975-154559997 TTCTGGAATCAATGCAAGTTTGG - Intergenic
999890870 5:155977504-155977526 ATGTGGAATAAATGAATGATTGG + Intronic
1000464588 5:161560083-161560105 TTCTGGATAAAATGCATGGTTGG - Intronic
1000901225 5:166913898-166913920 TTGCTTAATAAATGCATGATTGG + Intergenic
1001144592 5:169172720-169172742 TAATGGAAAAAATGCATGAATGG - Intronic
1001154418 5:169260728-169260750 TTGTTGAATGAATGAATGAATGG - Intronic
1003088225 6:3078562-3078584 ATGTAGAGTATATGCATGATGGG + Intronic
1003765015 6:9225929-9225951 GTGTTGAATAAATGACTGATGGG - Intergenic
1004014634 6:11720755-11720777 TTGTTGAAGACATGCATGTTAGG - Intronic
1004466799 6:15892871-15892893 TTGTGAAATGAATGAATGAATGG - Intergenic
1005711211 6:28504356-28504378 TGGTGGAACCAATGCATGACAGG + Exonic
1006415692 6:33902567-33902589 TTGTTGAATGAATGAATGAATGG - Intergenic
1006923240 6:37639844-37639866 TGGATGAATAAATGAATGATAGG + Intronic
1006942854 6:37764560-37764582 TTGTTGAACAAATGGATGACAGG + Intergenic
1007308338 6:40924557-40924579 CTGTGGAATAAATAAATGAGAGG + Intergenic
1008091031 6:47294037-47294059 TAGTTGAATAAATGAATGAATGG + Intronic
1008397211 6:51022887-51022909 TTATGGAATAAATAAATGATTGG + Intergenic
1009025720 6:57998084-57998106 TTGTAGAATAAATGAATTAAGGG + Intergenic
1010103514 6:72139998-72140020 TTGTGGGATAAATGTAGCATTGG + Intronic
1011579879 6:88850002-88850024 GTATAGAATAAATGCATGATGGG - Intronic
1011895193 6:92216669-92216691 TTGTGGAATAAATTCCTAAACGG + Intergenic
1012181006 6:96152527-96152549 TTTTTGAATAAATGAATCATTGG + Intronic
1012233479 6:96786692-96786714 TTAGGGAATAAAAGCTTGATAGG + Intergenic
1012286388 6:97394254-97394276 TTGTTGAATGAATGAATGCTTGG + Intergenic
1012510057 6:99992361-99992383 TTGTGGGCTAAATGCATAAGAGG - Intronic
1012655610 6:101816261-101816283 TAAGGGAACAAATGCATGATAGG + Intronic
1013161608 6:107550421-107550443 TTGTTGAATAAATGCGTAAGTGG - Intronic
1013342771 6:109231121-109231143 TTGTGGAATGAGTGAATGAATGG - Intergenic
1013473382 6:110486092-110486114 ATGTTGAATAAATGAATGAATGG + Intergenic
1013875903 6:114827952-114827974 TTGGGTAATAAATACATGAAAGG - Intergenic
1014139751 6:117927712-117927734 TTGTTGAATGAATGAATGAAAGG + Intronic
1014659112 6:124145265-124145287 TTGTGGAATAAATGTCTAAGAGG - Intronic
1016041794 6:139439068-139439090 TTGTTGAATGAGTGCATGAGAGG + Intergenic
1016198243 6:141373592-141373614 TTTTGGAACATATACATGATAGG - Intergenic
1016761593 6:147743736-147743758 TTGTGAATTAATTGCAGGATGGG - Intergenic
1017277516 6:152587217-152587239 TTGTGGAAAAAATTCAACATTGG - Intronic
1017866088 6:158444558-158444580 TTGTTGAATAAAACCATGTTGGG - Intronic
1017917496 6:158843142-158843164 TAGTTGAATGAATGAATGATTGG + Intergenic
1017918398 6:158851222-158851244 TTGTTGAATAAGTGAATGAATGG + Intergenic
1018583232 6:165326195-165326217 TTGTTGAATAAATGTTTGTTTGG + Intergenic
1018601722 6:165551300-165551322 TTGTAGTATAAATGCATGAGAGG - Intronic
1020631571 7:10647009-10647031 TGATTGAATAAATGCATGAATGG + Intergenic
1020991720 7:15205424-15205446 TTGTGACATAAATACATGTTTGG - Intronic
1021666069 7:22981991-22982013 TTGTAGGATAAATTTATGATTGG - Intronic
1021866667 7:24965083-24965105 TTGTTGAATAAATGAATGAATGG - Intronic
1022366287 7:29721702-29721724 TTTTTGAATGAATGGATGATTGG - Intergenic
1022438280 7:30410851-30410873 TTGTGAAACAAATGGATGGTTGG + Intronic
1022456239 7:30560686-30560708 TTGTTGAATGAATGAATGAATGG + Intergenic
1023119867 7:36898707-36898729 TTGTGGGTTAAAGGCAGGATGGG - Intronic
1026325196 7:69303230-69303252 TTGATGAATAAATGAATGACTGG + Intergenic
1026371621 7:69705400-69705422 TTATGGAATGAATGCATGGATGG + Intronic
1026398683 7:69986295-69986317 TTGTTGAATGAATGCTTGAATGG + Intronic
1026511969 7:71034837-71034859 TTGTTGAATGAATGAATGAATGG - Intergenic
1026569774 7:71519303-71519325 GTGTTCAATAAATGAATGATTGG - Intronic
1027288817 7:76679059-76679081 ATGTTGAATAAATGAATGAAAGG + Intergenic
1027307301 7:76913209-76913231 TTGTTGAGTAAATGAATGAATGG - Intergenic
1027592010 7:80129631-80129653 TTGTTGAATAAATGAATTAATGG + Intergenic
1028248721 7:88514437-88514459 TTGTGGAATAAATTCAAGCTAGG + Intergenic
1030068338 7:105677568-105677590 CTGTGGAATAAATGGGTGTTGGG + Intronic
1030846587 7:114421854-114421876 TAGTGGAATTAATTCATCATAGG - Intronic
1030943316 7:115682571-115682593 TTGTTGAATAAATGACTGAAAGG - Intergenic
1031058166 7:117017347-117017369 TTGTTGAGTGAATGCTTGATAGG + Intronic
1031070001 7:117151719-117151741 TTGTGGAATGAATGGATGGATGG + Intronic
1034043587 7:147905029-147905051 TTGTTGAATGAATGACTGATTGG - Intronic
1034075218 7:148225042-148225064 TTGTTGAATAAATGACTGAATGG - Intronic
1034202679 7:149292393-149292415 TTGTTAAATAAATGAATGAATGG - Intronic
1035038752 7:155912193-155912215 CTGTGGAATCCATGAATGATAGG - Intergenic
1035536786 8:397577-397599 TTGGTGAATAAATGAATGAATGG - Intergenic
1036113653 8:5934077-5934099 TTGAGGAATGGATGAATGATTGG - Intergenic
1036538970 8:9684724-9684746 TGGTGGAATGAATGAATGAAAGG - Intronic
1036694220 8:10964225-10964247 TTGTGGGAGAAATGAATGGTTGG + Intronic
1037025883 8:14037237-14037259 TTGTAGAATGAATGCCTCATTGG + Intergenic
1037215641 8:16448061-16448083 TGGTAGACTAAATGCTTGATTGG - Intronic
1037657307 8:20896141-20896163 TTGTTGAATCAATGAATGAAAGG - Intergenic
1038592640 8:28854234-28854256 TTTTTGAATAAATGAATGAATGG - Intronic
1038849504 8:31261875-31261897 TTCTGGAAGATATGCAGGATGGG + Intergenic
1039006289 8:33041180-33041202 CTGTGGAATAAATGAGTGAATGG - Intergenic
1040136014 8:43854760-43854782 TTGGGGAATAAATGGATATTTGG + Intergenic
1040567479 8:48580916-48580938 TTAGGGAATAAATTCATGACTGG - Intergenic
1040794857 8:51278504-51278526 TTGTAAAATAGATGCATAATTGG + Intergenic
1042048731 8:64684163-64684185 TTGTTAAATGAATGCATGGTTGG + Intronic
1042056441 8:64768983-64769005 TTGTTGCAAAAATGTATGATGGG - Intronic
1043342470 8:79256768-79256790 ATGTGGTATACATACATGATGGG - Intergenic
1044327105 8:90870836-90870858 TTGTGGAATTAATGAATGAATGG + Intronic
1044336275 8:90987575-90987597 TTGAGGAATAAATGAATAAAAGG - Intergenic
1044830523 8:96243308-96243330 TTGTTGAACAAATGAATGATTGG - Intronic
1046349231 8:112984762-112984784 TTTTGGAATGAATACAAGATAGG - Intronic
1046797331 8:118387158-118387180 TTTTGGAGTAATGGCATGATTGG - Intronic
1047012671 8:120689098-120689120 TTGTGGATTCAATGCCTGCTGGG + Intronic
1047028229 8:120848081-120848103 TTGTTGAATAAATGACTGAATGG + Intergenic
1047028865 8:120854125-120854147 ATCTGGAATATATGTATGATGGG + Intergenic
1048074958 8:131060099-131060121 TTGTGGAATACCTGGCTGATAGG + Intergenic
1048191335 8:132292536-132292558 TGGTTGAATAAATGCATGGATGG + Intronic
1048516392 8:135115530-135115552 TTGTTGAATAAATGAATTAATGG - Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1051444218 9:17123023-17123045 TTGTTGAATAAATTAATGAATGG + Intergenic
1051961905 9:22776171-22776193 TTGTTGAATAAATGGATGAATGG - Intergenic
1052404867 9:28046708-28046730 ATGTGGAATAAATGGTTGAGAGG - Intronic
1056534140 9:87513189-87513211 TTGAGGAATGAATAAATGATGGG - Intronic
1056788260 9:89608061-89608083 CAGGTGAATAAATGCATGATGGG + Intergenic
1057707594 9:97407805-97407827 GTGTGGACAAAATGCATGAAGGG + Intergenic
1058577649 9:106420959-106420981 CTGTGCAATAACTGCATGTTTGG + Intergenic
1058972812 9:110098378-110098400 TTGTTGAATAAATGAATGAATGG - Intronic
1059231275 9:112723775-112723797 TTATTGAATAAATGAATGAAAGG - Intergenic
1059759398 9:117324062-117324084 ATGTGAAAAAAATGCTTGATGGG + Intronic
1059958366 9:119541754-119541776 TTGTGAAATGAAGGGATGATTGG + Intergenic
1059990556 9:119861223-119861245 TTGTTGAACAAATGAATGAATGG + Intergenic
1060170621 9:121458249-121458271 TTCTTGCATAAATGAATGATTGG - Intergenic
1060243603 9:121925783-121925805 TTGTGGAGTGAATGAATGAATGG + Intronic
1061219309 9:129241134-129241156 TTGTTGAATAAATGAATGAATGG + Intergenic
1061720084 9:132546093-132546115 CTGTGGAATGAATGAATGAGGGG + Intronic
1062247921 9:135579039-135579061 TAATGGAATAAATGGATGAATGG - Intergenic
1186339358 X:8627130-8627152 TTATGGAATAAATGTTTGTTGGG - Intronic
1187506859 X:19885867-19885889 TTGTTGAATGAATGAATGAGGGG - Intronic
1187834854 X:23421869-23421891 TACTGGAATAAAGGCAGGATGGG + Intergenic
1188272827 X:28162521-28162543 TTTTGGCATAAATGCTTTATAGG + Intergenic
1189566933 X:42251667-42251689 CTGTTGAATAAATGCATGATTGG + Intergenic
1190130552 X:47744682-47744704 GTGTGGAAAAAATGAATGATAGG + Intergenic
1192130140 X:68542034-68542056 TTGTTAAATAAATGAATGAATGG - Intergenic
1192324391 X:70119960-70119982 ATGTTCAATAAATGTATGATAGG + Intergenic
1192341166 X:70264444-70264466 TAGTGGAAAAAATGCAGGCTTGG + Intergenic
1192425902 X:71076208-71076230 TTGTTGAGTAAATGAATGAATGG + Intergenic
1192849137 X:74935617-74935639 TTGTTGAATGAATGCATGAATGG + Intergenic
1193853998 X:86576054-86576076 TTGTTGAGTAAATGAATGAATGG - Intronic
1194426602 X:93746696-93746718 TTATGTAATAAATATATGATTGG - Intergenic
1195362441 X:104096415-104096437 TTGTAGAATGAATGAATGAATGG - Intergenic
1196048404 X:111280049-111280071 TTGTTGAATGAATGAATGATAGG - Intergenic
1196414949 X:115461425-115461447 TTGTCCAATAATTTCATGATGGG + Intergenic
1196536281 X:116848687-116848709 TTGTTGAATAAATGACTGAATGG + Intergenic
1197270392 X:124418675-124418697 TTGTTGAATAAATACATGAATGG + Intronic
1197813734 X:130475287-130475309 TTGTGGAAAAAATTCATCACAGG - Intergenic
1197882205 X:131178554-131178576 TTGTTGAATGAATGTATGAATGG + Intergenic
1197908754 X:131456768-131456790 ATGTGCAATATATGCATAATAGG + Intergenic
1198513423 X:137377926-137377948 TTGTTGAATGAATGAATGAGTGG - Intergenic
1200699697 Y:6391643-6391665 AAGTGGAATAAATTCATGCTAGG - Intergenic
1201034414 Y:9773055-9773077 AAGTGGAATAAATTCATGCTAGG + Intergenic
1201348455 Y:13011213-13011235 ATGTGGTATATATACATGATTGG - Intergenic
1201689468 Y:16746840-16746862 TTTTCTAATAAATACATGATAGG - Intergenic