ID: 935215791

View in Genome Browser
Species Human (GRCh38)
Location 2:100974411-100974433
Sequence GTAAACTCATCCACTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935215791_935215797 29 Left 935215791 2:100974411-100974433 CCTGTCCCAGTGGATGAGTTTAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 935215797 2:100974463-100974485 AGAACCTCCTTCCCCCTTCTTGG 0: 1
1: 0
2: 0
3: 27
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935215791 Original CRISPR GTAAACTCATCCACTGGGAC AGG (reversed) Intronic
900470451 1:2851642-2851664 CTAAACTAATCCACAGTGACCGG - Intergenic
906589104 1:47006983-47007005 GTAGACTCCACCACTGGGGCAGG + Intergenic
907306444 1:53515739-53515761 ATAAACTCCTACTCTGGGACTGG + Intronic
908494494 1:64680647-64680669 GTCAACACATCCCCGGGGACTGG - Intronic
910093559 1:83493859-83493881 TGAAACTCATCCACTGAGCCAGG + Intergenic
910348884 1:86273316-86273338 GTATATTCATCCACTGAAACTGG - Intergenic
913188060 1:116388261-116388283 GTCAAGTCATCCACTGGGGAAGG - Intronic
916184635 1:162118906-162118928 GAAAACTCATCAACAGGGAGTGG + Intronic
916563694 1:165955056-165955078 GTGAAGTCATCCACAGGGAGTGG + Intergenic
921511944 1:216042826-216042848 GGAACCTCATCCAATAGGACTGG + Intronic
921943808 1:220872310-220872332 GTATTCTCCTGCACTGGGACTGG - Intergenic
922414722 1:225410618-225410640 GTAAAGTTACCCACTGTGACAGG - Intronic
1063505620 10:6595641-6595663 GCAAACTCATCAACAGGAACAGG - Intergenic
1064973891 10:21093718-21093740 CTAAGCTCATCCACTGGAAGAGG + Intronic
1069703906 10:70445166-70445188 GCACCCTCATCCACTGAGACTGG + Intronic
1070552338 10:77500712-77500734 GTAAACTCCTCTACTGCTACTGG - Intronic
1075202934 10:120421359-120421381 GAAAACCCATCCCCTGGGGCTGG + Intergenic
1078584146 11:12566361-12566383 TCAAACTCATCCACAAGGACTGG + Intergenic
1084160791 11:67348850-67348872 GTAGACACATGCACTGTGACAGG - Intronic
1091176395 11:133562115-133562137 GTCAACCCAGGCACTGGGACGGG + Intergenic
1096538947 12:52292939-52292961 TTAAACTCCTCCACTGAGGCTGG - Intronic
1097753716 12:63386047-63386069 GTAAAAACATCCAGTGGGAAAGG + Intergenic
1102522596 12:113487900-113487922 GCAAACTAATCCACAGTGACAGG - Intergenic
1107718339 13:43222360-43222382 GTAAAATCATCTCCTGGGAATGG - Intronic
1108375470 13:49810047-49810069 TTAAACTCCTCCACTGGGGTTGG + Intergenic
1110733845 13:78911723-78911745 GTTAACTCTTCCACTGAGATGGG - Intergenic
1112665872 13:101572539-101572561 GTTAACTCAGCCTCTAGGACTGG - Intronic
1113567452 13:111327377-111327399 GTAAGTTGTTCCACTGGGACAGG - Intronic
1118314806 14:64719564-64719586 GTAAACTCATCCACAGGCTGTGG - Intronic
1118611506 14:67544182-67544204 GGAAAATCATTCACTGGCACAGG + Intronic
1120186562 14:81399826-81399848 GTAAACTCTTCCACTTAGCCTGG - Intronic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1136864664 16:33737133-33737155 GCAAACTCATCCTCTGTCACAGG + Intergenic
1137627861 16:49920955-49920977 CCACACTCGTCCACTGGGACAGG - Intergenic
1203126159 16_KI270728v1_random:1585269-1585291 GCAAACTCATCCTCTGTCACAGG + Intergenic
1146121368 17:30198361-30198383 GGAAACTCATTCACTTGGAGGGG + Exonic
1146511581 17:33453824-33453846 GCAAACTAATCCACAGTGACAGG - Intronic
1150702352 17:67459014-67459036 GAAAAATCATCCCCTGGTACAGG - Intronic
1154109698 18:11556203-11556225 TGAAAATCTTCCACTGGGACAGG - Intergenic
1155276106 18:24189275-24189297 GTAAAGTCAACCACTGTAACAGG + Intronic
1157437828 18:47686302-47686324 GTCAACTCTTCCACTGCCACAGG + Intergenic
1158130770 18:54150294-54150316 GTAAAACCATTCACTGGGAGTGG - Intergenic
1158818635 18:61132786-61132808 GTAAATTCAGCCAAAGGGACAGG + Intergenic
1159985902 18:74840688-74840710 GTGATCTCATCAGCTGGGACAGG - Intronic
1160156032 18:76434468-76434490 GTAAACGCATCCACTGGCTCTGG + Intronic
1163395502 19:17058097-17058119 GGAAACTCACCCACTGGGTGGGG + Intronic
1167957055 19:53074370-53074392 AAAAATTCATCCACTGGGCCAGG + Intronic
925054217 2:843605-843627 CTAATCAAATCCACTGGGACAGG - Intergenic
925875284 2:8306290-8306312 TTAAACCCATCCTCCGGGACAGG - Intergenic
925915947 2:8606482-8606504 GTAAAAGCTTCCACTGGGCCTGG + Intergenic
928059346 2:28095203-28095225 GTTAAGTCAACCACTGGGAGTGG + Intronic
928946850 2:36779268-36779290 GGAAACTCATGCACAGGGAGTGG - Intronic
931326820 2:61234457-61234479 ATAAACTGATCTACTGAGACAGG + Intronic
931645004 2:64414213-64414235 GGAAACGCATCCTCTGGGGCTGG + Intergenic
934633190 2:95953952-95953974 GCAAACTCATCCTCTGTCACAGG + Exonic
935215791 2:100974411-100974433 GTAAACTCATCCACTGGGACAGG - Intronic
937595842 2:123672168-123672190 GTAAACTCATCAACCAGGGCTGG + Intergenic
945915263 2:215697006-215697028 TTAAATCCATCCACTGGGACAGG + Intergenic
1173154749 20:40598703-40598725 GCCAAGTCATCCAATGGGACAGG + Intergenic
1185081815 22:48713724-48713746 GGCAAGCCATCCACTGGGACAGG - Intronic
950640635 3:14346070-14346092 GAAAACTAAGCCCCTGGGACTGG - Intergenic
952712827 3:36448820-36448842 GTAATCTCAGCTACTGGGAAGGG + Intronic
953683301 3:45056535-45056557 CAAAACTCATCAACTGGGCCAGG - Intergenic
954397438 3:50300353-50300375 GTACACTCAGCCACTGTCACAGG - Exonic
958801722 3:98763850-98763872 GTCATCTCATCCACTGGACCTGG - Intronic
960193752 3:114739761-114739783 GTAAACTCATTCAGTGGTAGAGG + Intronic
960483896 3:118227487-118227509 GCAAACTCAACCACTGGGCCAGG + Intergenic
967196612 3:187031728-187031750 GTAAAATAATCCACTCGGCCAGG - Intronic
969504778 4:7578533-7578555 GGAAACTCATCAACTGGCTCAGG - Intronic
969709225 4:8833120-8833142 GAAAACCCATACACTGGGAAGGG - Intergenic
972493147 4:39606869-39606891 GTAAAATCATCCAACTGGACTGG + Intronic
973926910 4:55748147-55748169 CTAAACTCATCCACTTGCATTGG + Intergenic
975902096 4:79165235-79165257 GTGAAGTCATTAACTGGGACAGG + Intergenic
976197170 4:82544316-82544338 TTAAATTCATCCACTTTGACAGG - Intronic
978016035 4:103748061-103748083 ATAACCTCTTCCAATGGGACTGG - Intergenic
979482196 4:121232388-121232410 TTAAACTCTTCGACTGGGAAGGG - Intergenic
988100983 5:26677809-26677831 GTAAACACATCAACTCTGACAGG + Intergenic
989553098 5:42758498-42758520 GTAAACTCATCCAGTCAGAATGG + Intronic
996049653 5:118917674-118917696 GTAAAATCATCCAATTGGCCGGG + Intronic
997966207 5:138358421-138358443 GTAATCTCAGCTACTGGGACTGG - Intronic
1000573168 5:162940378-162940400 GTAAAATCAACCACTGGAAATGG - Intergenic
1002124675 5:177033816-177033838 ATAAATTCATCAACTGGGCCAGG - Intronic
1003812940 6:9804837-9804859 TTAAACTCAACCACTTGGAGGGG + Intronic
1004171948 6:13302229-13302251 GTAAAATCAGCCCCTGGGAGGGG + Intronic
1006093828 6:31643880-31643902 GAAAACTCACCCACAAGGACTGG + Exonic
1008008495 6:46438017-46438039 GTAAACCCAGCCACAGTGACAGG - Intronic
1008043323 6:46825945-46825967 GTAATCTAATCCTCTGGGGCAGG + Intronic
1010685677 6:78852863-78852885 GGAATCTCATCCTCTGAGACAGG + Intergenic
1014236267 6:118958874-118958896 GTAAAGTCATAGACTGGGAAGGG - Intergenic
1018083015 6:160275173-160275195 ATAAAATAATCCTCTGGGACTGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1022760529 7:33344362-33344384 AAAAACTCATCCCCTGGGCCGGG - Intronic
1023253709 7:38291808-38291830 GTAAAATCATACACTGGTACTGG - Intergenic
1023547207 7:41330610-41330632 AGAACCTCATCCACTGGGAATGG + Intergenic
1027992871 7:85385513-85385535 TTAAACTCAGCCACAAGGACAGG - Intergenic
1030969950 7:116044810-116044832 GCAAAATACTCCACTGGGACAGG + Intronic
1031782146 7:125981713-125981735 GCAAACTCATACACTGGGGAAGG - Intergenic
1032925465 7:136599254-136599276 GAAAACTCATCCAGTGGGGCTGG + Intergenic
1033857385 7:145580943-145580965 GAAAACTCATCCACAGAGAATGG - Intergenic
1050097688 9:2084450-2084472 GTAAACTCATCAACTCTGAGGGG - Intronic
1050546903 9:6716834-6716856 GCAAACTCACCCACTGGGTGGGG - Intergenic
1051192552 9:14530725-14530747 GTCAGCTCATCCACTGTGCCCGG - Intergenic
1053511035 9:38687873-38687895 GAAAAGTCATTCACTGAGACTGG - Intergenic
1062102334 9:134734739-134734761 GTAAAATCAGCCACTGAGTCTGG - Intronic
1187913714 X:24133539-24133561 GTAATCTCCTCCAGTGGGCCAGG - Intergenic
1189724854 X:43958245-43958267 GCACACCCATCCAGTGGGACAGG - Intronic
1199216593 X:145266252-145266274 GTACACTCATCAACTGGGGTGGG - Intergenic