ID: 935213053

View in Genome Browser
Species Human (GRCh38)
Location 2:100954762-100954784
Sequence TTTCAACTGTCACCACACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935213053_935213055 9 Left 935213053 2:100954762-100954784 CCCAGGTGTGGTGACAGTTGAAA 0: 1
1: 0
2: 0
3: 7
4: 133
Right 935213055 2:100954794-100954816 GTAATATTAATAATAATAATAGG 0: 1
1: 11
2: 244
3: 529
4: 1850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935213053 Original CRISPR TTTCAACTGTCACCACACCT GGG (reversed) Intronic
900924890 1:5698776-5698798 TTTCAACTGACCCCACACCAAGG + Intergenic
902462996 1:16593349-16593371 TCTCAGCTTTCACCCCACCTAGG + Intronic
905302435 1:36994744-36994766 TTTCAGCTGTCACACCACCCTGG + Intronic
906409342 1:45566501-45566523 CTTCTACTGTCACCACCCCAAGG - Intronic
912423191 1:109561761-109561783 TTTCAAATGTCACCTCCTCTGGG - Intronic
916478552 1:165193721-165193743 TTTCACCTTTCATCAGACCTTGG - Intergenic
917664253 1:177208473-177208495 TTACAGCCGTCACCACACCAGGG - Intronic
918429225 1:184441126-184441148 TTTCCACTCCCAGCACACCTAGG + Intronic
918639009 1:186815637-186815659 TTACAACTATGCCCACACCTTGG - Intergenic
921786440 1:219236267-219236289 TTTCAACAGTTATCACACTTTGG + Intergenic
921790674 1:219286798-219286820 TTGCAACTGTCACCATACAGAGG - Intergenic
923919852 1:238551471-238551493 TTTCAAATATCACCACATCACGG - Intergenic
1063230069 10:4057132-4057154 TTTCAGCTGTGACCATAGCTGGG + Intergenic
1066024437 10:31340282-31340304 TTTCAGATGTCAAAACACCTAGG + Intronic
1066391452 10:34980223-34980245 TATCAACTTTCACCACATGTAGG + Intergenic
1068223914 10:54081817-54081839 TTTCCACTGACATCACTCCTGGG - Intronic
1069776216 10:70928819-70928841 TTTCTACTGCCACGTCACCTGGG + Intergenic
1071000556 10:80826095-80826117 TTACAACTTTCACCTAACCTGGG + Intergenic
1075180112 10:120203833-120203855 TTTCTACTGTAACAACCCCTAGG - Intergenic
1084890034 11:72232295-72232317 TGTGAATTGTCACCTCACCTCGG + Exonic
1086218938 11:84418315-84418337 TTTCCACTGTCACTTCACATTGG - Intronic
1088170565 11:106991510-106991532 TTTCAACCGTAACGACACATTGG - Intronic
1089807149 11:121100848-121100870 TTTCAACAGTCGCCACAGATAGG - Intergenic
1091614476 12:2038872-2038894 TTTCACCTGTCAACATACCTGGG - Intronic
1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097967849 12:65600300-65600322 TGTCAACTCTCTCCATACCTTGG + Intergenic
1099476477 12:83113589-83113611 TTTCAACAGGCATAACACCTTGG + Intronic
1104589532 12:130073307-130073329 TTTTAACAGACACCACACATCGG + Intergenic
1110808231 13:79783017-79783039 TTTCAAGTGTCAACACTCCCAGG - Intergenic
1116470781 14:45282987-45283009 TTGGAACTGTTACCACCCCTCGG - Intergenic
1119108579 14:71948198-71948220 TTTCAACAGTCACCTCACAGGGG + Intronic
1119469119 14:74882484-74882506 ATTCACCTGTCACCACCACTGGG + Intronic
1121309350 14:92926843-92926865 CTTCAACTGTCTGTACACCTTGG - Intronic
1125521652 15:40351218-40351240 TTTGCACTGTCCCCACTCCTGGG + Intronic
1125786829 15:42326066-42326088 TTTCAACTGATACCAAAACTGGG - Intronic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1131295366 15:91143349-91143371 TTTCAATGGTCCCCAGACCTGGG - Intronic
1132042692 15:98538276-98538298 TCTCAGCTGCCACCACCCCTGGG + Intergenic
1136055043 16:27682064-27682086 TTTCAATGATAACCACACCTTGG - Intronic
1137541200 16:49363040-49363062 GTTCAACCCTCACCACAGCTAGG - Intergenic
1139406428 16:66722485-66722507 TTTCAGGTGTCTCCCCACCTAGG - Exonic
1142929112 17:3267252-3267274 CTTCATCTCTCACCACACTTTGG - Intergenic
1143609360 17:8008786-8008808 TTTTAACTGTCACAAAAACTAGG - Intronic
1144776567 17:17787867-17787889 TCTCAGCTGTCCCCACAGCTGGG + Intronic
1144902210 17:18606040-18606062 TTTCAACCGTAACCACTTCTGGG + Intergenic
1144928854 17:18839912-18839934 TTTCAACCGTAACCACTTCTGGG - Intergenic
1145130291 17:20340037-20340059 TTTCAACCGTAACCACTTCTGGG - Intergenic
1145385839 17:22411096-22411118 TTTCAGCTGACACCTCGCCTTGG + Intergenic
1146951838 17:36912309-36912331 TTTTAACTGACACCGCCCCTGGG + Intergenic
1147452319 17:40513267-40513289 TTTCAACTGTGATCTCACCAAGG - Intergenic
1158581054 18:58683117-58683139 TTTCAAATGTCACAACTCTTGGG - Intronic
1165279786 19:34786145-34786167 TTTGAACTCTCTCCTCACCTAGG + Intergenic
1165743352 19:38216530-38216552 TTTCACCTCTCCCCACAGCTTGG - Intronic
1167889565 19:52528476-52528498 TTTCCACTTTCACCATATCTTGG - Intronic
1168655585 19:58125339-58125361 TTTCATCCATCACCACACCCTGG + Intergenic
1202678657 1_KI270711v1_random:30781-30803 TCTCAGCTTTCACCCCACCTAGG + Intergenic
928536062 2:32242902-32242924 TCACACCTGCCACCACACCTGGG - Intronic
928704114 2:33929244-33929266 TTACAACCTTCACCACACTTTGG + Intergenic
928704506 2:33933442-33933464 TTACAACCTTCACCACACTTTGG + Intergenic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
932443654 2:71756776-71756798 TCTCAACTGCTACCACCCCTTGG - Intergenic
935095616 2:99941585-99941607 TTTCCACTGTGACTACACATGGG + Intronic
935213053 2:100954762-100954784 TTTCAACTGTCACCACACCTGGG - Intronic
935456195 2:103270149-103270171 TTTCTATTGTCACCACAGATGGG + Intergenic
936293627 2:111248287-111248309 TATCAACTGTCCCCATACCCAGG - Intergenic
937636751 2:124164804-124164826 TTTCAATATTCACCTCACCTAGG + Intronic
939997208 2:148931035-148931057 TTTCAAGTGTCATCTGACCTAGG - Intronic
943156339 2:184183677-184183699 AATCAACTGCCACCACAGCTAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944667904 2:201972140-201972162 TTTCAGCTGTTCCCACCCCTTGG + Intergenic
1170809745 20:19664651-19664673 TGTCAACTGCCATCACAACTTGG - Intronic
1170928461 20:20746851-20746873 TTTCAACTATCTCTCCACCTGGG + Intergenic
1171088904 20:22265986-22266008 TTTCAACTGTAACCAGACAGTGG - Intergenic
1173059126 20:39645141-39645163 CTTCAAATGTCATCACAGCTTGG - Intergenic
1174054682 20:47789785-47789807 TTTCTACTGACAACACAGCTTGG - Intergenic
1174351179 20:49969428-49969450 CTTCAAGTGTAACCACACCCAGG - Intergenic
1175028281 20:55926592-55926614 CTTCACCTGACTCCACACCTGGG + Intergenic
1175572946 20:60037697-60037719 TTGCAGCTGGCACCCCACCTGGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178228928 21:30758088-30758110 TTTCATCTCTCTCCACATCTAGG - Intergenic
1182788779 22:32931235-32931257 TTACTACTGCAACCACACCTGGG + Intronic
1183243487 22:36675614-36675636 TTTCCAATGTCACCCCACCAGGG + Intronic
955955229 3:64281897-64281919 TTTCAGCAGTCACCACACCAAGG + Intronic
956047371 3:65209999-65210021 TTACAACTGTCACGAGATCTGGG + Intergenic
959743927 3:109754060-109754082 GTGCCACTGACACCACACCTGGG - Intergenic
961057328 3:123800094-123800116 TTTCAAAGGTCACCCCAGCTGGG - Intronic
962345254 3:134614045-134614067 TTCCAACTATCAGCACATCTAGG - Intronic
963287201 3:143444771-143444793 TTTCCTCTGTCCCCTCACCTTGG - Intronic
965489330 3:169317654-169317676 CCACAACTGTCACCACTCCTAGG + Intronic
968397127 4:250670-250692 TTTCTACTCTCACTCCACCTTGG + Intergenic
970161413 4:13193048-13193070 TTTCATGTGTCACCTCAACTGGG + Intergenic
970331030 4:14984035-14984057 TCTAAACTGTCACCACCTCTTGG + Intergenic
972280693 4:37599368-37599390 AATCAACTATCACCACACTTAGG - Intronic
976978925 4:91200405-91200427 TTTCAACTTTACCCAGACCTAGG + Intronic
977764655 4:100782746-100782768 TTTTAAGTTTCAGCACACCTAGG + Intronic
978406156 4:108380932-108380954 AAGCACCTGTCACCACACCTGGG - Intergenic
980550591 4:134328870-134328892 TCTGATCTGTCACCACACTTCGG - Intergenic
980912877 4:139009315-139009337 AGGAAACTGTCACCACACCTGGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990043578 5:51400355-51400377 TTTTCGCTGTCACCAAACCTGGG - Intergenic
991345196 5:65658321-65658343 TTTTAAATGCCACCACACCTTGG + Intronic
991927362 5:71718876-71718898 TTGCAGCTGTCACCACTGCTAGG + Intergenic
994974107 5:106780041-106780063 TCTCACCAGTCACCATACCTGGG - Intergenic
998061583 5:139122829-139122851 TCTCAAATCTAACCACACCTGGG + Intronic
1000192087 5:158920990-158921012 CTTCATCTGTCACCACATTTGGG + Intronic
1001236533 5:170034495-170034517 TCTCATCTGTCATCACACCCCGG - Exonic
1003502297 6:6712647-6712669 TTTCAACTTGCACCACCTCTTGG + Intergenic
1004044043 6:12009512-12009534 TTTCAACTGTCAAAAATCCTGGG - Intronic
1011254683 6:85408269-85408291 TGTCATCTTTCACCACTCCTGGG + Intergenic
1013759633 6:113501779-113501801 TCTCCACTGTCACCAAATCTAGG - Intergenic
1019001832 6:168760254-168760276 GTTGAACTGTCACCATCCCTTGG - Intergenic
1023258779 7:38337606-38337628 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259309 7:38342270-38342292 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259767 7:38346591-38346613 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023260242 7:38350920-38350942 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023261219 7:38360071-38360093 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1025757972 7:64363129-64363151 TTTCTTCTGTCAACATACCTGGG - Intergenic
1027356082 7:77357104-77357126 TTTCAAATGCCACCACCCCACGG - Intronic
1027692229 7:81362144-81362166 TCTCTACTGTGACCACAGCTTGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1040493953 8:47949704-47949726 TTTCAACTGTCACCCCTCTTAGG - Intronic
1041561348 8:59222816-59222838 TGACAGCTGCCACCACACCTGGG - Intergenic
1047575567 8:126150236-126150258 TTGCTACAGTCACCACACCTGGG + Intergenic
1049458394 8:142707269-142707291 TTTCACGTGCCACCACAGCTCGG + Intergenic
1049945490 9:591379-591401 TTTCAAGTGTGATCACATCTTGG + Intronic
1052600867 9:30629040-30629062 TTTGAACTGTCACAACCACTTGG - Intergenic
1052807617 9:33026154-33026176 TTACAACTGTCACCGCCTCTAGG + Intronic
1053196132 9:36120439-36120461 TTTCATCCTTCACCACTCCTTGG - Intronic
1057189629 9:93079476-93079498 TTTCAGCTGGGACCACAGCTGGG - Exonic
1187122544 X:16423306-16423328 TTTCAGCTGTTACTAGACCTGGG - Intergenic
1189315479 X:40052996-40053018 ATTCAGCTGTGACCACAACTAGG + Intronic
1190445074 X:50515682-50515704 CTTCAACTGTAACCACATCCCGG - Intergenic
1192433155 X:71126018-71126040 TTTCAACTGTCCCCTCAGGTGGG + Exonic
1193897009 X:87127085-87127107 TTTCTATTGTTACCATACCTGGG - Intergenic
1194840891 X:98740818-98740840 TTTCAACTGTCAACAATACTGGG + Intergenic
1198839447 X:140840984-140841006 TGTCAACTGGCAGCACTCCTGGG + Intergenic
1200951246 Y:8902084-8902106 TTTGACCTGGCACCACACCTTGG + Intergenic