ID: 935220667

View in Genome Browser
Species Human (GRCh38)
Location 2:101009699-101009721
Sequence TAATCCCACAAGATGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935220666_935220667 23 Left 935220666 2:101009653-101009675 CCAGCACAGTAGACGAGCAGCAT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG 0: 1
1: 1
2: 1
3: 12
4: 157
935220665_935220667 24 Left 935220665 2:101009652-101009674 CCCAGCACAGTAGACGAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG 0: 1
1: 1
2: 1
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935220667 Original CRISPR TAATCCCACAAGATGTTTTG TGG Intronic
901805077 1:11733587-11733609 TAATCCTAGGAGTTGTTTTGCGG + Intergenic
902240771 1:15087887-15087909 TAATCTCACAGGATGGTGTGAGG - Intronic
904305655 1:29587275-29587297 AAAGCACACAAGGTGTTTTGAGG + Intergenic
906087158 1:43145708-43145730 AAATCCCAAAAGATATTTTTAGG + Intronic
909146266 1:71937003-71937025 CAATCCCCCAAGGTGTTCTGTGG - Intronic
910957503 1:92722864-92722886 TAAACCCACAAAAAGTTATGTGG + Intronic
912089620 1:106055119-106055141 TTCTTACACAAGATGTTTTGTGG - Intergenic
913701241 1:121376360-121376382 AAATCCCATATGATGTTGTGAGG - Intronic
914041798 1:144056827-144056849 AAATCCCATATGATGTTGTGAGG - Intergenic
914136292 1:144903659-144903681 AAATCCCATATGATGTTGTGAGG + Intronic
914505329 1:148283925-148283947 TCTTCCCACAAGAGATTTTGAGG + Intergenic
914507233 1:148300222-148300244 TCTTCCCACAAGAGATTTTGAGG - Intergenic
915433182 1:155882671-155882693 TGATCCCAAAAGCTGTTTTCAGG + Exonic
915740626 1:158115986-158116008 TAAACCCACAAGTTCTTTGGAGG - Intergenic
916969539 1:169996931-169996953 TTATCCCCCAAGCAGTTTTGAGG + Intronic
917485222 1:175449394-175449416 TAGTCCCACAGGATGTCTTAAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920488667 1:206395082-206395104 AAATCCCATATGATGTTGTGAGG - Intronic
922272482 1:224046467-224046489 AAATCCCACAAGATTCTCTGCGG + Intergenic
923005495 1:230046066-230046088 TAGTTCCACAGGATGTTTTCTGG + Intergenic
923258848 1:232246971-232246993 TAATCCCAAAGGATGATTTTTGG - Intergenic
923775326 1:236973091-236973113 AAATTCTACAAGTTGTTTTGTGG + Intergenic
1064168380 10:13006117-13006139 TAATCCAATGTGATGTTTTGTGG + Intronic
1068153412 10:53164009-53164031 TAGTCCCAAAAGATGTTTAGTGG - Intergenic
1069238359 10:66106566-66106588 TAATCCCAAAAGTTGTTGTGAGG + Intronic
1071143483 10:82540405-82540427 TCAGGCCAAAAGATGTTTTGGGG + Intronic
1077012892 11:386816-386838 ATATCCCACAACATGTTTGGGGG + Intergenic
1079927238 11:26509766-26509788 TAATTCCAGGAGATGTTCTGTGG - Intronic
1082651433 11:55798915-55798937 TAATCCAACAAGCTTTTTTATGG + Intergenic
1083567803 11:63734914-63734936 TAATCCTAATAGTTGTTTTGTGG - Intronic
1084999870 11:73022518-73022540 AAATCCCACAAAATGTTTGCAGG + Intronic
1085852730 11:80140440-80140462 GATTCCCAAAAGATGTTTTGTGG - Intergenic
1086296590 11:85374309-85374331 CAGTCACACAAGAGGTTTTGGGG + Intronic
1086493731 11:87381301-87381323 TAATTGCACAGGATATTTTGAGG + Intergenic
1087594223 11:100233686-100233708 AAGTCCCACAAGATGTTCTGAGG - Intronic
1088426278 11:109707658-109707680 TACTGCCACCAGTTGTTTTGTGG + Intergenic
1088929045 11:114330801-114330823 TGATCACCCAGGATGTTTTGTGG + Intergenic
1090907608 11:131090889-131090911 TAGTCCCACAAGAAGCTCTGTGG + Intergenic
1093767105 12:22977543-22977565 TAATCCCAAACTATGTTTTAAGG + Intergenic
1094291196 12:28851983-28852005 TAACCACACAAGATGCTTTTAGG - Intergenic
1097621820 12:61947867-61947889 TTATTCTACAAGTTGTTTTGAGG - Intronic
1099391087 12:82078976-82078998 TAATCCTAAAAGTTGTTATGGGG - Intergenic
1101067513 12:101038256-101038278 TGAAGCCACATGATGTTTTGGGG - Intronic
1107325206 13:39234567-39234589 TTATTCCACAATATGTATTGAGG - Intergenic
1108327190 13:49345581-49345603 TAGTTCCACAAGATCCTTTGAGG + Intronic
1108762614 13:53587952-53587974 TAAAGCCAGAAGATGCTTTGCGG - Intergenic
1110966876 13:81711000-81711022 TGATCTTAGAAGATGTTTTGTGG + Intergenic
1111387240 13:87542454-87542476 TAAACCAACAAGTTGTTTTTTGG + Intergenic
1113476406 13:110585037-110585059 AAATCTCAACAGATGTTTTGTGG - Intergenic
1113798606 13:113074834-113074856 TAATCCCCGAAGCTGTTCTGTGG - Intronic
1118653424 14:67922374-67922396 TAATCTAACAAGATGTTAAGGGG - Intronic
1119179289 14:72594066-72594088 TAAGCCCACACTATCTTTTGGGG - Intergenic
1120213195 14:81654735-81654757 GAACCCTACAAGATGTTTTCTGG + Intergenic
1125827815 15:42691073-42691095 AAATACCACTAGATGTTTTTTGG + Exonic
1126430824 15:48582465-48582487 TAATACCACATGTGGTTTTGTGG - Intronic
1128357520 15:66938465-66938487 TAATCCCAGAAGGGGTTTTGTGG + Intergenic
1129302237 15:74632057-74632079 TAGCCCCACAAGTTGATTTGGGG - Exonic
1131696419 15:94882107-94882129 TAATGACACAGGATGTTTTCGGG + Intergenic
1133783124 16:8954472-8954494 AAATCTCACAAGCTGTATTGTGG - Intronic
1133857094 16:9559711-9559733 CAATGCCACAGGAAGTTTTGGGG + Intergenic
1137538703 16:49347344-49347366 AAATCCCACAAGGTATTTTTTGG + Intergenic
1137863753 16:51872202-51872224 TAAGCTTACAACATGTTTTGGGG + Intergenic
1138365122 16:56469344-56469366 ACAACTCACAAGATGTTTTGAGG - Intronic
1139134710 16:64188035-64188057 TAATCCTACATGAAGTTTTTTGG - Intergenic
1143271738 17:5680841-5680863 GATTCCCACAAGATGCTTTGGGG - Intergenic
1143900279 17:10169348-10169370 TTAACCCACAAGAAGTTTTAGGG - Intronic
1144355792 17:14444954-14444976 TTATGCCACTGGATGTTTTGTGG - Intergenic
1149957469 17:61068693-61068715 GAATCCCAGAAGAAGTTTTAGGG - Intronic
1150861786 17:68807789-68807811 TAATTACACAAGTTGTTTTAAGG - Intergenic
1151282075 17:73084014-73084036 TAACCTCCCAAGAAGTTTTGGGG + Intronic
1157439457 18:47699172-47699194 TAATCTCACATGTGGTTTTGAGG + Intergenic
1157771479 18:50351194-50351216 TAATCTTACAATATGTTTTCAGG - Intergenic
1158989689 18:62855901-62855923 TCTTCCAGCAAGATGTTTTGAGG + Intronic
1159446808 18:68551031-68551053 TTATCTCACAAAATTTTTTGAGG + Intergenic
1159967003 18:74604777-74604799 TAATCCCCCCAAATCTTTTGAGG + Intronic
1165665990 19:37628950-37628972 AAATCCAACAAGATGTTCAGGGG + Intronic
931364875 2:61610435-61610457 TACTCCCAAAAGATGTTTTGTGG - Intergenic
933999150 2:87692217-87692239 TAATCCCATACCATGTTTTTGGG - Intergenic
935220667 2:101009699-101009721 TAATCCCACAAGATGTTTTGTGG + Intronic
936039976 2:109142380-109142402 TAACCCCACAGGGTGCTTTGGGG - Intronic
936294695 2:111258674-111258696 TAATCCCATACCATGTTTTTGGG + Intergenic
936945089 2:117922926-117922948 TTCTCCCACAAGCTCTTTTGAGG - Intronic
937020532 2:118647296-118647318 TAATCTCACTAGATGTTAAGAGG - Intergenic
937774978 2:125765501-125765523 TAATCCCGGAAGAAGTTCTGAGG - Intergenic
939241442 2:139566008-139566030 TATTCCAACAAGTTGTTTTAAGG - Intergenic
944599183 2:201285800-201285822 TAATGCACCAAGAGGTTTTGAGG - Intronic
945559873 2:211326632-211326654 TAAACCCACAACATGTTTTCTGG + Intergenic
945689866 2:213020128-213020150 CAATGCCATAAGGTGTTTTGGGG + Intronic
946275234 2:218626742-218626764 TGTTCCCATATGATGTTTTGAGG - Intronic
947447426 2:230174728-230174750 TACTCCCAAAATGTGTTTTGTGG - Intronic
1170149834 20:13218311-13218333 TAATCACTCAGGATGTTTTATGG + Intergenic
1170164838 20:13350304-13350326 TTTTCCCACAAGATGATTTAAGG + Intergenic
1172388663 20:34551290-34551312 TAATTCAACATGAAGTTTTGAGG - Intronic
1174803522 20:53585688-53585710 TAATCCTACAAGGTCTTGTGTGG - Intronic
1175425427 20:58862123-58862145 AAAACCCAAAACATGTTTTGGGG - Intronic
1177492145 21:21840675-21840697 TAGTCTTAGAAGATGTTTTGAGG - Intergenic
1177816068 21:25978400-25978422 TAATCTCACAAGCTGTTGTGAGG - Intronic
1179722582 21:43324029-43324051 GGCTCCCACAAGAGGTTTTGGGG - Intergenic
1180560502 22:16611125-16611147 TAATCCTACAAGGTCTTGTGTGG + Intergenic
1182581617 22:31316234-31316256 AAATCCCAGAAGTTATTTTGTGG + Intergenic
1183534511 22:38390063-38390085 TAATCCTACAAGGTCTTGTGTGG - Intronic
949107914 3:222955-222977 GAATCTGAAAAGATGTTTTGAGG - Intronic
952641859 3:35606037-35606059 TAATCTCCCAACATGTTTTGAGG + Intergenic
956481777 3:69680296-69680318 TACTTCCACAAGATCTTTTGTGG + Intergenic
956541243 3:70342027-70342049 TAATCCAACAAGAGGATTTGAGG - Intergenic
957238976 3:77633362-77633384 TAATCCCACATTCTTTTTTGTGG - Intronic
958986038 3:100780717-100780739 AAATCCCAAAAGATCATTTGTGG - Intronic
959040583 3:101418728-101418750 TCTTCCCACTAGATGGTTTGGGG - Intronic
959373648 3:105560931-105560953 TAATTCCACAAAACTTTTTGTGG - Intronic
959496008 3:107052640-107052662 TACTCTCCCAATATGTTTTGGGG - Intergenic
963548131 3:146686561-146686583 TAAACCCATCAGATCTTTTGAGG + Intergenic
964524609 3:157605260-157605282 TAAACCAACAAGAGATTTTGGGG + Intronic
970701621 4:18747653-18747675 AAATCCCAAAAGTTATTTTGTGG - Intergenic
973676171 4:53265265-53265287 TTATCCCACAAAATCTTTTCTGG + Intronic
974764853 4:66330580-66330602 TAAGACAACAAGGTGTTTTGAGG + Intergenic
976097264 4:81522286-81522308 TCTTCCCAGAAGATTTTTTGAGG - Intronic
977000624 4:91495686-91495708 AAATCAGACAATATGTTTTGGGG - Intronic
977180303 4:93865895-93865917 GAATCCCCAAATATGTTTTGGGG + Intergenic
978291797 4:107150619-107150641 TAAAGACACAAAATGTTTTGGGG - Intronic
979749364 4:124258502-124258524 TCATTCCACAAAATGTTTTTTGG + Intergenic
983743233 4:171161906-171161928 TAATCAGAAGAGATGTTTTGGGG - Intergenic
987861783 5:23498420-23498442 CAATCTGACAAAATGTTTTGGGG + Intergenic
988096344 5:26615815-26615837 TAATTCTATAAGATGTATTGTGG + Intergenic
988680778 5:33481558-33481580 AAATCCCAAAAGAAGTTTTAAGG - Intergenic
988710727 5:33771907-33771929 TAATCCCAGAGGATTGTTTGAGG - Intronic
992101190 5:73409551-73409573 TAATCCCCCAAGTTGAATTGAGG - Intergenic
992752434 5:79873729-79873751 AGATTCCCCAAGATGTTTTGTGG - Intergenic
995661385 5:114487287-114487309 TATTCCCAGAAGATGTTATCTGG + Intronic
995957535 5:117796177-117796199 TAAGCCTAAAAGATGTTTTTAGG + Intergenic
996437539 5:123452222-123452244 TAATCCCAGACAGTGTTTTGGGG + Intergenic
996879281 5:128276527-128276549 TGATCCCACAAGATGCTTAAAGG - Intronic
998548965 5:143058052-143058074 TAATCCCACAAAATTCTGTGTGG - Intronic
999736923 5:154519735-154519757 AAATCAGAGAAGATGTTTTGGGG + Intergenic
1004512748 6:16296007-16296029 AAATTCCACAGGATGTTTTATGG + Intergenic
1005659953 6:27987285-27987307 TACTCCCAAAAGATGCTATGTGG - Intergenic
1006663944 6:35675610-35675632 TCTTCCCTCAAGGTGTTTTGTGG - Intronic
1008411251 6:51182669-51182691 TGACCCCACAAGAAGTTGTGAGG - Intergenic
1014494274 6:122101244-122101266 TAATTCTAAAAGGTGTTTTGTGG - Intergenic
1015058776 6:128936692-128936714 TAATACAATAAGATATTTTGAGG - Intronic
1019898560 7:4001509-4001531 TGATCCCACAACAGGCTTTGAGG - Intronic
1020556433 7:9675908-9675930 TGATTACACAATATGTTTTGAGG + Intergenic
1022195307 7:28060565-28060587 TAAATCCACAAGCTGTTCTGTGG + Intronic
1023904142 7:44509624-44509646 TAACCCCAGAAAATTTTTTGTGG - Intergenic
1025063629 7:55833473-55833495 TAATCCCAGCAGATCTCTTGAGG + Intronic
1027482973 7:78722424-78722446 TAATCGCACAAGTAATTTTGAGG + Intronic
1027951635 7:84823887-84823909 TAATCATACAACTTGTTTTGTGG - Intergenic
1027956325 7:84883135-84883157 CAATCTCACAAGCTGTTCTGGGG - Intergenic
1027997677 7:85446593-85446615 TAGTGCCACTAGATGTTTTTTGG + Intergenic
1030911431 7:115255057-115255079 CAATCCCAAAACATGTTTGGAGG + Intergenic
1031755825 7:125640927-125640949 TAATCACACAATATGTTCTAAGG - Intergenic
1038094816 8:24296355-24296377 TAAAACCACAAGATGGTTTGAGG + Intronic
1039348792 8:36738196-36738218 AAATCCCAGAAGCTATTTTGTGG + Intergenic
1042430754 8:68703703-68703725 CAACCCCACAAGAATTTTTGAGG - Intronic
1043723797 8:83582811-83582833 TAATCCCATTACATATTTTGTGG + Intergenic
1043784254 8:84377308-84377330 TTAGCCCACATGATATTTTGAGG - Intronic
1046548420 8:115681206-115681228 TTAGCCCATAAGATCTTTTGAGG - Intronic
1048363040 8:133714679-133714701 TACTCTCAGAACATGTTTTGTGG + Intergenic
1048674178 8:136758988-136759010 TATTCCCACAAGATAGTTGGAGG + Intergenic
1049958841 9:718907-718929 TAAGCCCAAATGATGGTTTGGGG - Intronic
1050269962 9:3932729-3932751 AAATGCCCCAAGAGGTTTTGTGG - Intronic
1051317242 9:15853248-15853270 TTCTCTCAAAAGATGTTTTGTGG + Intronic
1051799135 9:20911643-20911665 TAATACCACAAGATATTTGTTGG + Intronic
1055376556 9:75654844-75654866 TAAACCCACAAGATGTTTTGTGG - Intergenic
1061658278 9:132109675-132109697 TATTTCCCCAAAATGTTTTGAGG - Intergenic
1062278172 9:135740370-135740392 AAGTCCCATAAGATGCTTTGGGG - Intronic
1187129203 X:16484963-16484985 TAATGCCAAAAAATGTTTTCAGG - Intergenic
1187329360 X:18322557-18322579 TATTCCAAGAAGATGGTTTGGGG - Intronic
1187658912 X:21515772-21515794 TAATTACACAATATGTTTTTAGG + Intronic
1187914671 X:24142302-24142324 TAATTCCACAAAATGTATAGTGG + Intergenic
1190761982 X:53444486-53444508 AAATCCCAAAACATTTTTTGGGG - Intergenic
1198573396 X:137983257-137983279 TAATCCAACCAAATGTCTTGGGG - Intergenic
1199974984 X:152889148-152889170 TAATCACAAAAGAAGATTTGCGG - Intergenic