ID: 935216973

View in Genome Browser
Species Human (GRCh38)
Location 2:100982335-100982357
Sequence GATCCAGGAGCAGCTCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935216970_935216973 4 Left 935216970 2:100982308-100982330 CCGGTGGCAACAGGAAGAGCTCC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG 0: 1
1: 0
2: 4
3: 46
4: 334
935216969_935216973 11 Left 935216969 2:100982301-100982323 CCAATATCCGGTGGCAACAGGAA 0: 1
1: 0
2: 0
3: 3
4: 70
Right 935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG 0: 1
1: 0
2: 4
3: 46
4: 334
935216967_935216973 19 Left 935216967 2:100982293-100982315 CCTGCAGGCCAATATCCGGTGGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG 0: 1
1: 0
2: 4
3: 46
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935216973 Original CRISPR GATCCAGGAGCAGCTCTGCC TGG Exonic
900146344 1:1160528-1160550 GTCCCAGGAGCAGTTCTTCCTGG - Intergenic
900848850 1:5126080-5126102 AATCCAGGATCATCTCTCCCTGG + Intergenic
901000284 1:6145634-6145656 GCCCCAGCAGCAGCTCTTCCTGG - Intronic
901827619 1:11872653-11872675 GCCCCAGAAGCAGCTCGGCCTGG - Intergenic
902375776 1:16029329-16029351 GAGCCAGGACCAGCTCTGGTGGG + Intronic
902630807 1:17703265-17703287 CCTCCAGGGGCAGCTCAGCCAGG - Intergenic
903446570 1:23426070-23426092 GATCCAGGTGCAAGGCTGCCAGG + Intergenic
903604857 1:24568077-24568099 GTTCCAGGCCCAGCCCTGCCTGG - Intronic
903779234 1:25810884-25810906 GCTCCAGGACCAGCTGTTCCTGG + Intronic
903959972 1:27050829-27050851 AATCCAGGAGCAGCTTAGCTGGG + Intergenic
905134327 1:35786828-35786850 GGTCCAGAAGCATTTCTGCCTGG - Intergenic
905207146 1:36349470-36349492 GATCCAAGACCAGGTCTGCAGGG + Intronic
906068568 1:43000512-43000534 AATTCAGGAGCAGCTCAGCTGGG - Intergenic
906240107 1:44237680-44237702 GAACTAGGTGCAGCTCTGCCAGG + Intronic
906523783 1:46482421-46482443 AATCCAGGAGCAGCTTAGCTGGG - Intergenic
907574458 1:55513588-55513610 AATCTAGGAGCAGCTCAGCTGGG - Intergenic
912645299 1:111386598-111386620 GCTCCAGGACCACCTCAGCCTGG + Intergenic
913439302 1:118880651-118880673 GATCCAAGAGCAGAGCTGTCTGG - Intergenic
916742121 1:167655244-167655266 GGTCCAGGCCCATCTCTGCCTGG + Intronic
918967127 1:191365448-191365470 CATCCAGGAGCAGCTGTTTCAGG - Intergenic
922642313 1:227246160-227246182 GTTCCATGAGCAGTTCTGCCAGG - Intronic
922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG + Intergenic
924071891 1:240288982-240289004 AATCCAGGTGCAGCTCAGCTAGG - Intronic
924380909 1:243463508-243463530 GACACAGGAGCAGCCCTGGCTGG - Intronic
924739575 1:246786941-246786963 GAGCCAGGAGCTGGTGTGCCAGG - Intergenic
1063692292 10:8298085-8298107 AATCCAGGAGCATCTTAGCCGGG - Intergenic
1065126762 10:22581249-22581271 CATCAAACAGCAGCTCTGCCTGG + Intronic
1067036916 10:42927647-42927669 GGCTCAGCAGCAGCTCTGCCAGG - Intergenic
1067093322 10:43282852-43282874 GCCCCAGCAGCAGCTCTGCAAGG + Intergenic
1067140164 10:43649671-43649693 CATCCTGGAGCTGTTCTGCCTGG + Intergenic
1067428544 10:46227183-46227205 TATGCAGGGGAAGCTCTGCCAGG - Intergenic
1067562988 10:47316940-47316962 GAGCCAGCAGCAGCAGTGCCTGG - Intergenic
1067737973 10:48873535-48873557 GATCCAGGAGCAGCTTTTTGGGG + Exonic
1068135055 10:52943918-52943940 GATCCAGCAGCGGTTATGCCTGG - Intergenic
1068757597 10:60671993-60672015 AATCCAGGAGCAGCTCAGTTAGG - Intronic
1069732929 10:70631014-70631036 GAGTGAGGAGCATCTCTGCCCGG + Intergenic
1070726464 10:78794871-78794893 GAGCCAGGTGCAGCTCTGTTGGG - Intergenic
1070826051 10:79391228-79391250 CATTCAGGATCAGCTCTCCCAGG - Intronic
1072083462 10:92056143-92056165 GGTGCAGGAGCAGCTCTGCAGGG - Intronic
1072912189 10:99512845-99512867 AACCCAGGAGTAGCTCTGCTTGG + Intergenic
1074068351 10:110039688-110039710 AATCCAAGAGCAGCTTTGCTGGG + Intronic
1074393029 10:113073735-113073757 GATCGGGAAGCAGCTCTGCAGGG - Intronic
1074884843 10:117685375-117685397 GGTGCAGGAGCAGATCTGCCTGG - Intergenic
1075667968 10:124244377-124244399 GATTCAGGTCCGGCTCTGCCCGG + Intergenic
1076057141 10:127384858-127384880 GCTGAAGGAGCAGCTCTACCAGG + Exonic
1076208502 10:128622527-128622549 GAGCCAGGAGGATCTCAGCCAGG - Intergenic
1076348132 10:129794760-129794782 GAAAAAGGAGCAGCTCTTCCTGG + Intergenic
1076896536 10:133315816-133315838 GAAACACGAGCATCTCTGCCGGG - Intronic
1076992043 11:280478-280500 GGTCCAGGATCAGGTCAGCCAGG - Exonic
1077495457 11:2884784-2884806 GAACCAGGGGCAGCGCGGCCAGG - Exonic
1077575677 11:3381366-3381388 TACTCAGGATCAGCTCTGCCTGG + Intergenic
1078101546 11:8333169-8333191 AAGCCAGGAGCATCTCAGCCTGG + Intergenic
1079092442 11:17490588-17490610 ATTCCTGGAGCAGCCCTGCCTGG + Intergenic
1079111309 11:17606625-17606647 GATCCAGGGCCTGCCCTGCCAGG + Intronic
1079626695 11:22625294-22625316 GCTCCAGCAGCAGCTCCGCCTGG + Exonic
1080454882 11:32409138-32409160 GATCTAGGGGCATCTGTGCCAGG - Intronic
1080461065 11:32455364-32455386 GCTGCAGCAGCAGTTCTGCCTGG - Intergenic
1081596190 11:44461128-44461150 AATCCAGGAAGGGCTCTGCCGGG + Intergenic
1081712284 11:45225012-45225034 GACCCATCGGCAGCTCTGCCAGG + Exonic
1081771759 11:45654476-45654498 GCCCCAGGCCCAGCTCTGCCAGG - Intronic
1081796480 11:45824013-45824035 GAACCAGGACCAGATCTACCGGG + Intergenic
1083516536 11:63263970-63263992 CCTCCAGAAGGAGCTCTGCCAGG + Intronic
1083634199 11:64111337-64111359 AGTCTAGGAGCACCTCTGCCAGG - Intronic
1083888980 11:65586374-65586396 AACCAAGGGGCAGCTCTGCCAGG + Intronic
1084654304 11:70506241-70506263 TGTGCAGGAGCAGCTCTGGCTGG - Intronic
1085011681 11:73145704-73145726 CTTCCAGGGGTAGCTCTGCCTGG - Intergenic
1085215510 11:74827068-74827090 GAGCCTGGAGCACCTCTGCTAGG - Intronic
1085530452 11:77189388-77189410 CCTCCAAGAGCAGCTATGCCCGG + Exonic
1085762886 11:79257471-79257493 GCTCAAGGAGCACCTCTGGCTGG - Intronic
1086341478 11:85852882-85852904 AAGTCAGGAGCACCTCTGCCCGG + Intergenic
1089675931 11:120089195-120089217 GAGCTAGCATCAGCTCTGCCTGG - Intergenic
1092263034 12:6962613-6962635 GGTCCGGGAGCAGCTCGGTCCGG + Intergenic
1095142734 12:38686611-38686633 AATCCAGAAGCAGCTCAGCACGG + Intronic
1096329526 12:50698335-50698357 GTTCCAGGAGCCCCTTTGCCAGG + Exonic
1096413874 12:51395997-51396019 GAACTAGGAGCAGCTCTGCTTGG - Intronic
1097065472 12:56317290-56317312 GTTCCAGGAGCTTCTCTGCCTGG + Exonic
1098569511 12:71972994-71973016 GATCCAGGAGCTGCTGTGCTGGG + Intronic
1101836635 12:108300228-108300250 GCTCCAGGAGCAGGTGCGCCAGG + Intronic
1103271916 12:119680477-119680499 GCTGCAGGAGCTGCTCTGCCTGG - Exonic
1103350236 12:120278580-120278602 AAGCGAGGAGCACCTCTGCCTGG - Intergenic
1104127339 12:125861059-125861081 GCTCCAGGAGCAGCTCCAGCGGG - Intergenic
1104137312 12:125952782-125952804 GCTCTAGGGCCAGCTCTGCCAGG + Intergenic
1104483966 12:129133467-129133489 GATCAAGAAGCAGGTCTGCATGG - Intronic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1105772794 13:23629269-23629291 GAACCAGGAGTAGCCCTCCCTGG + Intronic
1108269811 13:48748641-48748663 GCTCCAGGCTCAGCCCTGCCTGG - Intergenic
1108370279 13:49761787-49761809 AAGCGAGGAGCATCTCTGCCCGG + Intronic
1111731805 13:92086163-92086185 GATTTGGGAGCAGCTCTGCAGGG - Intronic
1112344469 13:98577594-98577616 GACACCGAAGCAGCTCTGCCCGG - Intronic
1112483283 13:99796633-99796655 GATCAAAGTGCAGCTCTGCCTGG - Intronic
1113437210 13:110302477-110302499 GCTGCAGGGGCAGCTCTGCGTGG - Intronic
1113438179 13:110308682-110308704 GCGCCCGGAGCAGCTCTTCCAGG - Intronic
1113582312 13:111438103-111438125 AATTCAGGAGCGGCTTTGCCTGG - Intergenic
1113598446 13:111550757-111550779 GATCAAGGAACAGCTTTGCAAGG - Intergenic
1114253684 14:20983469-20983491 TGTCCAGGTGCTGCTCTGCCTGG + Intergenic
1118758783 14:68864912-68864934 GATCCAGGAGAAGCGCTGTTGGG - Intergenic
1119137817 14:72236882-72236904 GAAGCAGGAGCACCTTTGCCCGG - Intronic
1121454199 14:94027880-94027902 CTTCCAGGAGCAGCTCAACCAGG - Intronic
1121751614 14:96362865-96362887 GAGCCTGGAGCAGCTCAGCCTGG - Exonic
1122198882 14:100109874-100109896 GTTCCAGTACCAGCTGTGCCAGG + Intronic
1122366204 14:101196177-101196199 GATGCAGGCGCAGCCCTGCCAGG - Intergenic
1122481413 14:102049800-102049822 GTCCCTGGAGGAGCTCTGCCTGG + Exonic
1122717003 14:103701902-103701924 CACCCAGGAGCTGCTCTGCCAGG + Intronic
1122748858 14:103918291-103918313 GCTCCAACACCAGCTCTGCCTGG + Intronic
1122843131 14:104476387-104476409 GGTCCTGGAGAAGCTCTCCCCGG + Intronic
1122893833 14:104745524-104745546 CAGCCAGGAGCAGCTCGCCCAGG - Intronic
1123056643 14:105574074-105574096 GGCCCAGGAGCAGCTCAGCGTGG + Intergenic
1123081566 14:105697711-105697733 GGCCCAGGAGCAGCTCAGCGTGG - Intergenic
1123115894 14:105893886-105893908 GAGCCATGCGCAGTTCTGCCGGG - Intergenic
1127152867 15:56096138-56096160 GGTCCAGGAGCAGCAGTGCGGGG - Exonic
1127595221 15:60474842-60474864 CAGCCAGGAGCCACTCTGCCTGG - Intronic
1127641211 15:60917564-60917586 CATCCACGAGCAGCTCTATCTGG + Intronic
1128258843 15:66217773-66217795 GTTCTAGAAGCAGCTCTGCCAGG - Intronic
1128546504 15:68572147-68572169 AATTGAGGAGCAGCTCTTCCAGG + Intergenic
1129250241 15:74304711-74304733 GAGCCTGGTGCTGCTCTGCCAGG + Intronic
1130537512 15:84797920-84797942 CATCCAGGAGCGACACTGCCAGG + Exonic
1130667335 15:85880705-85880727 GAAGGAGGAGCAGCTGTGCCAGG - Intergenic
1130901559 15:88210550-88210572 GATGCAGGAACAACTCTCCCAGG + Intronic
1132064919 15:98722881-98722903 GAATCAGGAGCATCTCCGCCTGG + Intronic
1132289039 15:100686473-100686495 TGTCCAGCAGCAGCCCTGCCGGG - Intergenic
1132691448 16:1183502-1183524 GATCCAGGATCAGGGTTGCCGGG - Intronic
1133128028 16:3658795-3658817 GATCCACCAGCAGCTGAGCCAGG + Exonic
1133189279 16:4121613-4121635 GCTCCAGCAGGAGCTGTGCCAGG - Intergenic
1134906882 16:17987551-17987573 GGCCCAGGAGCAGATCTACCAGG + Intergenic
1135064921 16:19301320-19301342 GATCCAGGACCAGTACTTCCAGG - Intronic
1136158237 16:28400198-28400220 GATCTGGGCCCAGCTCTGCCAGG - Intronic
1136204850 16:28715085-28715107 GATCTGGGCCCAGCTCTGCCAGG + Intronic
1136920600 16:34268263-34268285 GATCCAGAAGCAGATCTCGCCGG - Intergenic
1137613173 16:49832595-49832617 GATGCAGGAGCAGTTATGACAGG + Intronic
1138082884 16:54108477-54108499 GATACAGGAGCAGCTCTGTCTGG - Intronic
1139078679 16:63486808-63486830 GATCCAGGAGAAACACTGCGTGG - Intergenic
1139924001 16:70475730-70475752 GCTCCAGGTGCAGCACTGCGTGG - Exonic
1140041357 16:71410371-71410393 GGCCCAGGTGCAGCTCTGACAGG + Intergenic
1141749245 16:85947127-85947149 GATCCATCTGCAGCCCTGCCAGG - Intergenic
1141922254 16:87143939-87143961 GACCCAGGAGCAGATGAGCCAGG - Intronic
1141943189 16:87292221-87292243 AATCCAGGAGCAGCTCATCTGGG + Intronic
1142003474 16:87677792-87677814 GAGACAGGAGCGGGTCTGCCTGG - Intronic
1142569665 17:864970-864992 GATCCAGGAGCCTGACTGCCAGG - Intronic
1143866303 17:9926323-9926345 GAACCAGCAGCAGCACTGCTAGG + Intronic
1143881782 17:10035470-10035492 TATCCAGGAGCATCTCTAACGGG - Intronic
1144185372 17:12790706-12790728 ACTCCAGGAGCGGCTCTGCAGGG + Intronic
1144249263 17:13399260-13399282 GATCCAGGAGCATGTAAGCCTGG + Intergenic
1144729824 17:17519910-17519932 GATCCAGGAGCAGCTAGACCAGG - Intronic
1144958657 17:19032721-19032743 GTTCCAGGAGCCACTCAGCCAGG + Intronic
1144976502 17:19141803-19141825 GTTCCAGGAGCCACTCAGCCAGG - Intronic
1145095441 17:20021531-20021553 GACCCAGGAGTAGGACTGCCTGG + Intronic
1145273169 17:21415280-21415302 GTTGCAGGAGCCGCCCTGCCTGG + Exonic
1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG + Exonic
1145790412 17:27623156-27623178 TGACCAGGGGCAGCTCTGCCAGG + Exonic
1146915320 17:36674584-36674606 AATCCAGGAGCAGCTGAGCCAGG - Intergenic
1147027226 17:37597314-37597336 AATCTAGGAGTAGCTCTGCTGGG - Intronic
1147576063 17:41599712-41599734 CCCCCAGGAGCAGATCTGCCTGG - Intergenic
1148115170 17:45171246-45171268 GTTCCAGGGGCAGGTCTCCCAGG - Intergenic
1148229661 17:45923812-45923834 GTTCAAAGCGCAGCTCTGCCAGG + Intronic
1148456536 17:47814331-47814353 GTTCCAGGAGCAGCTCTGCTGGG - Intronic
1148752528 17:49953544-49953566 GATGTAGGTGCAGCTCTGCGTGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148766685 17:50043747-50043769 AGCCCAAGAGCAGCTCTGCCGGG - Intergenic
1149256482 17:54832999-54833021 TATCCAGGAGCAGGACTGCAGGG - Intergenic
1150576337 17:66434021-66434043 GAGCCAGGAGCAGCAGAGCCAGG + Intronic
1151745198 17:76008185-76008207 GAGCCGGGAGGAGCTCAGCCAGG - Exonic
1151894223 17:76969321-76969343 TATGCATGAGGAGCTCTGCCTGG + Intergenic
1151965008 17:77426549-77426571 GTTCCAGGAGCAGCCAGGCCAGG - Intronic
1152721573 17:81926443-81926465 GAAGCAGGGGCAGCTCTACCAGG - Intronic
1152784457 17:82240691-82240713 TGTCCGGGAGCAGCACTGCCTGG - Intronic
1154420753 18:14224723-14224745 AAACGAGGAGCACCTCTGCCCGG + Intergenic
1154441450 18:14393196-14393218 CATCCAAGAGCAGCCCGGCCAGG - Intergenic
1156339794 18:36200773-36200795 GAGCTAGGATCAGCTCAGCCTGG + Intronic
1156485776 18:37464677-37464699 GGTCATGGAGCAGCCCTGCCAGG + Intronic
1157180295 18:45491867-45491889 CAGCCAGCACCAGCTCTGCCAGG + Intronic
1157894035 18:51447407-51447429 GACCCAGCAGCCGCTCTGCTTGG + Intergenic
1158149563 18:54352538-54352560 AATCCAGGAACAGCTTTGCTAGG - Intronic
1159959832 18:74546766-74546788 GTTCAAGGAGCAGCTCTGTTAGG + Intronic
1160319833 18:77879985-77880007 GCCCCAGGAGCTGCTCTGCCCGG - Intergenic
1160411072 18:78675801-78675823 GAACCAGGACCAGCTCTGGATGG - Intergenic
1160532144 18:79571788-79571810 GCTCCAGGAGCTGCCCTGTCAGG + Intergenic
1160912695 19:1482166-1482188 CATCCTGGGACAGCTCTGCCTGG - Exonic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1161589589 19:5123338-5123360 GACCCAGGAGGACCTCTCCCAGG + Intronic
1162158903 19:8697618-8697640 GAGCGCGCAGCAGCTCTGCCCGG + Exonic
1162164548 19:8743405-8743427 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162165620 19:8750873-8750895 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162166685 19:8758329-8758351 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162167751 19:8765785-8765807 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162168690 19:8772083-8772105 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162683163 19:12362152-12362174 AAGCGAGGAGCATCTCTGCCTGG + Intronic
1163234739 19:16023756-16023778 CATCCAGGACCAGTTCTTCCGGG + Intergenic
1164757873 19:30703685-30703707 GACTCAGGGGAAGCTCTGCCTGG - Intronic
1164836463 19:31358030-31358052 GAACCAGGCCCAGCTCTTCCTGG + Intergenic
1167442039 19:49514084-49514106 GATCAAGGAGAAGCTCTTTCTGG + Exonic
1167661419 19:50798097-50798119 AAACCAGGAGCAGCTCCCCCAGG + Exonic
1168222405 19:54970054-54970076 TCTCCTGGAGCAGCTCAGCCAGG + Exonic
925132424 2:1503250-1503272 CTTCCAGGAGCTGCTCTGTCTGG - Intronic
925404523 2:3597254-3597276 GATCCCGGAGCAGCCCAGGCTGG - Intronic
925873796 2:8294269-8294291 CATCAGGGAACAGCTCTGCCAGG + Intergenic
927721011 2:25382138-25382160 GAGCCAGCAGCAGCCCTCCCAGG - Intronic
927774118 2:25888769-25888791 GTTCTGGGAGCAGCTCTTCCTGG - Intergenic
928934658 2:36662879-36662901 AAGTGAGGAGCAGCTCTGCCCGG + Intergenic
929576591 2:43056276-43056298 GATGCAGGAGCAGCTGAGCCGGG + Intergenic
931256809 2:60581452-60581474 GTTCCAAGCGCAGCTCTGCAGGG - Intergenic
931444240 2:62313663-62313685 GTTCCAGGAGAAGCACAGCCAGG - Intergenic
931996729 2:67845887-67845909 GGTCCAGGGGAAGCCCTGCCAGG + Intergenic
935134124 2:100284435-100284457 GCTCCAGGGGCAGCACGGCCAGG + Exonic
935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG + Exonic
939910570 2:147977814-147977836 GATCCAGTAGGAGCCCTCCCAGG - Intronic
940913571 2:159229983-159230005 GCTGCAGGAGCAGCCCTGGCTGG - Exonic
941116684 2:161480189-161480211 GAACCTGGGGCACCTCTGCCAGG - Intronic
941841439 2:170088855-170088877 AATCCAGGAGCAGCTTAGCTGGG + Intergenic
943224092 2:185145698-185145720 GATCCAGGTGCAGAGCTGCAAGG - Intergenic
943432072 2:187816780-187816802 CAGCCAGTAGCACCTCTGCCTGG + Intergenic
945253318 2:207782890-207782912 GCCCCAGGCTCAGCTCTGCCTGG + Intergenic
947718373 2:232352887-232352909 TGTCCAGGATCAGCTCTCCCCGG + Intergenic
947790933 2:232868765-232868787 CATCTAGGAGCAGCTCTGTTTGG - Intronic
948284094 2:236770550-236770572 GAAGCAGGCTCAGCTCTGCCAGG + Intergenic
948304953 2:236939951-236939973 GAACCAGGAGCAGCTGAGCTAGG + Intergenic
948698267 2:239745052-239745074 AAGCCAGGACCAGCTCTGCCCGG + Intergenic
948897871 2:240935567-240935589 GCTCCAGGAGCAGGTGGGCCAGG + Intronic
1169552912 20:6719510-6719532 GAGTCAGTTGCAGCTCTGCCTGG + Intergenic
1169788518 20:9385742-9385764 AAGCGAGGAGCACCTCTGCCCGG - Intronic
1170118483 20:12886984-12887006 AATCCAGGAGCAGCTCAGCTGGG + Intergenic
1170548647 20:17456466-17456488 GGTCCAGGGCCAGCTCTGCAGGG + Intronic
1172447288 20:34999826-34999848 GATCCAGCTGGAGCTCTCCCAGG + Exonic
1172704897 20:36875985-36876007 CACCCAGCAGCAGCTCGGCCTGG + Intergenic
1172806269 20:37614102-37614124 CATCCAGGAGCATATCTGCAAGG - Intergenic
1172985649 20:38986864-38986886 GGATCAGAAGCAGCTCTGCCTGG - Intronic
1173076674 20:39825824-39825846 AATCCAGGAGCAGCTTAGCTGGG - Intergenic
1173309823 20:41887583-41887605 GATCCAGGAACAGCTGAGCTGGG + Intergenic
1175844923 20:62053120-62053142 GGGCCAGACGCAGCTCTGCCTGG - Intronic
1175995710 20:62811482-62811504 GATCCAGGAGCGGCTTGTCCGGG + Exonic
1176275323 20:64262852-64262874 GACCTAGGAGCGGCTCTGCCAGG + Intronic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176852853 21:13935684-13935706 AATTGAGGAGCACCTCTGCCCGG - Intergenic
1179195270 21:39157554-39157576 CAGCCAGGAGCCCCTCTGCCCGG + Intergenic
1179646169 21:42777632-42777654 GAGACAGGAGCAGCAATGCCTGG + Intergenic
1179909737 21:44441473-44441495 GATGCAGGTGCAGCTTTGCCGGG - Intronic
1180854209 22:19036130-19036152 GCTCCAGGCTCAGCTCTGCCTGG + Intergenic
1180987312 22:19912517-19912539 GATGCACGTGCAGCTCTGCCTGG + Intronic
1181050846 22:20237592-20237614 GATCCTTGAGCTGCTGTGCCCGG + Intergenic
1181677539 22:24466061-24466083 AATCCAGGTGTAGCTCAGCCAGG - Intergenic
1181943487 22:26497121-26497143 GACCCTAAAGCAGCTCTGCCAGG - Intronic
1182118981 22:27774811-27774833 GTGCCAGGGGCAGCTCTGCCAGG + Intronic
1182981489 22:34675523-34675545 GTTCCAGGAGCAGCTCCTCCAGG - Intergenic
1183257594 22:36772535-36772557 GAACAAGTAGCAGCTGTGCCTGG + Intronic
1185149550 22:49156223-49156245 GATCCAACAGCAGCTCCACCAGG + Intergenic
1185218696 22:49618022-49618044 GTTCCTGGAGCAGCTCCCCCGGG + Intronic
1185231761 22:49687789-49687811 GCTCCAGGAGCAGCCCAGGCTGG - Intergenic
949636357 3:5985806-5985828 AATCCAGGAGCAGCTTGGCTGGG + Intergenic
949989861 3:9569997-9570019 AATTGAGGAGCATCTCTGCCCGG + Intergenic
950141892 3:10621289-10621311 GATCCAGGAGCAGAGTTGCAGGG + Intronic
950451183 3:13066725-13066747 TATCCAGGAGCCGCTCTGGCAGG + Intronic
950723862 3:14903037-14903059 GATTGGGGAGGAGCTCTGCCTGG + Intronic
953789585 3:45937141-45937163 GTTCCAGGTCCAGCTCAGCCAGG + Intronic
953899597 3:46832498-46832520 GAATGAGGAGCAGCTCTGACTGG + Intronic
954396813 3:50297388-50297410 AATCCAGGGGCAGCTTTGGCTGG + Exonic
954677606 3:52324427-52324449 GCTCCAGGAGAAGCTCTGAGTGG + Intronic
955412378 3:58664055-58664077 GATCCTGGAGCTGGACTGCCTGG + Intronic
957730428 3:84126300-84126322 GATCCAGCTGCAGCTTTGCATGG + Intergenic
958719023 3:97822238-97822260 GAACCGGGAGAAGCTGTGCCAGG - Exonic
960616146 3:119597927-119597949 CACCCAGAAGCAGCTCTCCCAGG - Exonic
961060368 3:123823501-123823523 AATCCATAAGCAGCTCTGACTGG + Intronic
961412519 3:126733099-126733121 TATCCAGGATAAGCTCTTCCAGG + Exonic
961449232 3:126994992-126995014 GACCCAGGGGCAGGCCTGCCAGG + Intronic
963602687 3:147391581-147391603 GAACCAGAAGCACCTCTGCTCGG + Intronic
964680526 3:159332919-159332941 GATGCAGGAGCAACTCTTCCAGG - Intronic
966749105 3:183305163-183305185 GATCCTGGAGCAAGACTGCCTGG - Intronic
967943893 3:194787114-194787136 AATCCAGGACCAGTTCTGGCAGG - Intergenic
968153909 3:196362392-196362414 GTTCCAGGATCAGTTCTGACTGG + Exonic
969601145 4:8177120-8177142 GAGCCGGGGGCAGCTCTCCCTGG - Intergenic
969608861 4:8216127-8216149 GGTCCATGAGCAGGTTTGCCAGG - Exonic
969674517 4:8607562-8607584 GCTCCAGGCCCAGCTCTGCAGGG + Intronic
969858428 4:10018150-10018172 GATCCAGGTGCAATTCTCCCAGG - Intronic
970442488 4:16093692-16093714 GACCCACAAGGAGCTCTGCCAGG - Intergenic
971207450 4:24584226-24584248 GCTCCAGGACCCGCTCGGCCAGG + Intronic
984490674 4:180431034-180431056 GCCCCAGGGGCAGCTCTGCAAGG - Intergenic
984881494 4:184413505-184413527 ACTCCAGTAGCAGCCCTGCCAGG + Intronic
992215262 5:74519189-74519211 GCTCCAGGGGCAGCTCTGCAGGG - Intergenic
993091997 5:83437871-83437893 AAGCGAGGAGCACCTCTGCCCGG + Intergenic
994891265 5:105639601-105639623 GGTCTAGGGGCAGCTCTGCGTGG + Intergenic
995061325 5:107814377-107814399 GGTCCAGGTCCAGCACTGCCAGG - Intergenic
995331350 5:110950389-110950411 GATCCAGAAGCAGATCTCACTGG - Intergenic
996353760 5:122574683-122574705 GTGCCAGAAGCATCTCTGCCAGG - Intergenic
997053567 5:130412869-130412891 GATCCAGCAGGAGGTGTGCCTGG - Intergenic
997248324 5:132370104-132370126 GACCCCGGAGCACCGCTGCCGGG + Exonic
999514142 5:152284099-152284121 AATCCAGAAGTAGCTCTGCTGGG - Intergenic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1001170076 5:169410910-169410932 GGTCCAGGAGCTGCTCTGATAGG - Intergenic
1001399775 5:171439571-171439593 GTTCCAGCTGCAGCTCTGCCAGG + Intronic
1001528219 5:172444180-172444202 GATCCAGGAGAGACTCTGACTGG - Intronic
1001555955 5:172637398-172637420 AATCCAGGAGCTGCTGTGACTGG + Intergenic
1002359461 5:178659209-178659231 GACCCAGCAGAAGCTCTGGCAGG - Intergenic
1002429635 5:179195577-179195599 GAACCACGAGGAGCTCTGCAGGG + Intronic
1003570053 6:7250036-7250058 GGTCCAGGAGCAGCTCAGAGAGG + Exonic
1003934794 6:10964250-10964272 TATAAAGGAGAAGCTCTGCCAGG - Intronic
1004534511 6:16487067-16487089 GTTCCAGGAGAAGCTGTTCCTGG - Intronic
1004568558 6:16822741-16822763 GTTTTAGGAACAGCTCTGCCTGG - Intergenic
1006030301 6:31172706-31172728 GCTCCAGGCTCAGCCCTGCCTGG + Intronic
1006114754 6:31769674-31769696 GACTCAGGAGCGGCGCTGCCGGG - Exonic
1006605282 6:35251779-35251801 GATTCAGCAGCAGCTTTGCCTGG - Exonic
1008119655 6:47597581-47597603 GATCCAGGAGCAGATGTGCCAGG + Intronic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1013759277 6:113498120-113498142 GATCCGGGAGCAGCTTAGCTGGG + Intergenic
1015723885 6:136278488-136278510 GATCCAGAAGCAGATCTCGCCGG - Exonic
1015965583 6:138693062-138693084 GTTCCAGGGGCAGCTCTGGGCGG + Intergenic
1015986122 6:138885674-138885696 GGTACAGCAGCAGCTCTGGCAGG - Exonic
1016058526 6:139603882-139603904 AATCCAGGAGCAGCTTAGCCAGG + Intergenic
1017855884 6:158349720-158349742 AATTGAGGAGCACCTCTGCCCGG - Intronic
1018995545 6:168707118-168707140 GATCCAAGGGCAGATCTGGCAGG - Intergenic
1019024185 6:168943357-168943379 GATTCAGGAGCTGCCCTGCTGGG - Intergenic
1019183456 6:170207465-170207487 CATCCAGGAGCTGCTAGGCCAGG - Intergenic
1019717659 7:2547440-2547462 GCTGCAGGAGCACCCCTGCCTGG - Exonic
1021538682 7:21733010-21733032 GCTCCACGGGAAGCTCTGCCTGG - Intronic
1021912942 7:25404725-25404747 AATCTGGGAGCAGCTCGGCCAGG + Intergenic
1022440263 7:30427409-30427431 GTTCAGGGAGCAGCTCTGCTTGG - Intronic
1023173503 7:37412988-37413010 AACCCAGGAGCAGCTTAGCCAGG - Intronic
1023200727 7:37694272-37694294 GCTTTTGGAGCAGCTCTGCCGGG + Intronic
1023830982 7:44038962-44038984 GCTGCAGGTCCAGCTCTGCCAGG + Intergenic
1026163279 7:67889062-67889084 AAACGAGGAGCACCTCTGCCTGG + Intergenic
1028019087 7:85749122-85749144 GATCCAGGAGAAGCTCCACAAGG + Intergenic
1029112050 7:98217548-98217570 GATCCTGGAGGGGATCTGCCTGG + Intronic
1029118094 7:98248272-98248294 GATCTAGGAGCCGCCCTGTCGGG - Intronic
1029676623 7:102074322-102074344 GATCCAGGAGCAGGGCTGTGTGG - Intronic
1029741316 7:102493271-102493293 GCTGCAGGTCCAGCTCTGCCAGG + Exonic
1029759306 7:102592440-102592462 GCTGCAGGTCCAGCTCTGCCAGG + Exonic
1029776675 7:102688350-102688372 GCTGCAGGTCCAGCTCTGCCAGG + Intergenic
1029872904 7:103714564-103714586 GAGCCAGAAGCTGCTCTGCATGG - Intronic
1030404966 7:109099452-109099474 TATCCAGGAGCTCCTCTGGCTGG + Intergenic
1032192405 7:129772493-129772515 GATCCAGGACCTGTTCTGCAGGG + Intergenic
1034226298 7:149486342-149486364 GATCCAGGAGCGGAACTGCTGGG - Intronic
1034243474 7:149626730-149626752 AATCCGGGAGTAGCTCTTCCAGG - Intergenic
1035050994 7:155999031-155999053 GACCCAGGCGCACCTTTGCCAGG + Intergenic
1035290296 7:157833661-157833683 GTTCCGGGAGCAGCTCTCCTGGG + Intronic
1035482553 7:159198880-159198902 GACCCAGGCGAGGCTCTGCCTGG - Intergenic
1036964080 8:13276701-13276723 GACCCAGGAGCAGCCCGGCGCGG - Intronic
1037994028 8:23339907-23339929 GATCCTGGCCCAGCCCTGCCTGG - Intronic
1038427154 8:27471124-27471146 AATCCAGCAGCAGCTCTGCTGGG - Exonic
1038433521 8:27518805-27518827 GAAGGAGGAGCAGCCCTGCCTGG - Intronic
1038749761 8:30284584-30284606 GGGGCTGGAGCAGCTCTGCCTGG - Intergenic
1039026795 8:33267383-33267405 AAGCCAGGAGGAGCTCTGCAAGG - Intergenic
1040638313 8:49301845-49301867 GAAACAGGAGCAGGTCTGCCTGG - Intergenic
1040916996 8:52573621-52573643 AATTCAGGAGCGTCTCTGCCCGG - Intergenic
1040969255 8:53115616-53115638 CACCCAGAAACAGCTCTGCCTGG + Intergenic
1041358142 8:57022250-57022272 CAGCCAGGAGCCCCTCTGCCCGG + Intergenic
1041889549 8:62853646-62853668 AATCCAGGAGCTGCTTTTCCTGG - Intronic
1043247610 8:78025312-78025334 GATTCAGGAGCAGGTTTACCAGG + Intergenic
1044099981 8:88123031-88123053 AATCCAGGAGCAGCTTAGCCAGG - Intronic
1045365834 8:101475358-101475380 AATCCAGGAGCAGCTCAGCCAGG - Intergenic
1046249362 8:111610025-111610047 GTTGTAGGAGCAGCTCTTCCTGG - Intergenic
1046703699 8:117427288-117427310 AAGCAAGGAGCACCTCTGCCCGG + Intergenic
1048533822 8:135274200-135274222 GGTCCAGGAGCAGCTCCGGTGGG - Intergenic
1048878609 8:138855796-138855818 GTTGCTGAAGCAGCTCTGCCTGG - Intronic
1048922275 8:139242061-139242083 GATGCTGGAACAGCCCTGCCAGG + Intergenic
1049180394 8:141219220-141219242 GATCAAGGGGCAGTTCTGTCGGG - Intronic
1050417768 9:5433923-5433945 AATTGAGGAGCACCTCTGCCCGG + Intronic
1051615181 9:18999785-18999807 GAGTGAGGAGCACCTCTGCCCGG + Intronic
1051616155 9:19008822-19008844 GGTCCAGGAGCAACTGTGTCTGG + Intronic
1052395466 9:27933114-27933136 TACCAAGGAGCAGCTCTGCTGGG - Intergenic
1053121212 9:35548463-35548485 GATCCAGGGCCTGCTCTCCCAGG + Exonic
1053258402 9:36639253-36639275 GATCCTGTAACAGCTCTGCAAGG - Intronic
1053719800 9:40934019-40934041 GATGCAGAAGCACATCTGCCTGG + Intergenic
1054806475 9:69400751-69400773 AATCCAGGAGCAGCTTAGCTGGG + Intergenic
1055772999 9:79737154-79737176 GATCCAGGAGCAGTTTAGCCAGG - Intergenic
1055855750 9:80685923-80685945 CCTCCAGCAGCAACTCTGCCAGG + Intergenic
1057785955 9:98087517-98087539 GTTCCAGGAGCCGCTCTACCCGG - Exonic
1059587622 9:115622741-115622763 AATTCAGGAGCAGCTCAGCTGGG - Intergenic
1061089872 9:128420631-128420653 GACCCTGGAGCAGCCCCGCCCGG - Exonic
1061119208 9:128632934-128632956 GACCAAGGAGGAGCTCTACCAGG + Exonic
1061295565 9:129675092-129675114 CATCCTGCGGCAGCTCTGCCCGG - Intronic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1062142180 9:134965643-134965665 GACCCAGGAACAGCCCTACCAGG + Intergenic
1062517686 9:136944456-136944478 GGCCCTGGAGCAGCTCTGCCCGG + Intronic
1062524668 9:136973397-136973419 GATCCAGGCCCAGCCCTGACCGG + Intergenic
1185705599 X:2264159-2264181 GCGCCAGGAGCACCTGTGCCCGG + Intronic
1185849878 X:3475387-3475409 CACCCAGGAGCAACTCAGCCCGG + Intergenic
1186515057 X:10160831-10160853 GATCCGACAGCAGCTCTGCAGGG - Intronic
1189220847 X:39370431-39370453 ACTCCAGCTGCAGCTCTGCCTGG + Intergenic
1189491367 X:41473786-41473808 GCGCCAGGCGCAGCTCAGCCAGG - Exonic
1190158967 X:48016736-48016758 AAGCGAGGAGCATCTCTGCCTGG + Intronic
1190692142 X:52920803-52920825 GATACAGGAGCCGATCTCCCCGG + Intergenic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1197571606 X:128156877-128156899 GTTCCAGGGGCAGCTGTGCAGGG + Intergenic
1199230907 X:145436135-145436157 AAGCGAGGAGCATCTCTGCCCGG + Intergenic
1199570329 X:149261160-149261182 GAGGCAGGAGCATCTCTGCTGGG - Intergenic
1199973841 X:152879851-152879873 GTGCCAGGAGCAGATCTGCCTGG - Intergenic
1200284148 X:154804923-154804945 CATCAAGGAGTAGGTCTGCCTGG - Intronic