ID: 935212703

View in Genome Browser
Species Human (GRCh38)
Location 2:100952224-100952246
Sequence CCTCGTGCACAGAGGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935212694_935212703 17 Left 935212694 2:100952184-100952206 CCATAATGGCAGCTACTGTGATA 0: 1
1: 0
2: 1
3: 14
4: 127
Right 935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935212703 Original CRISPR CCTCGTGCACAGAGGGCAAA GGG Intronic
900354410 1:2253332-2253354 GCTCCAGCACAGCGGGCAAAAGG + Intronic
900866678 1:5273978-5274000 CCTCTTACACAGAGGTCAAGAGG - Intergenic
901773731 1:11544887-11544909 CCACGTGCACAGGTGGCAAGAGG + Intergenic
903168743 1:21539079-21539101 CATATTGCAGAGAGGGCAAATGG + Intronic
903350398 1:22713202-22713224 CCTAGTGTCCAGGGGGCAAACGG - Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904252290 1:29233784-29233806 TCCCCTGCACAAAGGGCAAAGGG + Intergenic
908112275 1:60909229-60909251 CCTAGGGCACAGAGTGCAAAAGG + Intronic
910519691 1:88105824-88105846 CCTCCTGCCCAGAAGGAAAATGG + Intergenic
912707208 1:111923774-111923796 CTTCGTGCACAGGGTGCTAATGG + Intronic
912710733 1:111948134-111948156 CATCATGCCCACAGGGCAAATGG + Intronic
915165416 1:153945697-153945719 CCTCATCCACTGAGGGCGAATGG + Intronic
918341151 1:183568846-183568868 GCACGTGGACAGAGGGCCAATGG + Intronic
919513648 1:198495036-198495058 CCTCAGGGACAGAGGGCACAGGG + Intergenic
920373182 1:205492380-205492402 ACTCCTGGAAAGAGGGCAAAGGG - Intergenic
924669561 1:246109838-246109860 CCTTGTTCCCAGATGGCAAACGG - Intronic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1065006854 10:21388110-21388132 CCTCGGGCACACACGGCTAAAGG + Intergenic
1065857099 10:29839510-29839532 CCACCTGGACAGAGGGCAACTGG + Intergenic
1069836453 10:71311498-71311520 CCTGGTGAAAATAGGGCAAAGGG + Intergenic
1069964740 10:72105171-72105193 CCTCTGCCACTGAGGGCAAAGGG - Intronic
1070802084 10:79249810-79249832 CCTCGTGCATTGGGGGGAAAGGG - Intronic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1074584256 10:114751795-114751817 ACTCATGCACAGGGGGGAAATGG + Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077155921 11:1090742-1090764 CCTGGTGGACACAGGGCATAGGG - Intergenic
1082996306 11:59258133-59258155 CCTCGTGAACAAATCGCAAAAGG + Intergenic
1083618803 11:64039010-64039032 CCTCGTTCACTGTGGGCCAAGGG + Intronic
1084544516 11:69807975-69807997 CATCAGGCACAGAGGGCAAGGGG - Intergenic
1084770145 11:71337420-71337442 CAGCCTGCACAGAGGGGAAAAGG + Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1087899298 11:103622536-103622558 ATTCCTGCACAGAGGGCATATGG - Intergenic
1088654366 11:111985277-111985299 CCTGGTTCACAGAGGGCCAAGGG - Intronic
1090437505 11:126698827-126698849 CCTCGTGCACAGAGCCCAGTAGG + Intronic
1090556646 11:127883571-127883593 CCTCGTCCTGAAAGGGCAAAGGG + Intergenic
1091863463 12:3807944-3807966 CTTCCTGCATAGAGTGCAAAGGG + Intronic
1096317591 12:50582026-50582048 CCTCCTGCAGAGAGGACACAGGG + Intronic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1101560972 12:105857709-105857731 CCACGGGCACAGAGGGCACCAGG + Intergenic
1102609543 12:114099403-114099425 CCTCTGCCAGAGAGGGCAAAGGG + Intergenic
1102991350 12:117318604-117318626 CCTCTTGCACGGAAGGAAAAGGG + Intronic
1107655608 13:42589728-42589750 GCAAGTGCAGAGAGGGCAAAGGG + Intronic
1110103117 13:71634401-71634423 CCTGGAGCACAGAGAGCAAGGGG - Intronic
1111105461 13:83640211-83640233 CCTGGAGCACATAAGGCAAATGG + Intergenic
1112666870 13:101585273-101585295 TCTCCAGCATAGAGGGCAAAGGG + Intronic
1113308728 13:109108669-109108691 CCAGGTGCAAAGAGAGCAAATGG + Intronic
1115645016 14:35363185-35363207 CTTCCTGCACTGAGGGCAACAGG + Intergenic
1116716330 14:48431221-48431243 CCTCCTCCAGCGAGGGCAAAGGG + Intergenic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1120204627 14:81574420-81574442 CCTCGTAGAAAGAGGACAAATGG - Intergenic
1121508272 14:94492936-94492958 CCTCCTGCACAGAGGCCAGGTGG + Intronic
1122523119 14:102360770-102360792 TCTGATGCACAGAGGGCAAGTGG - Intronic
1129909302 15:79212904-79212926 CCTGGAGCACAGAGGGGAAGGGG - Intergenic
1132092719 15:98958954-98958976 CCTCGTGCCCAGAGAGCCTACGG - Exonic
1138580902 16:57939945-57939967 CCTCGTGCACAGGTGGCCACTGG + Intronic
1138638946 16:58367416-58367438 CCTCAGGCACAAAGGGCTAAAGG + Intronic
1141118960 16:81335973-81335995 ACTGGTGCACTGAGAGCAAAGGG - Intronic
1141327139 16:83071483-83071505 CCTCCTGCTCAGAGAGCAAAGGG - Intronic
1142020727 16:87780492-87780514 CCTCATCCACAGAGGACAGAGGG + Intergenic
1143815021 17:9506092-9506114 TCTCGTGCAGAAAGGGCACATGG - Intronic
1148857359 17:50586046-50586068 CCTCTTGCAGAGAGGGCATGAGG - Intronic
1149037379 17:52149934-52149956 TTTCATGCACAGAGGGAAAATGG + Intronic
1149678479 17:58487681-58487703 CCTCGCCCACAGTGGGCACATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151409747 17:73914394-73914416 CTTTGTGCCCAGTGGGCAAAAGG - Intergenic
1152375655 17:79917578-79917600 CCTTGTGCACAAGAGGCAAATGG - Intergenic
1152740932 17:82018048-82018070 CCCCGTGCAGGGAGGGGAAAGGG - Intergenic
1153944870 18:10009562-10009584 CCTAATGCATAGAGGGCACAGGG + Intergenic
1155391473 18:25342018-25342040 CCTAGAGTACAGAGGGTAAATGG + Intronic
1160467210 18:79089424-79089446 GCACGTGCACAGTGGGCCAAGGG - Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1160875168 19:1293479-1293501 CCCCTTGCACGGAGGGGAAAGGG + Intronic
1161571850 19:5035196-5035218 CCTGGTGCACATAGGGCAGGTGG + Intronic
1161727173 19:5936249-5936271 CCTGATGCACAGAGGACAGAGGG + Intronic
1162051091 19:8033526-8033548 GCTCGGGCACAGAGGGAAATAGG - Intronic
1165064502 19:33221108-33221130 CCTGCTTCACAGAGAGCAAAAGG + Intronic
1165158795 19:33803896-33803918 CCTTGTGCACACAGGGCAGGTGG + Intronic
1166635132 19:44444495-44444517 CCTCCTACACAAAGGACAAAGGG + Intronic
1166996706 19:46722942-46722964 CCCCGTGCTCTGAGGGCACAGGG + Exonic
925043049 2:748550-748572 CCTTGTGCACAGAGCGCGCATGG - Intergenic
925557884 2:5152482-5152504 GCCCATGCACAGAGGGCACATGG - Intergenic
926232048 2:11011742-11011764 CCTCCTTCACAGAGGTTAAAGGG + Intergenic
927490341 2:23517112-23517134 CCACGTCCACAGCGGGCACAGGG - Intronic
928181683 2:29072575-29072597 CCTGGTGCCCACAGGGCACAGGG + Exonic
932469607 2:71945255-71945277 CTTCATGCGCAGAGGGGAAATGG - Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
937462341 2:122100509-122100531 CCTGGTGGAGAGAGGGGAAAAGG - Intergenic
937907764 2:127060727-127060749 CCTTCTGCTCAGAGGACAAAGGG + Intronic
939035384 2:137124548-137124570 CCTCAAGCACACAGGGGAAAGGG + Intronic
940373315 2:152925593-152925615 CCACATGCCCAGAGGGCCAAGGG - Intergenic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
947394792 2:229675809-229675831 GCTCGTGCTCAGCAGGCAAATGG + Intronic
947611253 2:231526360-231526382 CCTGGTGCACAGAGGGCCAGCGG + Intronic
948388081 2:237593983-237594005 CCTCCTGCACAGAGGTCATCTGG + Intronic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169816023 20:9657265-9657287 CCTCGTGCTGAGAGGGAAACAGG - Intronic
1172351896 20:34249563-34249585 CCTCGTGCTTAAAGGGCCAATGG + Intronic
1172601576 20:36187523-36187545 CCTCCTGCTCTGAGGGCAGAGGG + Intronic
1175997803 20:62819210-62819232 CCTCCTGCACAGGGACCAAAGGG + Exonic
1176135223 20:63519601-63519623 CCACGTGCTCAGGGGGCACAAGG + Intergenic
1179230530 21:39500087-39500109 CCTGGTGCAGAGAGGGCTAAAGG + Intronic
1179585918 21:42374054-42374076 GCGTGGGCACAGAGGGCAAAGGG - Intronic
1179832550 21:44006459-44006481 CCCTCTGCACAGAGGGCAAAAGG - Intergenic
1182458619 22:30468870-30468892 CCTTGCTCACAGAGGGTAAATGG + Intronic
1184257501 22:43295536-43295558 CCTCGTGCCCAGTGGGAATAAGG - Intronic
950296767 3:11838780-11838802 CCACCTTCACAGAGGGGAAAAGG - Intronic
950673830 3:14542715-14542737 TGTCGAGGACAGAGGGCAAAGGG - Intergenic
951250979 3:20394285-20394307 CCTCGTCCAATGATGGCAAAGGG - Intergenic
961970852 3:130965593-130965615 CTTGGTGCACAGAAAGCAAAGGG - Intronic
963523116 3:146380853-146380875 CCTCCACCAGAGAGGGCAAAGGG + Intergenic
968474988 4:800215-800237 CCTTGTGGAGTGAGGGCAAAGGG + Intronic
971133222 4:23836772-23836794 CTTTGTGCACAGTTGGCAAAAGG + Intronic
975647422 4:76558942-76558964 CCTGGGGCCCAGAGGGGAAAGGG - Intronic
978075322 4:104521965-104521987 GCTAGTGCAAAGAGGGAAAAGGG - Intergenic
980795852 4:137681568-137681590 CCTCATGTACAGAGGAAAAAGGG + Intergenic
981964973 4:150589510-150589532 GCTAATGTACAGAGGGCAAAAGG - Intronic
982800631 4:159702325-159702347 CCCTGTGCTCAGAGGTCAAATGG + Intergenic
984256267 4:177393308-177393330 CCTCGTGCACAGCGGCACAAAGG - Intergenic
988130615 5:27099374-27099396 CCTGGTGCAAAAAGGGCAAAGGG - Intronic
988817656 5:34850604-34850626 ACTGGAGCACAGTGGGCAAAGGG + Intronic
990514818 5:56521269-56521291 CCTCTTGTAGGGAGGGCAAATGG - Intronic
994119926 5:96102109-96102131 CCTCCTCCAGGGAGGGCAAAGGG + Intergenic
995721687 5:115141543-115141565 CCTTAGGCACAGAGGGCCAAAGG + Intronic
995780285 5:115767931-115767953 CCTCTTGCACAGATTGCAGATGG - Intergenic
997607638 5:135186568-135186590 CCTCTGGCAGGGAGGGCAAAGGG - Intronic
997638069 5:135429563-135429585 CCTGCTGCACAGAGAGCAAGGGG + Intergenic
997655238 5:135549527-135549549 GCTGGAGCTCAGAGGGCAAAGGG - Intergenic
997975766 5:138440513-138440535 CCTAGGGAACAGAGGGCACAGGG - Intronic
998767975 5:145509552-145509574 CCTCTTTCAGAGATGGCAAAAGG - Intronic
1001324879 5:170715924-170715946 CCTCCTGCACACAGGGAACAGGG + Intronic
1007715700 6:43854855-43854877 CCTCATGCACAGAGGGCTGGAGG + Intergenic
1013368973 6:109454462-109454484 TCTTGGGCACAGAGGGCACATGG + Intronic
1013950214 6:115771168-115771190 CCTCCACCAGAGAGGGCAAAAGG + Intergenic
1016006962 6:139099145-139099167 CCTCTGCCAGAGAGGGCAAAGGG - Intergenic
1016357204 6:143231485-143231507 TCTCGTGAACAGAGTGAAAAAGG + Intronic
1021616678 7:22509002-22509024 CCTCCTGCACAGTGGTCAATTGG - Intronic
1022926482 7:35060206-35060228 CCTCCTGCACAGTGGTCAATTGG - Intergenic
1023849492 7:44142133-44142155 CCTGGTGCACAGTGGGCCGATGG + Intergenic
1025832126 7:65061455-65061477 CTTCATTCACAGAGGGGAAAAGG - Intergenic
1025919806 7:65900883-65900905 CTTCATTCACAGAGGGGAAAAGG - Intronic
1027265408 7:76492432-76492454 CCACGTACCCAGAGAGCAAAAGG - Intronic
1027316779 7:76990549-76990571 CCACGTACCCAGAGAGCAAAAGG - Intergenic
1028375784 7:90145338-90145360 CCTCCTGCACAGTGGTCAATTGG + Intergenic
1028450633 7:90978099-90978121 CCAGGTACAGAGAGGGCAAAGGG + Intronic
1029824488 7:103174900-103174922 CCTCCTGCACAGTGGTCAATTGG - Intergenic
1031933839 7:127715082-127715104 CCTCGTGCACCGATGTAAAATGG - Intronic
1035935564 8:3834300-3834322 CCACATCCACAGAGGGTAAAGGG - Intronic
1037106067 8:15110513-15110535 CCTCCAGCCCACAGGGCAAAGGG + Intronic
1037406082 8:18544051-18544073 TCTCATGCAGACAGGGCAAAAGG + Intronic
1038498559 8:28024633-28024655 CCTCGGGCACAGAAAGCCAAGGG - Intronic
1041914389 8:63125438-63125460 GGTAGAGCACAGAGGGCAAAGGG - Intergenic
1043569804 8:81589755-81589777 CTGCCTGCACAGAGGGGAAAAGG - Intergenic
1047577959 8:126179147-126179169 ATTGGTGCAAAGAGGGCAAATGG + Intergenic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048571311 8:135659428-135659450 CCTTGTCAACAGAGGCCAAATGG - Intergenic
1059752418 9:117260278-117260300 TCATGTGAACAGAGGGCAAAAGG + Intronic
1185817474 X:3169702-3169724 CCTTGTGGACAAAGGGCAGAAGG - Intergenic
1186239021 X:7546619-7546641 CCTCTGGCAGCGAGGGCAAAGGG - Intergenic
1187175735 X:16894870-16894892 CTTGGTGCACAGTGAGCAAAGGG - Intergenic
1189076509 X:37921046-37921068 CCTCATGCACAGAAAGCACAAGG - Intronic
1191882899 X:65860186-65860208 CCTCATGTACAGAGGCCAATGGG + Intergenic
1193924680 X:87469015-87469037 CCCCCTGCACAGATGGGAAATGG - Intergenic