ID: 935219217

View in Genome Browser
Species Human (GRCh38)
Location 2:100997785-100997807
Sequence CCTCCCATGTAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935219211_935219217 10 Left 935219211 2:100997752-100997774 CCTGCTGCATTGCTATGGCTCTC 0: 1
1: 0
2: 2
3: 7
4: 117
Right 935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG 0: 1
1: 0
2: 2
3: 21
4: 277
935219208_935219217 16 Left 935219208 2:100997746-100997768 CCTTTCCCTGCTGCATTGCTATG 0: 1
1: 0
2: 2
3: 27
4: 244
Right 935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG 0: 1
1: 0
2: 2
3: 21
4: 277
935219210_935219217 11 Left 935219210 2:100997751-100997773 CCCTGCTGCATTGCTATGGCTCT 0: 1
1: 0
2: 1
3: 22
4: 344
Right 935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG 0: 1
1: 0
2: 2
3: 21
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935219217 Original CRISPR CCTCCCATGTAGAATGGGGA TGG Intergenic
900241294 1:1618736-1618758 CCTCTCATGAACAATGGGAATGG + Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902634845 1:17728551-17728573 CCTCCCTTGTAAAATGCAGAGGG - Intergenic
903029718 1:20454993-20455015 CCTCCCCTGTGGAATGGGAATGG + Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903859226 1:26355003-26355025 CCTCTTACGTAGAATGGGAAGGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906830624 1:49027675-49027697 TCTTCAATATAGAATGGGGATGG - Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
910712981 1:90200969-90200991 CCTCCCATGGAGATTTGGCAAGG - Intergenic
910724506 1:90324366-90324388 CCTCACATATAAAATGGTGATGG - Intergenic
911068820 1:93815601-93815623 CCTCCCCAGAAGAATGGGGAGGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
918487011 1:185040292-185040314 CCTCCCATGGAGATTTGGAATGG - Intergenic
1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG + Intergenic
1064155784 10:12902014-12902036 CGTGCCATGGAGACTGGGGAGGG - Intronic
1067509558 10:46883893-46883915 CCTCCCCTGTAGAATTGGACTGG - Intergenic
1067652696 10:48167966-48167988 CCTCCCCTGTAGAATTGGACTGG + Intronic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1070935523 10:80291620-80291642 CCTCCCATGCAGCATGGAGAAGG + Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072618965 10:97067478-97067500 TCTCCTTTGTATAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1074193100 10:111155029-111155051 CCTACCAGGATGAATGGGGAGGG + Intergenic
1076683890 10:132188041-132188063 CCTCCCATCTGGAGAGGGGAGGG - Intronic
1076865394 10:133164002-133164024 CCTCCCACGTGGGATGGGGGTGG + Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078911507 11:15736880-15736902 CCTCCCATGTTTACTGGAGAGGG + Intergenic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1083201724 11:61124865-61124887 CCTCCCAGGAAGAAAGGAGAGGG + Intronic
1084175050 11:67418638-67418660 GCTGCCATGCTGAATGGGGATGG + Intronic
1087005353 11:93465522-93465544 CCTCCCAATTAGGATTGGGATGG - Intergenic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1093945011 12:25098520-25098542 GCTCCCATCTACAGTGGGGAAGG - Intronic
1094054064 12:26250695-26250717 CCTCCAATGAAGAGTGGGGCTGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096914641 12:55017966-55017988 ACACCCCTGAAGAATGGGGAGGG - Intergenic
1098450421 12:70612599-70612621 CTTCCCATGTAGTCTGGGAAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098811834 12:75104293-75104315 CGTCCCAAGTAGAATGGAGCAGG + Intronic
1100803941 12:98261650-98261672 AATCCCCTGTAGAATGGGGAGGG + Intergenic
1101397586 12:104362221-104362243 CCCCCCATGCAGCATGGGGAGGG + Intergenic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101912261 12:108869058-108869080 CCTCCTAAGTAAAATGGGAAGGG - Intronic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1104683969 12:130772322-130772344 CCACTCATGGAGAAAGGGGAAGG + Intergenic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1110138784 13:72101716-72101738 CCTCCCATGTGGGTTGGGAATGG - Intergenic
1113886764 13:113665103-113665125 TCTCCCACGTGGAATGGGGTGGG + Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114634163 14:24178074-24178096 CCTCCTCTGTTGAGTGGGGAGGG - Exonic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118425042 14:65651140-65651162 CCTCCCAACTAGAGTGTGGAGGG + Intronic
1119748053 14:77058551-77058573 CCACCCAAATAGAGTGGGGATGG + Intergenic
1120827944 14:88971950-88971972 TCTCCCATGAAGGCTGGGGAAGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121784429 14:96645309-96645331 CCTTTCATGTTGAATAGGGATGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122061907 14:99141529-99141551 CATCCCATGTAGGATGGAGCTGG - Intergenic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122546877 14:102527950-102527972 CCTGCCCTGTGGGATGGGGAGGG + Intergenic
1123923354 15:25086323-25086345 CCTCCCAGGTAGCATTGGCATGG + Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1129411317 15:75352058-75352080 CATCCCATGGAGGGTGGGGATGG + Intronic
1129930475 15:79406438-79406460 CCTCCCAGTTAGAGTGGGGATGG - Intronic
1130661408 15:85833935-85833957 CCTCCCAGCTAGAAAGGAGAGGG + Intergenic
1131054939 15:89369471-89369493 CCTCTCATGTAAAAGGGTGAGGG - Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1132140405 15:99387934-99387956 CCGTCCACGTAGAATGGAGAAGG + Exonic
1133298932 16:4769840-4769862 ACTCCTTTGTACAATGGGGATGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1134248543 16:12558076-12558098 CATCCCATGCAAAGTGGGGACGG + Intronic
1134668772 16:16039080-16039102 TCTCCCATATAGAATGTCGATGG - Intronic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134837990 16:17377789-17377811 CATCTCATCTAGAAAGGGGAGGG + Intronic
1135327053 16:21533173-21533195 CCTCCCATGCTGAATCAGGATGG + Intergenic
1136337369 16:29619013-29619035 CCTCCCATGCTGAATCAGGATGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1140038516 16:71389854-71389876 CCCCCCATGTAAAGTGGGGACGG + Exonic
1140705849 16:77628448-77628470 CCTACCATGAAGAATGATGAAGG - Intergenic
1142040171 16:87888357-87888379 CCTCCCATGCTGAATCAGGATGG + Intronic
1144577242 17:16436818-16436840 CCTCCCAAGGAGGATGAGGATGG + Exonic
1145960738 17:28885239-28885261 CCTGCCATCTCTAATGGGGAAGG - Intronic
1147210799 17:38871353-38871375 CCTCCCCTCCAGACTGGGGAGGG - Intronic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1152361924 17:79836819-79836841 ACTCCCAGGTGGAATGGGGCAGG + Intronic
1152368052 17:79868825-79868847 CCTCCCATGTAAATCTGGGACGG + Intergenic
1153280613 18:3411105-3411127 CCTCCCAGGTAGCAGGGGAAAGG + Intergenic
1153280844 18:3412476-3412498 CCTCCCAGGTAGCAGGGGAAAGG - Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1157422873 18:47560726-47560748 CCTCCCATGTACTGTGGGTAAGG - Intergenic
1157513715 18:48296228-48296250 CTCCCCATGCAGGATGGGGAGGG + Intronic
1158945443 18:62443462-62443484 CCTCCTGTGTAGACTCGGGAGGG - Intergenic
1160238704 18:77106721-77106743 CATGCCATGAAGCATGGGGAAGG - Intronic
1160309646 18:77777614-77777636 CACCCCATGAAAAATGGGGAAGG + Intergenic
1160941519 19:1622312-1622334 CCTGCCACGTAGAAGGGGGCGGG + Exonic
1161056853 19:2195050-2195072 CCTCCCATGGACCCTGGGGATGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1164718859 19:30416605-30416627 CTTCCCAGGGAGGATGGGGAGGG - Intronic
1165229985 19:34380910-34380932 CCTCCTATGTGGAATAGGTAAGG + Intronic
1166051235 19:40261583-40261605 CGTCCCATGGTGAAAGGGGAAGG - Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1168246119 19:55113939-55113961 CCTCCTGGGTTGAATGGGGAGGG - Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168523253 19:57069183-57069205 CCTCCCATGGAGAAGGGGAGCGG - Intergenic
925315831 2:2922343-2922365 CATCCCATGGGGCATGGGGAGGG - Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
927625436 2:24712362-24712384 TCTCCCATATTGGATGGGGAAGG - Intronic
927860179 2:26555802-26555824 GCTCCCAAGGAGAATGGGAATGG + Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931460027 2:62442558-62442580 CCTCACTTGTAGGATGGAGAAGG + Intergenic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932498214 2:72158172-72158194 CAACTCATGGAGAATGGGGAGGG - Intergenic
935170938 2:100611145-100611167 CCCCTCATGGAAAATGGGGATGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
939955412 2:148523810-148523832 CCTCCTATGGAAAATGGGGTGGG - Intergenic
940280855 2:151988407-151988429 ACTCTCATGTAGGGTGGGGAAGG - Intronic
941076116 2:161008312-161008334 CCTCCCAGTTAGAATGAAGAGGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
948165603 2:235859418-235859440 GCTCCCATTTTGAAAGGGGATGG - Intronic
948300196 2:236900325-236900347 GCTCCCATGTAGGCTGGGCATGG + Intergenic
1171430858 20:25082364-25082386 CCTCCCTCCTAGAATGGGGGTGG - Exonic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173042165 20:39474865-39474887 CCCCTCATGTAGATTTGGGAAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1177695411 21:24565172-24565194 CCACCCATGTGAAATTGGGATGG + Intergenic
1178287705 21:31339026-31339048 CCACCCAGGAAGAATGGGAAAGG + Intronic
1178934594 21:36850631-36850653 CCTTCCTTGTGGAATGGCGAAGG + Intronic
1179144189 21:38752822-38752844 CCTCCTATCTAAAGTGGGGATGG + Intergenic
1180131210 21:45828430-45828452 CCACCCATGTATACTGGGGTGGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
950029625 3:9843744-9843766 CCTCCGCTGTAGAATGGGACCGG - Intronic
950128697 3:10527328-10527350 CCTACCCTGTAAAATGGGGGTGG - Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955148818 3:56346840-56346862 CCTCCAATGGAGAAAGGGCAAGG + Intronic
955728074 3:61953687-61953709 TCTCCAATGTAGAAGGGTGATGG + Intronic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956747529 3:72321416-72321438 CCTCCCATGGAGGCTGGGGTAGG + Intergenic
958053652 3:88382360-88382382 CCTCCCTAACAGAATGGGGAGGG + Intergenic
960673021 3:120170209-120170231 CTCCCCTTGTAGAATTGGGAAGG + Intronic
960965020 3:123098615-123098637 TCTTCCATGGAGAATGTGGAAGG - Intronic
961485144 3:127210910-127210932 CCCCCTCTGTGGAATGGGGAGGG - Intergenic
961662099 3:128474547-128474569 TGTCCCATGTGGAATGGGCATGG + Intergenic
962531614 3:136286488-136286510 CCTGCCATTTAAAATGGCGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
966212124 3:177464211-177464233 CTCCCCAGGTAGAATGGTGAGGG - Intergenic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
967443316 3:189534743-189534765 CATCCCAAGTAGATAGGGGATGG - Intergenic
968925745 4:3547134-3547156 CCTCCCGTGTGGGAAGGGGAAGG + Intergenic
969226045 4:5798956-5798978 TCTCCCTCGCAGAATGGGGAGGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969867733 4:10086500-10086522 ACTCCCATGTAGAATGGATTTGG + Intronic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
972254639 4:37340199-37340221 CTGCCCATGTAGAATTGGTAAGG - Intronic
972564585 4:40258672-40258694 CCCCCCAGGAAGAAAGGGGAGGG + Intergenic
975591231 4:76002012-76002034 TCTCCCATGAAGAAAGGGAACGG - Exonic
978182698 4:105819281-105819303 CTTACCAGATAGAATGGGGATGG - Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
982345176 4:154349553-154349575 CCTCCCATGAAGTAAGGAGAAGG - Intronic
982831118 4:160061844-160061866 CATACCAGTTAGAATGGGGATGG - Intergenic
984210339 4:176839716-176839738 CCACCCATGGAGGATGGAGATGG - Intergenic
985678704 5:1245113-1245135 CTGCCCATGTGGCATGGGGACGG + Intronic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
986982058 5:13459353-13459375 CCTCCCACAAAGAATGGAGATGG + Intergenic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991218979 5:64190290-64190312 TCTCCCTTTTAGAATGGGAATGG + Intronic
991408969 5:66328330-66328352 CCTCCCATGTGGAAGGCAGAAGG - Intergenic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
994239741 5:97406825-97406847 GTTCCCATGTGGAAAGGGGAGGG - Intergenic
995176478 5:109183628-109183650 TCTCCCATGTAGTATGGGGTCGG + Intronic
995280647 5:110331758-110331780 CCTCACATGTGGAAGGGGAAGGG - Intronic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
997467968 5:134100773-134100795 CCTCCCATCCAGGATGGGCAGGG + Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1002044331 5:176533513-176533535 CCTCCCATGAAGCCTGGGGCTGG - Intronic
1003574981 6:7284487-7284509 CATCCCATGAAGCATGGGGCGGG - Exonic
1003956863 6:11172323-11172345 CCTCCAATGTGGGATGGGGGTGG + Intergenic
1005021650 6:21424181-21424203 CATCCCATGGAAAATGGGCAAGG - Intergenic
1005100071 6:22162396-22162418 TCTCTCAAGTAGAAAGGGGAAGG + Intergenic
1006137782 6:31906419-31906441 CCTCCGAGGTAGGAGGGGGAGGG - Intronic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008867279 6:56228043-56228065 CCGCCCATGGAGAGTGGGAAAGG + Intronic
1010167297 6:72931749-72931771 CCTCGCATGCAGAGTTGGGAAGG - Intronic
1012990576 6:105921859-105921881 CATCCCAAGTGGGATGGGGAAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013815166 6:114089164-114089186 TCTACCATGTAGAGAGGGGAAGG + Intronic
1015187617 6:130436122-130436144 CCTCCCATTTGAGATGGGGAGGG - Intronic
1015208806 6:130672199-130672221 CCTCCCACGTTGAAGGTGGATGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015578761 6:134701431-134701453 ACTCCTGTGTAGAAAGGGGAGGG - Intergenic
1019310830 7:359817-359839 CCTCCCAGGTGGTCTGGGGAAGG + Intergenic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022304503 7:29133979-29134001 CCTCTCTTTTAGACTGGGGAGGG - Intronic
1022781522 7:33589294-33589316 CGTCCCATGCAGGATGGAGAAGG + Intronic
1023615736 7:42017505-42017527 CCTCCCAGGCTGAAAGGGGAGGG + Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031788449 7:126065974-126065996 CCTCCCATGACAGATGGGGATGG + Intergenic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1034975836 7:155448920-155448942 CGTCCCATGAAGCACGGGGAAGG - Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1037157343 8:15719755-15719777 CCTGGCATGTGAAATGGGGATGG - Intronic
1042662820 8:71174404-71174426 CTTCCCTTCTAGAATGCGGAGGG + Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1046805536 8:118475333-118475355 CCACTCATGGAGAATGGTGAAGG - Intronic
1047009178 8:120652642-120652664 CATCCCATGTAAAATTGAGATGG + Intronic
1047554248 8:125911640-125911662 CCTCCCAGGGAGACTGGGGGAGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1050388107 9:5111539-5111561 TCTGCCATGTAGAAGGGGGCGGG - Intronic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1054811900 9:69441709-69441731 CCTCCTTGGGAGAATGGGGAGGG + Intronic
1055139395 9:72858566-72858588 CCTCCCCTGTAAAATATGGAAGG + Intergenic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1056976211 9:91257110-91257132 CCTCCCATATAGCTTGGAGATGG - Intronic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1059505959 9:114800114-114800136 CATCCCAGGTGGAGTGGGGAGGG + Intronic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1062218594 9:135402481-135402503 CCTAGCATGTGGACTGGGGATGG + Intergenic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1187373000 X:18725920-18725942 CCTCCCTTGGAGAGTGGGGTGGG + Intronic
1187668290 X:21640577-21640599 CCTCCCTTAGAAAATGGGGAGGG - Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1194767367 X:97857183-97857205 CCACTCATGAAGAAAGGGGAAGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197246620 X:124173262-124173284 TCTCCCATGTTGAATAAGGATGG + Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198430751 X:136564456-136564478 CTTTGCATGTAGAAAGGGGAGGG - Intergenic
1201639821 Y:16166932-16166954 CTTCCCTTGTAGAATAGAGAAGG - Intergenic
1201662992 Y:16418393-16418415 CTTCCCTTGTAGAATAGAGAAGG + Intergenic