ID: 935205128

View in Genome Browser
Species Human (GRCh38)
Location 2:100890509-100890531
Sequence CCTGATGACCTGAGGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935205128_935205139 21 Left 935205128 2:100890509-100890531 CCCTGTACCCTCAGGTCATCAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 935205139 2:100890553-100890575 GCCACTCAGAGCCACTTGAGGGG 0: 1
1: 1
2: 0
3: 19
4: 132
935205128_935205137 19 Left 935205128 2:100890509-100890531 CCCTGTACCCTCAGGTCATCAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 935205137 2:100890551-100890573 CAGCCACTCAGAGCCACTTGAGG 0: 1
1: 1
2: 4
3: 24
4: 226
935205128_935205138 20 Left 935205128 2:100890509-100890531 CCCTGTACCCTCAGGTCATCAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 935205138 2:100890552-100890574 AGCCACTCAGAGCCACTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 176
935205128_935205133 -7 Left 935205128 2:100890509-100890531 CCCTGTACCCTCAGGTCATCAGG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 935205133 2:100890525-100890547 CATCAGGCCCAAATACAGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935205128 Original CRISPR CCTGATGACCTGAGGGTACA GGG (reversed) Intronic
903693021 1:25187441-25187463 CCTGTGGACCTGAGGGTGCTGGG - Intergenic
904035920 1:27558440-27558462 CTTGATGACCTGAGAGAACTGGG - Exonic
906378497 1:45316430-45316452 TCTGAGGACCTGAGGTTATAGGG - Intergenic
906790959 1:48658530-48658552 CCTGATGACCTTAAAGTTCACGG + Intronic
910654192 1:89603446-89603468 CCTGATGAACAGAGTGTCCATGG + Intergenic
911481563 1:98448651-98448673 CCTGAGTAGCTGAGGCTACAGGG + Intergenic
913974425 1:143443269-143443291 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
914068815 1:144268883-144268905 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
914110340 1:144697471-144697493 CCTTAAGAGCTGAGAGTACAGGG + Intergenic
916644435 1:166768928-166768950 CCTGATCACCTTAGGGTGCTGGG - Intergenic
918132316 1:181640260-181640282 CCTGAAGGCCTGAAGGTACATGG - Intronic
920067078 1:203276683-203276705 CCTGGAGACCTGAGGGACCAAGG + Intergenic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
923353716 1:233133021-233133043 CCTGAGTAGCTGAGGCTACAGGG + Intronic
924166708 1:241291209-241291231 CCTGATGTCCTCAGGGAACTTGG - Intronic
1064427668 10:15244392-15244414 CCTGAAGAACTGGGAGTACAAGG - Intronic
1064853193 10:19733946-19733968 CCTGAGGACCCCAGGATACATGG + Intronic
1069868589 10:71519391-71519413 CCTGATGGAGGGAGGGTACAGGG + Intronic
1069871483 10:71535774-71535796 CCTCATGTCCTCAGGGCACATGG - Intronic
1070853474 10:79586115-79586137 CCTGATGACATGAGTACACAAGG - Intergenic
1073226823 10:101927947-101927969 CCTGAGTAGCTGAGGTTACAGGG - Intronic
1074309762 10:112312285-112312307 ACTGATGGCCTGATGGTCCAGGG - Intergenic
1074480416 10:113815280-113815302 CATGATGATCAGAGGGTTCAGGG - Intergenic
1075628875 10:123987549-123987571 CCTGAAGAACTGAGGGTCCTGGG - Intergenic
1075831636 10:125417079-125417101 CCTGATGAGCTGACGGGAGATGG - Intergenic
1077024555 11:433451-433473 CCGGATCACCTGGGGGCACATGG + Exonic
1077465291 11:2731064-2731086 CCTGAGGACCTTTGGGTCCAAGG - Intronic
1077555835 11:3225621-3225643 CCTAATGTCCTGAGGGCTCAAGG + Intergenic
1079595013 11:22233492-22233514 CCTGAGGAACTGAGGGTCCTGGG + Intronic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1085665853 11:78415643-78415665 CCTGATGGGCTGAAGGTACATGG + Intronic
1085823072 11:79813914-79813936 CTTGAAGTCCTGAGGATACATGG - Intergenic
1091035700 11:132231265-132231287 TCAGATGACCTGTTGGTACAAGG + Intronic
1091302822 11:134518435-134518457 CCTGCTGCCCTGAGGGAACAGGG - Intergenic
1098031638 12:66260862-66260884 CCTGATGACCTGAGGTGGAACGG + Intergenic
1098532474 12:71556394-71556416 CCTGATGTCCTGAAGCTAAAAGG + Intronic
1102387629 12:112523406-112523428 CCTGAAGAACTGAGGGTCCTGGG - Intergenic
1103299461 12:119916929-119916951 GCTTCTGACCTGAGGGTACTTGG + Intergenic
1103327165 12:120129393-120129415 CTTGATGGCCTGGGGGTCCAGGG + Exonic
1103699482 12:122841416-122841438 CCTGATGACCCCAGGGTAGGTGG - Intronic
1105894267 13:24705253-24705275 CGTGAAGGCCTTAGGGTACAGGG + Intronic
1106394075 13:29363253-29363275 ACACATTACCTGAGGGTACATGG + Intronic
1107140168 13:36990318-36990340 CCTGATGGGCTAAGGTTACAAGG - Intronic
1107144160 13:37039789-37039811 CCTGAAGAACTGAGGGTCCTGGG - Intronic
1107222560 13:38002661-38002683 CCTTATGACCTGTTGGTACTAGG - Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108583480 13:51847401-51847423 CCTGATGATCTGAGGTTGAACGG + Intergenic
1110024808 13:70523113-70523135 CCTAAAGAACTGAGGGTACCAGG + Intergenic
1111173579 13:84562441-84562463 CCGGAAGACCTGAGATTACAGGG + Intergenic
1112170413 13:96967178-96967200 CCTAATGACCTGTGGGTATTTGG - Intergenic
1113651140 13:112035064-112035086 GCAGATGCCCTGAGGGTACATGG - Intergenic
1114469882 14:22953266-22953288 CCTGAGGAGCTGAGACTACAAGG + Intronic
1122853206 14:104547748-104547770 CCTGAGGGCCTGTGGGCACATGG - Intronic
1122864586 14:104597794-104597816 GCTGATGACCTGCGGGTGAATGG - Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123923080 15:25084254-25084276 CATGATGACCTCAGGGTGCTGGG + Intergenic
1124971575 15:34494829-34494851 GATGTTGACCTGAGGGTGCATGG - Intergenic
1125142210 15:36421883-36421905 CCTAAAGAACTGAGGGTACTGGG + Intergenic
1127977330 15:64007308-64007330 CAAAATGACCTGAAGGTACAGGG + Intronic
1133758413 16:8779480-8779502 GCTGATGAACTGGGGGTACCGGG - Exonic
1135076234 16:19396135-19396157 TCTGATGAACTGGGGGTGCAGGG + Intergenic
1138267695 16:55671705-55671727 CCTGATGACCTGAGGTGGAACGG + Intronic
1138998151 16:62477788-62477810 CCTGATCCCCTGAGAGCACAGGG - Intergenic
1140209502 16:72959558-72959580 GTTGATGATCTGCGGGTACACGG + Exonic
1140562905 16:76004688-76004710 CTTGGTGAGCTGAGGGCACAAGG + Intergenic
1142698141 17:1644731-1644753 CCTGCTGTCCTGAGGCTGCATGG + Intronic
1142977625 17:3655313-3655335 CATGATCACCTGAGGGTAGAAGG - Exonic
1144399907 17:14886309-14886331 CCTGCTGACCTGAGTGCATAGGG - Intergenic
1147913991 17:43875913-43875935 CTTGCTGACCTGAGGCTATAGGG - Intronic
1148229150 17:45920432-45920454 CCTCATGAGCTGAGGGACCATGG - Intronic
1149295430 17:55257781-55257803 TCTGATCACCTGAGGATACCTGG + Intergenic
1151705310 17:75764257-75764279 CCTGAAGACCTAAGGGGGCAGGG - Intronic
1152807289 17:82362149-82362171 CATGCTGACCGGAGGGCACATGG - Exonic
1159734408 18:72076124-72076146 CCTGATGAAGTGAGGGTAAAGGG + Intergenic
1159927060 18:74278979-74279001 CATGATGACCTTGGGGTACAGGG + Intronic
1160048545 18:75409794-75409816 CCTGAGGACCTGAGTGCAGATGG - Exonic
1160762377 19:791987-792009 CCTGTTGGCCTGAGGGCCCAGGG + Intergenic
1160904980 19:1447737-1447759 CCTGGAGGGCTGAGGGTACATGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1166786491 19:45370337-45370359 CCTGAGGACCTGAGGGTTACCGG - Intronic
1168243515 19:55098725-55098747 TCTGAGGAGCTGAGGGGACATGG + Intronic
1168245052 19:55108829-55108851 CCTGAGCAGCTGAGGTTACAGGG + Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
927393077 2:22618228-22618250 GCTGATGACCTCAGGGAAAAAGG + Intergenic
928409767 2:31045793-31045815 CCTGATAACCTCAGGAAACAGGG - Intronic
930245402 2:48978804-48978826 TCTGAACACCTGAGGGTGCAAGG - Intronic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
933301596 2:80546971-80546993 CCTGATGACCTGCTGGTTCTTGG + Intronic
934179131 2:89604244-89604266 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
934289415 2:91678512-91678534 CCTTAAGAGCTGAGAGTACAGGG - Intergenic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
936017516 2:108971009-108971031 GCTGTGGACCTGAGGGGACAGGG + Intronic
936595605 2:113844561-113844583 CCTGAAGAAGTGAGGGTAAAGGG + Intergenic
938980971 2:136526803-136526825 CCTCCTGACCTGAGGGTGCCAGG - Intergenic
941318435 2:164024363-164024385 CCTGAAGAACTGAGGGTCCTGGG + Intergenic
944468751 2:200030720-200030742 CCTGAGTAGCTGAGGTTACAGGG + Intergenic
948301780 2:236912961-236912983 CTTGATGACCTGAGCTTAGAAGG - Intergenic
1170195898 20:13689196-13689218 CCTGATGATCTGAGGTGAAACGG + Intergenic
1174004904 20:47402782-47402804 TCTGAGGCTCTGAGGGTACAAGG + Intergenic
1175557464 20:59878193-59878215 CCTGGTGGCCTGAGGCCACATGG - Intronic
1175722977 20:61298492-61298514 CCTGAGGACCTGACGGGACGTGG - Intronic
1175743887 20:61439973-61439995 CGTGATGACCTGAGTGTATTAGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177458118 21:21370257-21370279 CCTTATGACCTGAGAGACCAAGG + Intronic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1182876736 22:33698423-33698445 CCTGAGTAGCTGAGAGTACAGGG + Intronic
1183244637 22:36684489-36684511 CCTGAGGAGCTGAGACTACAGGG - Intronic
1183678210 22:39311621-39311643 CCTGTGGACCTGAGGGTGCAGGG - Intergenic
1184303844 22:43580916-43580938 CCTGAAGACCTGAGGCTTGAAGG + Intronic
951225084 3:20111540-20111562 TCTGATGACCTGGGGGTTTATGG + Intronic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
953765795 3:45740918-45740940 CCTGAGAACCTGAGGAGACAAGG + Intronic
955226662 3:57065893-57065915 ACTGAAGACCTGAGAGTTCATGG - Intronic
960781895 3:121329308-121329330 CCTGCTGACCTAAGGATACCTGG + Intronic
961421487 3:126808592-126808614 CCTGAAGAACTGAGGGTCCTGGG + Intronic
964209640 3:154212642-154212664 CCTGATGATCTGAGGTGAAATGG - Intronic
969496925 4:7531516-7531538 TCTGATGACCTGGGGGAAAAGGG - Exonic
969830151 4:9789372-9789394 CCTTAAGAGCTGAGAGTACAGGG + Intronic
970446035 4:16124048-16124070 CCACATGCCCTGAGGCTACAAGG + Intergenic
973005103 4:44995944-44995966 CTTGATGGCCTGAAGGTAAAAGG - Intergenic
973844005 4:54892435-54892457 ACTGATGACCTAAGGGTAGGAGG - Intergenic
974116787 4:57588884-57588906 ACTGAGAACCTGAGAGTACAAGG + Intergenic
975127161 4:70795729-70795751 CCTGAAGAACTGAGGGTCCTAGG + Intronic
977733006 4:100378166-100378188 CCTAAAGAACTGAGGGTCCAGGG - Intergenic
977787330 4:101052678-101052700 CCTGATGTAATTAGGGTACAGGG - Intronic
980106617 4:128594442-128594464 CCTGATGACCTGGGCCTTCAAGG - Intergenic
980711385 4:136573110-136573132 CCTGATGACCTGAGGTAGAACGG + Intergenic
981685909 4:147454706-147454728 CCTGATGCACTGAGGGTGCAAGG - Intergenic
983658371 4:170106711-170106733 CTTGATGACCTGAAGGTAAAAGG - Intergenic
985382770 4:189412855-189412877 CTTGAAGACCTGAGGTCACAGGG - Intergenic
986380696 5:7182691-7182713 CCTGATGACCCCATGTTACATGG + Intergenic
994451485 5:99950227-99950249 CCTGAGGCTCTGAGAGTACAAGG - Intergenic
994997331 5:107080245-107080267 ACCAATGACCTGAGGGTAGAGGG - Intergenic
995577859 5:113560271-113560293 CCTAAAGAACTGAGGGTCCAGGG - Intronic
997318001 5:132954216-132954238 CCTGATGATCTGAGGTGAAATGG - Intronic
997594343 5:135096145-135096167 CCTGTTCACCTGAGGGTAGGGGG + Intronic
998072735 5:139211036-139211058 CCTGATGATCTGAGGGGGAACGG + Intronic
1002834402 6:853731-853753 CCTCCTGACCTGGGGGTGCAGGG - Intergenic
1003554532 6:7128027-7128049 TCTGAAAACCTGAGAGTACAAGG - Intronic
1004209525 6:13624871-13624893 CCTGATGACTTGTGAGTACCCGG - Intronic
1005322926 6:24673039-24673061 CCTTGTGACCTTAGGTTACAGGG - Intronic
1007821889 6:44566482-44566504 CCTGATGACCAGAGAGTAATGGG - Intergenic
1008222963 6:48876796-48876818 TCTGATGAACTGGGGGTGCAGGG - Intergenic
1014565961 6:122947708-122947730 CTTTATGACCTGACTGTACAGGG - Intergenic
1015016385 6:128418543-128418565 CCTGATGACCTGAGGTGGAACGG + Intronic
1016814296 6:148289443-148289465 CCTGTTGACTTCAGGGTAAAAGG + Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1020137030 7:5593346-5593368 GATGTTGACCTGAGGGTGCATGG - Exonic
1022803835 7:33802054-33802076 TCTGGTGACTTGAGGCTACAAGG - Intergenic
1024001724 7:45194400-45194422 CCTGAGGGCCTGAGGGTCTAAGG - Intergenic
1025092858 7:56077868-56077890 CCTGGAGCCCTGTGGGTACAGGG + Intronic
1026088824 7:67283582-67283604 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1027118416 7:75498900-75498922 CCTGAAGAGCTGAGAGTAGAGGG - Intergenic
1027227700 7:76254812-76254834 CTTGATGAGCTGAGGGTGCTGGG + Intronic
1029226219 7:99030463-99030485 CCAGATCACCTGAGGGGAAAGGG - Exonic
1030492796 7:110258977-110258999 CCTCATGCTCTGAGGGTACTTGG - Intergenic
1032485024 7:132279228-132279250 TCTAATGACCAGAGGGAACAAGG - Intronic
1032625669 7:133589129-133589151 CCTAAAGAACTGAGGGTACTGGG + Intronic
1033718305 7:144026422-144026444 CCTGAGAACCTGGGGGTCCAGGG - Intergenic
1039278547 8:35957446-35957468 CCTGATCACCTGAGGAGAAAGGG - Intergenic
1040138696 8:43885039-43885061 TCTGATGAACTGAGGGTGCAGGG + Intergenic
1043124186 8:76367955-76367977 CATGGTGAACTGAGGGTACCTGG - Intergenic
1055282456 9:74690270-74690292 TCTCAGGACCAGAGGGTACAGGG + Exonic
1055309580 9:74964670-74964692 CCTGATGACCTCAGGATCCTGGG - Intergenic
1058546519 9:106066077-106066099 ACTGATGACCTGAGGGTGAGAGG + Intergenic
1060223110 9:121774727-121774749 CCTGAGGACCTGGGGGTTGAGGG + Intronic
1060628534 9:125135526-125135548 CCTGAATACCTGAGATTACAGGG - Intronic
1061303134 9:129717940-129717962 CCTGATCACCTGAGTCCACATGG - Intronic
1186107311 X:6221558-6221580 CCTCATGCCCTGAAGCTACATGG - Intronic
1186139929 X:6561273-6561295 CCTGGAGAGCTGAGGGTGCAAGG - Intergenic
1192440972 X:71173414-71173436 GCTGAGAACCTGAGGCTACAGGG - Intergenic
1192775672 X:74241983-74242005 GCTGAAGACCTGAAAGTACAGGG + Intergenic
1195931243 X:110078999-110079021 CCTGAAGAACTGAGGGTACTGGG + Intronic
1196081497 X:111637645-111637667 CCAGAAGAGCTGTGGGTACAGGG + Intergenic
1198452678 X:136783510-136783532 GCTGATGAACTGAGGGAATAGGG + Intergenic
1200961263 Y:8998199-8998221 TCTGATGAACTGGGGGTGCAGGG - Intergenic