ID: 935217745

View in Genome Browser
Species Human (GRCh38)
Location 2:100988195-100988217
Sequence AGATCTGCCCTGGAAGTTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935217745 Original CRISPR AGATCTGCCCTGGAAGTTGG GGG (reversed) Exonic
900278486 1:1849358-1849380 AGATCTGCCCTGTGAGATGGAGG - Intronic
900458897 1:2790749-2790771 AGCTCTGCCCTGGGAGTGGAGGG - Intronic
900850168 1:5136448-5136470 AGAACAGCCCTGAAAGGTGGGGG - Intergenic
901005053 1:6167526-6167548 TGATCAGCCCTGGAAATTGGTGG - Intronic
901348371 1:8568077-8568099 AGATCTGCCCTCAATGTAGGTGG + Intronic
901849511 1:12006704-12006726 AGTTCTGCTCGGGAAGGTGGGGG + Intronic
901937876 1:12639462-12639484 AGATCTGCCCTCAAGGTGGGCGG + Intergenic
902210062 1:14898588-14898610 AGATGTTCCCTGTAAGCTGGAGG - Intronic
902722442 1:18313054-18313076 GGATCAGCCCTGGATGGTGGGGG - Intronic
906060363 1:42944460-42944482 AGCTGGGCCCTGGAAGTGGGTGG + Intronic
906709288 1:47917139-47917161 AGGACTCCCCTGGAAGTTGGTGG + Intronic
909532291 1:76694446-76694468 AGATGTGACCTAGAAGTTGGAGG + Intergenic
915024183 1:152811953-152811975 AGAACTGCAAAGGAAGTTGGAGG - Exonic
915116396 1:153603342-153603364 TGATCTGCCCTGGAACAGGGTGG - Intergenic
916452367 1:164933382-164933404 AGTTCTACCTTGGAAGCTGGAGG - Intergenic
920298559 1:204974773-204974795 AGCTTTGCCCAGGATGTTGGTGG - Exonic
921620069 1:217315587-217315609 AGATCTGCCCTCAATGTGGGTGG + Intergenic
923364086 1:233242754-233242776 CTATCTGCCTAGGAAGTTGGAGG - Intronic
923510707 1:234649857-234649879 AGATCTGCCCTCAATGTAGGCGG - Intergenic
924034134 1:239918858-239918880 AGGTCTGAACTGGAAGCTGGTGG - Intergenic
1063431335 10:5991378-5991400 AGATCTGCTCTGGAAATTGAAGG - Intergenic
1063445199 10:6109223-6109245 TGATCTGCTCTAGAATTTGGGGG + Intronic
1067945696 10:50686764-50686786 GGAAGTGCCCTGGGAGTTGGGGG + Intergenic
1070602833 10:77877769-77877791 TGCTATGCCCTGGAAGGTGGGGG + Intronic
1071577821 10:86742440-86742462 AGACATGCCCTGGAATTGGGAGG + Intergenic
1071634124 10:87235861-87235883 GGAAGTGCCCTGGGAGTTGGGGG + Intronic
1071647572 10:87368078-87368100 GGAAGTGCCCTGGGAGTTGGGGG + Intronic
1072612641 10:97028935-97028957 ATGTCTGCCATGGAAGTGGGAGG - Intronic
1074427149 10:113361407-113361429 AGCTCTGCCGAGGAAGTGGGGGG + Intergenic
1075676108 10:124296635-124296657 AGATGAGCCCTGGGACTTGGTGG - Intergenic
1077075231 11:697925-697947 AGATCTGCCCAAGAAGCTGTGGG + Intronic
1077251338 11:1562010-1562032 ACATCTGCCCTGCAAGGTTGAGG - Intronic
1077475828 11:2790027-2790049 AGCCCTGCCCTGGGACTTGGAGG + Intronic
1078246157 11:9574322-9574344 AGAGCTACCCAGGAAGTAGGGGG - Exonic
1078629821 11:12992161-12992183 AGATCTGCCCTTGATATTGGTGG - Intergenic
1079007785 11:16804249-16804271 AGATCTGACCAGGAAAATGGAGG + Intronic
1081607610 11:44537140-44537162 AGCTCTGCCCTGGGAGTTATGGG + Intergenic
1081620224 11:44614986-44615008 GGAACTGCCCTGGAGGTGGGAGG + Intronic
1081818689 11:45969390-45969412 AGTTCTGCCCTGGAAAGTGATGG - Intronic
1085309581 11:75508332-75508354 AGATCTGCCTTGCAAATCGGTGG + Intronic
1086762689 11:90652888-90652910 ACATCTGCCCTGGAACTTTCAGG - Intergenic
1087688314 11:101290370-101290392 AGATCTGCCCTCAATGTGGGTGG + Intergenic
1088543770 11:110939705-110939727 AGTTCTTCCCAGGAAGTGGGTGG - Intergenic
1089514984 11:119026655-119026677 ATGAGTGCCCTGGAAGTTGGGGG - Exonic
1090417046 11:126547796-126547818 AAGTCTGCCCTGGACGATGGTGG + Intronic
1090665863 11:128914503-128914525 ACATCTGTCCTGGATGTGGGTGG + Intronic
1090686299 11:129125183-129125205 AAATTTCCCCTGGAAGTTGTTGG + Intronic
1090769880 11:129910579-129910601 AGAACTGCCCTGGATGTGGGAGG + Exonic
1091301244 11:134509602-134509624 GGGTCTGCCCTGGGAGCTGGAGG - Intergenic
1091835689 12:3583979-3584001 AGGTGTGCCCTGGAGGTGGGAGG + Intronic
1092124844 12:6067772-6067794 AGATGGGCACTGGAAGTTTGGGG + Intronic
1092295510 12:7194811-7194833 AGATCTTTTCTGGATGTTGGAGG + Intronic
1093653380 12:21669419-21669441 AGATCTGCCCTCAATGTTGGCGG + Intronic
1097744414 12:63285563-63285585 AGGTCTGCCCTTGATGTGGGTGG + Intergenic
1098156810 12:67608031-67608053 AGAACAGGCCTTGAAGTTGGGGG + Intergenic
1099904067 12:88751114-88751136 ACTGCTGCCCTGGAAGTTGGAGG - Intergenic
1100339321 12:93663314-93663336 AGATCTGCCCTCAATGTGGGTGG + Intergenic
1100429444 12:94517450-94517472 AGATCTGCCCTCCATGTGGGTGG - Intergenic
1101549373 12:105747806-105747828 AGAGCTGCCCTGTGAGTTTGGGG - Intergenic
1102093432 12:110214390-110214412 AGATCTACTCTAGAAGTTTGAGG - Intronic
1104314390 12:127683510-127683532 AACTTTGCCCTGGAAGTTGTGGG + Intergenic
1105216889 13:18292746-18292768 AGCTCTGCCCTGGGATCTGGAGG - Intergenic
1105550452 13:21390183-21390205 ATATCTGCCAGGTAAGTTGGAGG - Intronic
1111872538 13:93850934-93850956 AGATCTGCCTTGGAAGGGGTTGG + Intronic
1112026006 13:95411732-95411754 AGATCTGCCCTGGAATGTGCAGG - Intergenic
1115551362 14:34508129-34508151 AGATCTGCCCTCAGTGTTGGTGG - Intergenic
1115932841 14:38516782-38516804 AGAGCTACCTTGGAAGTTTGAGG - Intergenic
1116709184 14:48343310-48343332 AGATCTGCACTGGGATTTGGTGG + Intergenic
1117427619 14:55617465-55617487 AGATGTGCCATGGAAATTAGAGG + Intronic
1118910380 14:70057388-70057410 TGATCTCCCCTGGAACTTGGGGG - Intronic
1119339579 14:73865425-73865447 AGATCTGCCCTCAATGTGGGTGG - Intronic
1120479966 14:85037358-85037380 AGATCAGCCCTCAATGTTGGGGG - Intergenic
1120970722 14:90204864-90204886 TGATTTGTCCTGGGAGTTGGGGG + Intergenic
1121226740 14:92326809-92326831 TGATCTGCCCAGGAACTTAGTGG - Intronic
1121969104 14:98340205-98340227 AGATCTTCCCTCAAAGTGGGCGG + Intergenic
1123780042 15:23617293-23617315 AGATCTTGCCTGGAAATTGTAGG + Intronic
1124155763 15:27224119-27224141 GGAGCAGCCCGGGAAGTTGGAGG - Intronic
1124610410 15:31204151-31204173 AGATCTGCCCTCGATGTGTGTGG - Intergenic
1124941763 15:34224968-34224990 ATTTCCGCCCTGGAAATTGGTGG - Intergenic
1127804525 15:62506583-62506605 AGCTCTCCCATGGAGGTTGGGGG + Intronic
1128216779 15:65939813-65939835 AAACTTGCCCTGGAAGTGGGAGG - Intronic
1128800038 15:70491569-70491591 AGCTCTGCCCAGGCAGATGGTGG - Intergenic
1130018125 15:80202867-80202889 AGACCTGCCCTGCAGGGTGGTGG - Intergenic
1130568355 15:85017967-85017989 AGATATGCCCAGGATGGTGGTGG + Intronic
1132877087 16:2144734-2144756 AGATGGGCCCTGGGAGCTGGGGG - Intronic
1134433976 16:14237941-14237963 TGATGAGCCCTTGAAGTTGGTGG + Intronic
1136396412 16:29994921-29994943 AGCCCTGCCCTGACAGTTGGAGG + Intronic
1137370993 16:47905703-47905725 AAGTCTGCCCTGGTAGGTGGAGG + Intergenic
1141866333 16:86752480-86752502 CGTTCTGCCCTGGAAGTTGTGGG - Intergenic
1143663870 17:8345081-8345103 AGAAGTGCCCAGGAAGATGGGGG - Intronic
1152211715 17:79005956-79005978 AGATTTGCCGTGGAATTTGCAGG - Intronic
1152389375 17:79993595-79993617 AAATCTTCCCTGAAAGTTGCAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153521940 18:5962042-5962064 AGAGCTGCCCTGGGAGCTGGTGG + Intronic
1155248101 18:23929905-23929927 AGATCCGCCCTGGACAATGGGGG + Intronic
1158921077 18:62191433-62191455 ACATGTACCCTGGAAGTTGAAGG - Intronic
1160620973 18:80170425-80170447 AGATTTGCTCTGGCAGATGGGGG - Exonic
1161141171 19:2648820-2648842 ATAGCTGCCCTGCAAGGTGGAGG - Intronic
1161266222 19:3366056-3366078 CGAGCTGGCCGGGAAGTTGGAGG - Intronic
1162474034 19:10889127-10889149 AGATCTGACCTGGCAGTCTGGGG + Intronic
927881100 2:26690767-26690789 AGATCTTCCCTTGAAGAGGGAGG + Intergenic
928113423 2:28528142-28528164 AGAGCTGGCCTGGAAGTCAGGGG - Intronic
932388342 2:71359486-71359508 AGATCTGCCCTCAATGTGGGCGG - Intronic
935068972 2:99676863-99676885 AGGTCTGCCCTGGGAGCTAGCGG + Intronic
935217745 2:100988195-100988217 AGATCTGCCCTGGAAGTTGGGGG - Exonic
936600317 2:113889398-113889420 AGGTCGGCCCTGGGAGGTGGGGG + Intergenic
938943866 2:136193006-136193028 AGATCTGCCCTCAATGTGGGTGG - Intergenic
940898022 2:159099700-159099722 AGATGTCACCTGGAAGATGGTGG - Intronic
941970084 2:171340852-171340874 AGAGATGCCTTGGAGGTTGGGGG - Intronic
942182192 2:173390591-173390613 AGCTCTGGCCTAGAAGTTGAAGG - Intergenic
942208951 2:173651388-173651410 AGAACTGTCCTCGAAGTTGGAGG - Intergenic
943235474 2:185313222-185313244 AGATCTGCCCTAAATGTTGGGGG + Intergenic
948897674 2:240934862-240934884 AGCCCTGCCCTGGAAGCTGAAGG + Intronic
1169138953 20:3215592-3215614 GGGCCTGCCCTGGGAGTTGGAGG + Intronic
1169260634 20:4135791-4135813 AGCTCCTCCCAGGAAGTTGGCGG + Intronic
1170085461 20:12526530-12526552 AGATATTACCTGGAAGATGGTGG - Intergenic
1171268443 20:23793660-23793682 ATATGTGCCCAGGAAGCTGGTGG + Intergenic
1172118886 20:32586094-32586116 AGATCTGCCCAGGTAGGAGGGGG - Intronic
1172365503 20:34346011-34346033 AGACCCTCCCTGGAGGTTGGGGG + Intergenic
1174352966 20:49981586-49981608 AGTTCTGCCCTTCAGGTTGGTGG + Intergenic
1174396683 20:50251062-50251084 GGACCTGCCCTGGAGGTTTGAGG + Intergenic
1174400965 20:50275739-50275761 AGTGCTGTCCTGGAAGTTGGGGG + Intergenic
1174946654 20:54993707-54993729 AGATCTGCCCTCAGTGTTGGTGG + Intergenic
1175340506 20:58226384-58226406 ACATCTGCCCTGAGATTTGGGGG + Intronic
1175636975 20:60592916-60592938 AGATCTGCCCTCATTGTTGGTGG + Intergenic
1178258164 21:31074389-31074411 CGCTCTCCCCTGGAAGGTGGGGG - Intergenic
1179294258 21:40046753-40046775 ACTTCTGGCATGGAAGTTGGGGG + Intronic
1179770261 21:43610003-43610025 AGCTTTGCCTTGGAAGTTGAAGG + Intronic
1180177284 21:46097238-46097260 AGAGCTGTCCTGGAAGGTGGCGG - Intergenic
1181385486 22:22542339-22542361 AGATCTGCCCTCCATGTAGGTGG - Intergenic
1182494114 22:30694525-30694547 AGAGCTGCGCTGGGAGCTGGCGG + Intronic
1182718192 22:32376733-32376755 GGACCTGCCCTGGACGTGGGAGG - Intronic
1183016631 22:34993773-34993795 AGATCTGGCCTGGGAGATAGTGG - Intergenic
949179604 3:1112605-1112627 AGATCTGTCCTCAAAGTGGGTGG - Intronic
949486977 3:4549455-4549477 ACATCAGCCCTTGAATTTGGAGG + Intronic
949845040 3:8361359-8361381 GGACCAGCCCTGGAAGTGGGAGG + Intergenic
950265194 3:11568349-11568371 ACCTCTGCCCTGGCAGCTGGCGG - Intronic
950456395 3:13095274-13095296 AGAGATGCCCTGGGAGGTGGGGG - Intergenic
953738481 3:45516313-45516335 TGATCTGCCCTGGACTTTGAAGG + Intronic
953779857 3:45858358-45858380 AGATCTTCCCTTGACCTTGGAGG - Intronic
953795596 3:45983476-45983498 AAATCAGCCCAGGATGTTGGGGG + Intronic
956547102 3:70416991-70417013 ATGTCTGTCATGGAAGTTGGAGG - Intergenic
958089958 3:88864839-88864861 TGATCTTCCTTGGAAGTTTGGGG - Intergenic
961819185 3:129566566-129566588 GGAGCTGCCCTGGGAGTTGAGGG + Exonic
962394300 3:135001397-135001419 AGAACAGCCCTGGGAGATGGAGG - Intronic
963928756 3:150979496-150979518 ATATCTCCCCTGGGGGTTGGAGG - Intergenic
970286954 4:14528332-14528354 ACATCTGCCCTCGATATTGGTGG + Intergenic
970974745 4:22030521-22030543 AGATCTGCCTTGGCTGTTTGTGG + Intergenic
971267576 4:25108680-25108702 AGATGTGCCCAGGCAGGTGGAGG - Intergenic
971786207 4:31106159-31106181 AGAACTGGCCTGGAAGAGGGAGG - Intronic
972340457 4:38148470-38148492 ACTACTGCCCTGGATGTTGGAGG - Intergenic
973029649 4:45320698-45320720 ATAGCTGCACTGGAAGTTTGAGG - Intergenic
977609165 4:99014916-99014938 AACTCTGCCCTGGAAGATGGAGG + Intronic
977715973 4:100184491-100184513 AGATTGGCATTGGAAGTTGGGGG - Intergenic
979393810 4:120161284-120161306 ACAGCTGGCCTGCAAGTTGGTGG - Intergenic
982068443 4:151674358-151674380 GGAGCTGCCCTGTAAGTCGGAGG + Intronic
982392126 4:154876399-154876421 AGCTCTATCCTGGAAGCTGGGGG - Intergenic
984125238 4:175800425-175800447 AGATTTGGCCTAGAGGTTGGAGG - Intronic
984936900 4:184897671-184897693 TGTTCTGCCCTTGAAGTCGGCGG + Intergenic
985618405 5:938377-938399 AGGTCTGTCCTGGAGGTTGTGGG - Intergenic
987159000 5:15120604-15120626 ACATCTGCCCTGGCATTGGGAGG - Intergenic
992432730 5:76725186-76725208 AGATCTGTCCTGGAAGCAGAGGG - Intronic
993968384 5:94386969-94386991 AGGCCTGCACTGGCAGTTGGGGG - Intronic
994621822 5:102172736-102172758 AGATCTGCCATTGGGGTTGGAGG - Intergenic
995366200 5:111364140-111364162 AGATATGCTTTGGAAGTGGGAGG + Intronic
996273473 5:121636895-121636917 AGACCTGCCCTCGATGTTGGTGG - Intergenic
997768715 5:136532070-136532092 AGATCTGCCCTGAATGTGTGTGG + Intergenic
998593480 5:143502411-143502433 AGATCTGCCCTCAGTGTTGGTGG + Intergenic
999096737 5:148985390-148985412 AGATCTGTGCTGTGAGTTGGAGG - Intronic
999146311 5:149397955-149397977 AGATCTGCCCTCAATGTTGGTGG - Intronic
1000008180 5:157207254-157207276 AGATCTGCCCTCAGTGTTGGTGG - Intronic
1000858720 5:166431081-166431103 ATATGTGCCCTGGATGTTGCAGG + Intergenic
1002337348 5:178489146-178489168 AGATCTGCCCTCAATGTGGGTGG + Intronic
1002963734 6:1942067-1942089 AGATCCGACCAGGAAGTTGCAGG - Intronic
1003733718 6:8854312-8854334 AGAGGAGCCCTGGGAGTTGGAGG + Intergenic
1004484076 6:16049113-16049135 AGCAATGCCCAGGAAGTTGGGGG - Intergenic
1004682872 6:17913652-17913674 AGCTGAGCCCTGGAAGTTGCAGG + Intronic
1006895949 6:37471103-37471125 AGATCTTCCCTTGAAATAGGTGG - Intronic
1009809298 6:68639886-68639908 AGATCAGACCTGGAAATGGGTGG - Intronic
1010690572 6:78906914-78906936 AGATCTTCTCTGAAAGATGGTGG + Intronic
1010731905 6:79400033-79400055 AGGTCTTACCTAGAAGTTGGTGG - Intergenic
1016536289 6:145110315-145110337 AGCCCTGCCCTTCAAGTTGGAGG - Intergenic
1017489594 6:154933348-154933370 AGATATGCCATGAAAGTTTGAGG - Intronic
1019624572 7:2009457-2009479 AGACCTGGCCAGGAAGGTGGAGG - Intronic
1021452706 7:20797798-20797820 AGATCTGCACTCCAAGCTGGCGG - Intergenic
1024300329 7:47882660-47882682 TGATCTGCCCTAGTGGTTGGAGG + Intronic
1026343972 7:69457997-69458019 AGGGCTGGGCTGGAAGTTGGGGG + Intergenic
1027170323 7:75867013-75867035 AGATGTGCAGTGGAGGTTGGGGG + Intronic
1027242662 7:76342783-76342805 AGATCTGACTTGGAAGTGGCGGG + Intronic
1030680094 7:112425354-112425376 AGATCTGCCCTCAATGTGGGTGG + Intronic
1030923991 7:115428502-115428524 ATATCTGCCATGGAGGATGGTGG - Intergenic
1031397116 7:121286638-121286660 AGATGTGCTCAAGAAGTTGGTGG + Intronic
1031431240 7:121671964-121671986 AGATCTGCCCTCAAAGTTGATGG - Intergenic
1031564013 7:123272129-123272151 AGATCTGCCCTGGGAGTCCTAGG + Intergenic
1032808030 7:135378055-135378077 AGAATTGCCTTAGAAGTTGGGGG + Intronic
1033344207 7:140514675-140514697 AGAACAGCCCTGGTGGTTGGTGG + Intergenic
1033661514 7:143406220-143406242 CTACCTTCCCTGGAAGTTGGGGG - Intronic
1033823458 7:145161379-145161401 ACATCTGCCCTGAAAGGTGGTGG - Intergenic
1035569286 8:661311-661333 AGTTCTGCCCTGGAGCCTGGCGG + Intronic
1036557616 8:9873990-9874012 TGAGCTGCCCTGGAGGATGGTGG + Intergenic
1036868963 8:12422727-12422749 GGACCTGCCCATGAAGTTGGTGG + Intergenic
1041204728 8:55487342-55487364 AGACCTGCCCTGAATTTTGGTGG - Intronic
1047374395 8:124282268-124282290 AGTTCTGACCTGGAAGTTGAAGG - Intergenic
1050354276 9:4768697-4768719 AGACCTGCTCTGGAAGATGCTGG + Intergenic
1050829939 9:9998230-9998252 AGAACTGCCCTCGGAGGTGGAGG + Intronic
1051562205 9:18454370-18454392 AGATCTGCCCTCAATGTGGGTGG - Intergenic
1051796623 9:20879009-20879031 AGATCTGCCCTCAATGTTGATGG - Intronic
1053064085 9:35054826-35054848 AGATCTGCCTTCAATGTTGGTGG + Intergenic
1055217450 9:73883645-73883667 ATTTCTGGCCTGGAAGTCGGAGG - Intergenic
1056388525 9:86119162-86119184 AGATCTAACTTGGAATTTGGGGG + Intergenic
1058918500 9:109590689-109590711 AGATGTGCCCTGGAGGCTAGTGG - Intergenic
1059784735 9:117568968-117568990 AGATATGACATGGAAGTTGCTGG - Intergenic
1060330398 9:122663331-122663353 AGAACTGCCCCAGCAGTTGGAGG - Intergenic
1186858818 X:13651592-13651614 AGATGTCACCTGGAGGTTGGTGG - Intergenic
1190130967 X:47748684-47748706 AGATTTGCCATGGCAGTTAGTGG - Intergenic
1190774818 X:53544318-53544340 AAATCTGGCAGGGAAGTTGGGGG - Intronic