ID: 935219656

View in Genome Browser
Species Human (GRCh38)
Location 2:101001806-101001828
Sequence GCCCTGTGGCTCCACCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935219649_935219656 17 Left 935219649 2:101001766-101001788 CCAACACACTGGGCCACCCACGC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG 0: 1
1: 0
2: 2
3: 10
4: 144
935219652_935219656 4 Left 935219652 2:101001779-101001801 CCACCCACGCACAGGGACGACGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG 0: 1
1: 0
2: 2
3: 10
4: 144
935219653_935219656 1 Left 935219653 2:101001782-101001804 CCCACGCACAGGGACGACGCGAC 0: 1
1: 0
2: 0
3: 3
4: 12
Right 935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG 0: 1
1: 0
2: 2
3: 10
4: 144
935219654_935219656 0 Left 935219654 2:101001783-101001805 CCACGCACAGGGACGACGCGACA 0: 1
1: 0
2: 0
3: 3
4: 28
Right 935219656 2:101001806-101001828 GCCCTGTGGCTCCACCGCACAGG 0: 1
1: 0
2: 2
3: 10
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935219656 Original CRISPR GCCCTGTGGCTCCACCGCAC AGG Intronic