ID: 935221620

View in Genome Browser
Species Human (GRCh38)
Location 2:101019981-101020003
Sequence AGAATGGTGTGGAACCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1575
Summary {0: 2, 1: 11, 2: 66, 3: 408, 4: 1088}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935221612_935221620 4 Left 935221612 2:101019954-101019976 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG 0: 2
1: 11
2: 66
3: 408
4: 1088
935221614_935221620 3 Left 935221614 2:101019955-101019977 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG 0: 2
1: 11
2: 66
3: 408
4: 1088
935221610_935221620 12 Left 935221610 2:101019946-101019968 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG 0: 2
1: 11
2: 66
3: 408
4: 1088

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935221620 Original CRISPR AGAATGGTGTGGAACCCGGG AGG Intronic
900168912 1:1256795-1256817 AGAATGGCGTGAACCCCGGGGGG + Intronic
900249589 1:1660702-1660724 ATAATGGCGTTGAACCCGGGAGG - Intronic
900260524 1:1726013-1726035 ATAATGGCGTTGAACCCGGGAGG - Intronic
900272528 1:1799007-1799029 AGAATGGCGTGAACCCCGGGGGG - Intronic
900384934 1:2406180-2406202 AGTGTGGTGAGGACCCCGGGAGG + Intronic
901385590 1:8906681-8906703 AGAAAGGCGTGAACCCCGGGAGG - Intergenic
901732378 1:11289650-11289672 AGAATGGCTTTGAATCCGGGAGG - Intronic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
902035082 1:13452182-13452204 AGAATGGTGTGAACCTTGGGAGG - Intergenic
902225760 1:14995532-14995554 AGAATCGTTTGAAACCCTGGAGG + Intronic
902347931 1:15832676-15832698 AGAATGGCATGAACCCCGGGAGG - Intergenic
902454972 1:16526837-16526859 AGAATGGTGTGAACCCAGGAGGG - Intergenic
902576183 1:17379200-17379222 AGAATGGCGTGAACCCCAGGGGG - Intronic
902815459 1:18913918-18913940 AGAATGGCGTGAACCCCAGGGGG - Intronic
903123057 1:21228928-21228950 AGAATGGCGTGAACCCCGGGGGG - Intronic
903134613 1:21301403-21301425 AGAATGGCGTGAACCCCAGGGGG + Intronic
903239925 1:21975958-21975980 AGAATGGCGTGAACCCCAGGGGG - Intergenic
903422968 1:23231823-23231845 AGAATGGCGTGAACCCCAGGGGG + Intergenic
903714176 1:25351073-25351095 AGAATGGCGTAAAACCTGGGAGG + Intronic
903834645 1:26195588-26195610 AGAATGGTGTGAACCCGGGGAGG - Intronic
903901452 1:26648952-26648974 AGAATGGCGTGAACCCCGGGGGG + Intergenic
903940326 1:26925449-26925471 AGAATGGCGTGAACCCCGGGGGG + Intronic
904125452 1:28235426-28235448 AGAATTGGCTTGAACCCGGGAGG - Intergenic
904394496 1:30209678-30209700 AGAATCATTTTGAACCCGGGAGG - Intergenic
904641148 1:31930247-31930269 AGAATGGCGTGAACCCCGGGGGG + Intronic
904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG + Intergenic
904740294 1:32669799-32669821 AGAATGGCATGAAACCCGGGAGG + Intronic
904742306 1:32687580-32687602 AGAATTGACTTGAACCCGGGAGG + Intronic
904746371 1:32713734-32713756 AGAACGGCGTAAAACCCGGGAGG - Intergenic
904925292 1:34042875-34042897 AGAATGGTGTGAAACCCCGGAGG - Intronic
904967473 1:34387773-34387795 AGTATGGTGTTGAATCAGGGTGG - Intergenic
905050806 1:35049421-35049443 AGAATAGCGTGAAACCCGGGAGG - Intergenic
905089023 1:35411970-35411992 AGAATGGCGTTGAACCCAGGAGG - Intronic
905129394 1:35741882-35741904 AGAATCGCTTTGAACCCGGGAGG + Intronic
905147985 1:35903093-35903115 AGAATGGCGTGAAACCCGGGAGG - Intronic
905379200 1:37548061-37548083 AGAATGGCGTGAACCCCGGGAGG + Intronic
905456874 1:38094444-38094466 AGAATGGTTTGGAACCTGTGTGG + Intergenic
905561585 1:38931430-38931452 AGAATGGTGTGAACCCAGGAAGG + Intronic
905583825 1:39102085-39102107 AGAATGGCGTGAACCCCGGGGGG + Intronic
905818368 1:40969805-40969827 AGAATGGCGTGAACCCCAGGAGG - Intergenic
906042481 1:42798830-42798852 AGAATGGCGTGAATCCCGGGGGG - Intergenic
906050160 1:42864238-42864260 AGAATGGTGTGAACCCCGGGGGG + Intergenic
906468005 1:46102072-46102094 AGAATGGCGTGAACCCCAGGGGG - Intronic
906478722 1:46186749-46186771 AGAATGGCGTGAACCCCAGGGGG - Intergenic
906500313 1:46337169-46337191 AGAATGGCGTGAACCCCCGGGGG + Intergenic
906541342 1:46588716-46588738 AGAATGGCGTAAACCCCGGGGGG + Intronic
906736318 1:48132647-48132669 AGAATGGCGTGAACCCCGTGGGG - Intergenic
906874849 1:49526001-49526023 AGAATGGCGTGAACCCTGGGAGG + Intronic
907006756 1:50922075-50922097 AGAATTGCTTAGAACCCGGGAGG + Intronic
907137698 1:52155321-52155343 AGAATGGCATGAACCCCGGGGGG - Intronic
907173701 1:52498330-52498352 AGAATGGCGTGAACCCCGGGGGG - Intronic
907495856 1:54843940-54843962 AGAATCGCTTAGAACCCGGGAGG + Intergenic
907781302 1:57569167-57569189 AGAATGGCGTGAACCCCAGGGGG + Intronic
908523167 1:64964867-64964889 AGAAATGTCTGGAACCCTGGTGG + Intronic
908748813 1:67400414-67400436 AGAATCGCTTTGAACCCGGGAGG + Intergenic
909011419 1:70339405-70339427 AGAATTGCTTGAAACCCGGGAGG - Intronic
909235570 1:73148683-73148705 AGAATGGGCGTGAACCCGGGAGG + Intergenic
909322678 1:74309277-74309299 AGAATGGCGTGAACCCCAGGGGG + Intronic
909608446 1:77530167-77530189 AGAATTGTGGGGAGCCCTGGAGG + Intronic
910244078 1:85120292-85120314 GGAAGGGAGTGGAACCCTGGAGG + Intronic
910453549 1:87371965-87371987 AGAATGGCGTGAACCCCGGGGGG - Intergenic
910822317 1:91364720-91364742 AGAATGGCGTGAACCCCGGGGGG - Intronic
910973270 1:92878729-92878751 AGAATAGCGTGAACCCCGGGGGG + Intronic
911183109 1:94878143-94878165 AGAATGGCGTGAACCCCAGGGGG + Intronic
911698483 1:100923103-100923125 AGAATGGCGTGAACCCCAGGGGG - Intronic
911807394 1:102228834-102228856 AGAATGGCGTGAACCCCGGGGGG + Intergenic
911825517 1:102480159-102480181 AGAATGGCGTGAACCCCAGGGGG + Intergenic
912026514 1:105181629-105181651 AGAATGGCCTTGAACCCGGGAGG - Intergenic
912280391 1:108306843-108306865 AGAATGGTGTGAACCCGGGAGGG + Intergenic
912287835 1:108387514-108387536 AGAATGGTGTGAACCCGGGAGGG - Intronic
912356073 1:109055206-109055228 AGAATGGCGTGAACCCCAGGGGG - Intergenic
912366901 1:109141348-109141370 AGAATGGTGTGAACCTCGAGAGG - Intronic
912399298 1:109375452-109375474 AGAATGGCGTGAACCCCAGGGGG + Intronic
912619091 1:111137162-111137184 AGAATGGTGTGAACCCCGGGGGG + Intronic
912910299 1:113752487-113752509 AGAATGGCGTGAACCCGGGGAGG - Intronic
913002074 1:114590687-114590709 AGAATGGTGTGAACCCCGGAGGG + Intronic
913178425 1:116296481-116296503 AGAATGGCTTAGAACCTGGGAGG + Intergenic
913598612 1:120402245-120402267 AGAATGGCGTGAACCCCAGGGGG + Intergenic
913667070 1:121058208-121058230 AGAATGGCGTGAACCCCAGGGGG + Intergenic
913965564 1:143374489-143374511 AGAATAGTGTGACCCCCGGGAGG - Intergenic
913999996 1:143685811-143685833 AGAATGGCGTGAACCCCGGGGGG - Intergenic
914059938 1:144200091-144200113 AGAATAGTGTGACCCCCGGGAGG - Intergenic
914119212 1:144766278-144766300 AGAATAGTGTGACCCCCGGGAGG + Intergenic
914249194 1:145907857-145907879 AGAATGGCGTGAACCCAGGGGGG - Intronic
914264972 1:146030855-146030877 AGAATCGCTTTGAACCCGGGAGG - Intergenic
914288693 1:146252276-146252298 AGAATGGCGTGAACCCCAGGGGG + Intergenic
914549728 1:148703020-148703042 AGAATGGCGTGAACCCCAGGGGG + Intergenic
914696982 1:150092929-150092951 AGAATGGCGTAAAACCCGGGAGG - Intronic
914734303 1:150401085-150401107 AGAATGGTGTGAACCCGGGAAGG + Intronic
914745001 1:150495088-150495110 AGAATGGCGTGAACCCTGGGGGG + Intronic
914762784 1:150612504-150612526 AGAATGGCATGAACCCCGGGAGG - Intronic
914854313 1:151339486-151339508 AGAATGGCGTAAAACCCAGGAGG + Intergenic
914862081 1:151395086-151395108 AGAATGGCGTGAACCCCGGGAGG + Intergenic
915158337 1:153897116-153897138 AGAATGGCGTGAACCCCAGGGGG - Intronic
915177084 1:154025015-154025037 AGAATGCCGTGAACCCCGGGGGG - Intronic
915359114 1:155274908-155274930 AGAATGGCGTGAACCCCAGGGGG + Intronic
915436130 1:155907999-155908021 AGAATGGCATGAACCCCGGGGGG + Intronic
915620873 1:157083346-157083368 AGAATGGCTTGCAACCTGGGAGG - Intergenic
915688969 1:157667663-157667685 AGAATGGCGTGAACCCCAGGGGG + Intergenic
915923529 1:159997365-159997387 AGAATGGCGTGAACCCCGGGGGG - Intergenic
916067517 1:161148359-161148381 AGAATGACGTGAACCCCGGGGGG - Intergenic
916071768 1:161174316-161174338 AGAATGGCGTAAAACCCGGGAGG + Intronic
916122206 1:161538423-161538445 AGAATGGCGTGAATCCCGGGGGG + Intergenic
916325132 1:163548432-163548454 AGAATGGCGTGAACCCCAGGGGG - Intergenic
916538975 1:165733510-165733532 AGAATCATTTGAAACCCGGGAGG + Intronic
916700244 1:167285501-167285523 AGAATGGCGTGAACCCCGGGAGG + Intronic
916767505 1:167875862-167875884 AGAATGGTGTGAACCCGGGAGGG + Intronic
917026566 1:170649972-170649994 AGAATGGCGTGAACCCCGGGGGG - Intergenic
917343374 1:174003748-174003770 AGAATGGCGTGAAACCCGCGAGG - Intronic
917888621 1:179414512-179414534 AGAATGGCGTGAACCCCAGGGGG - Intronic
917949425 1:180015321-180015343 AGAATGGCATGAACCCCGGGGGG - Intronic
918134078 1:181654893-181654915 AGAATGGCGTGAACCCCAGGGGG + Intronic
918442918 1:184586370-184586392 AGAATGGCGTGAACCCCAGGGGG - Intronic
918602612 1:186381414-186381436 AGAATGGCGTGAACCCCAGGGGG - Intronic
918682355 1:187371109-187371131 AGAATGGCGTGAACCCTGGGGGG + Intergenic
918753869 1:188310168-188310190 AGAATGGCGTGAACCCCAGGGGG + Intergenic
918963899 1:191315844-191315866 AGAATGGCATGAACCCCGGGAGG - Intergenic
918998462 1:191794425-191794447 AGAATGGCGTGAACCCCGGGGGG + Intergenic
919126156 1:193395993-193396015 AGAATGGCGTGAACCCCAGGGGG + Intergenic
919202975 1:194382214-194382236 AGAATGGCGTGAACCCCGGGGGG - Intergenic
919332440 1:196189019-196189041 AGAATGGCGTGAACCCCAGGGGG - Intergenic
919339334 1:196283343-196283365 AGAATGGCGTGAACCCCGGGGGG + Intronic
920118387 1:203637340-203637362 AGAATGGCGTGAACCCCCGGGGG + Intronic
920237791 1:204520186-204520208 AGAATGGCATGAACCCCGGGGGG + Intronic
920547140 1:206827599-206827621 AGAATGGCATGAACCCCGGGGGG + Intronic
920761946 1:208792496-208792518 AGAATGGGTGTGAACCCGGGAGG + Intergenic
920857518 1:209675265-209675287 AGGAGGGGGTGGAACCCGGCTGG - Intergenic
921201337 1:212809593-212809615 AGAATGGCGTGAACCCGGGGGGG + Intronic
921227910 1:213038689-213038711 AGAATGGCGTGAACCCCAGGGGG - Intergenic
921295985 1:213704296-213704318 AGAATGGCGTGAACCCCAGGGGG + Intergenic
921974688 1:221189590-221189612 AGAATGGCGTGAACCCCGGGAGG + Intergenic
922063483 1:222113912-222113934 AGAATGACGTGGAACCTGGGAGG - Intergenic
922108819 1:222537540-222537562 AGAATGGCGTGAACCCCGGGAGG + Intronic
922253475 1:223871338-223871360 AGAAAAGTGTAGTACCCGGGCGG + Intergenic
922285498 1:224167453-224167475 AGAATGGCGTGAACCCCGAGGGG - Intergenic
922296459 1:224254179-224254201 AGAATGAACTTGAACCCGGGAGG - Intronic
922420315 1:225455940-225455962 AGAATGGCGTGAACCCCGGGGGG + Intergenic
922559659 1:226559882-226559904 AGAATGGCGTGAACCCGGGGGGG + Intronic
922625423 1:227036516-227036538 AGAATGGCGTGAACCCCGGGGGG - Intronic
923084772 1:230694931-230694953 AGAATGAACTGGAACCCGTGGGG + Intergenic
923367370 1:233275939-233275961 AGAATCGCTTGGAACCAGGGAGG + Intronic
923444971 1:234062458-234062480 AGATTCATGTGGAACCCCGGAGG + Intronic
923484838 1:234419081-234419103 AGAATGGCGTGAACCCTGGGGGG + Intronic
923760758 1:236841978-236842000 AGAATGGCGTGAACCCCGGGGGG - Intronic
924137591 1:240986669-240986691 AGAATGGCGTGAACCCCAGGGGG - Intronic
924263249 1:242253400-242253422 AGAATGGCGTGAACCCCAGGGGG - Intronic
924327702 1:242912202-242912224 AGAATGGGCATGAACCCGGGAGG - Intergenic
924400333 1:243673701-243673723 AGAATTGCTTGAAACCCGGGAGG - Intronic
924480826 1:244432751-244432773 AGAATGGCAGTGAACCCGGGAGG - Intronic
924522763 1:244819735-244819757 AGAATGGTGTGAACCCCGGGAGG - Intergenic
924616590 1:245617183-245617205 AGAATCGCGGGGAACCCAGGAGG - Intronic
1063468225 10:6262363-6262385 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1063830505 10:9947208-9947230 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1063989753 10:11547627-11547649 AGAATGGCGTGAACCCCGGGAGG - Intronic
1064157920 10:12918964-12918986 AGAATGGGCGTGAACCCGGGAGG + Intronic
1064200786 10:13283216-13283238 AGAATGGCGTGAACCCCAGGGGG - Intronic
1064386103 10:14893090-14893112 AGAATGGCGTGAACCCCAGGGGG - Intronic
1065017673 10:21476767-21476789 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1065031635 10:21592543-21592565 AGAATGGCGTGAACCCCGGGGGG - Intronic
1065032564 10:21602816-21602838 AGAATGGTGTGAACCCTGGGAGG - Intronic
1065534511 10:26703990-26704012 AGAATGGCGTGAACCCTGGGGGG + Intronic
1065644911 10:27824049-27824071 AGAATGGCGTGAACCCCAGGGGG + Intronic
1065803375 10:29372688-29372710 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1065877525 10:30010410-30010432 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1065883143 10:30054756-30054778 AGAATGGCGTGAACCCCAGGGGG - Intronic
1066139691 10:32490706-32490728 AGAATGGCAGTGAACCCGGGAGG + Intronic
1066273752 10:33848290-33848312 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1066535059 10:36382314-36382336 AGCATGGCGTGAACCCCGGGGGG - Intergenic
1067115734 10:43434438-43434460 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1067208402 10:44238962-44238984 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1067704279 10:48595407-48595429 AGGACGGTGTGGGACCCGGAAGG - Intronic
1067714889 10:48683240-48683262 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1067942641 10:50669351-50669373 AGAATGGCTTAGAACCCGGGAGG + Intergenic
1068623027 10:59207800-59207822 AGAATGGTGTGACATCTGGGAGG + Intronic
1068692365 10:59930433-59930455 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1068808406 10:61226677-61226699 AGAATGGCGTGAATCCCGGGGGG + Intergenic
1069189108 10:65465345-65465367 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1069523908 10:69150484-69150506 AGAATGGTGTGAAACCCAGGAGG - Intronic
1069692972 10:70365978-70366000 AGAATGGCGTGAACACCGGGAGG + Intronic
1070110691 10:73484357-73484379 AGAATGGCATGAACCCCGGGGGG - Intronic
1070197566 10:74173177-74173199 AGAATGGTGTGAACCCAAGGTGG - Intronic
1070863880 10:79694306-79694328 AGAATGGCTTAGAACCCGGGAGG + Intergenic
1070989777 10:80721475-80721497 AGAATGGTGTGAACCCAGGGAGG - Intergenic
1071000346 10:80824397-80824419 AGAATGGTGTGAAACCCGGGGGG - Intergenic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1071857057 10:89636424-89636446 AGAATGGCGTGCACCCCGGGGGG - Intronic
1071924694 10:90392312-90392334 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1072100828 10:92227678-92227700 AGAATGGCGTGAACCCCGGGGGG - Intronic
1072222681 10:93339988-93340010 AGAATGGCGTGAACCCCGGGGGG + Intronic
1072466705 10:95669972-95669994 AGAATGGCGTGAACCCCAGGGGG + Intronic
1072564652 10:96607513-96607535 ACAAAGGTGTGGATCCTGGGCGG - Intronic
1072593091 10:96845554-96845576 AGAATGGCATGAACCCCGGGGGG - Intronic
1072658683 10:97348637-97348659 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1073054497 10:100690517-100690539 AGAATGGCGTGAACCCCGTGGGG - Intergenic
1073156063 10:101347840-101347862 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1073304978 10:102495848-102495870 AGAATGGCTTTGGACCCGGGAGG - Intronic
1073413281 10:103360097-103360119 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1073641303 10:105255097-105255119 AGAATGGCGTGAACCCGGGGGGG + Intronic
1073663071 10:105498989-105499011 AGAATGGTGTGAAACCCGGGAGG + Intergenic
1074055360 10:109918670-109918692 AGAATGGTGTGAACCCAGGAGGG + Intronic
1074124300 10:110516096-110516118 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1074280884 10:112050464-112050486 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1074363289 10:112839386-112839408 AAAATGCTGAGGAACCCGGTGGG + Intergenic
1074417460 10:113279835-113279857 AGAATGGCGTGAACCCCGGAGGG - Intergenic
1074548421 10:114420243-114420265 ACAATGGCGTTGAACCCAGGAGG + Intergenic
1074740365 10:116480316-116480338 GGAATGGCGTGAACCCCGGGAGG + Intergenic
1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG + Intergenic
1075092215 10:119450222-119450244 GCAAAGGTTTGGAACCCGGGTGG + Intronic
1075386988 10:122062120-122062142 AGAATGGAGTGAACCCAGGGAGG - Intronic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1075753893 10:124795248-124795270 AGAATTCTCTTGAACCCGGGAGG + Intergenic
1075755161 10:124805242-124805264 AGAATGGCGTGAACCCCGGGAGG + Intronic
1075937771 10:126358087-126358109 AGAATGGCATGAACCCCGGGGGG + Intronic
1076147673 10:128137401-128137423 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1076452513 10:130566549-130566571 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1076741432 10:132487717-132487739 GGAAGGATGTGGAACCCTGGAGG - Intergenic
1077005258 11:352026-352048 AGAATGGCATGAACCCCGGGGGG + Intergenic
1077084900 11:744751-744773 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1077087012 11:758193-758215 AGAATGGCGTGAACCGCGGGGGG + Intronic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1077587751 11:3466882-3466904 AGAATGGTGTGAACCCCGAGAGG + Intergenic
1077745618 11:4901246-4901268 AGAATGGCATGAACCCCGGGGGG - Intronic
1078168828 11:8912961-8912983 AGAATGGTGTGAACCCAGGAGGG - Intronic
1078286206 11:9958445-9958467 AGAATGGCGTGAACCCCAGGGGG - Intronic
1079223744 11:18587711-18587733 AGAATCGGCTTGAACCCGGGAGG + Intronic
1079474323 11:20812917-20812939 AGAATGGCGTGAACCCCAGGGGG + Intronic
1079545229 11:21625939-21625961 AGACTGGTGTGGGACGCGGATGG + Intergenic
1079616927 11:22506715-22506737 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1079680419 11:23289854-23289876 AGAATTGTTTGAAACCCAGGAGG - Intergenic
1079820078 11:25115443-25115465 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1080181735 11:29433811-29433833 AGAATGGCGTGAACCCCGCGGGG + Intergenic
1080323634 11:31044386-31044408 AGAATGGGCATGAACCCGGGAGG + Intronic
1080360451 11:31507188-31507210 AGAATGGTGTGAACCCAGGAAGG + Intronic
1080367027 11:31586729-31586751 AGAACGGCGTTGAACCCAGGAGG - Intronic
1080396557 11:31895279-31895301 AGAATGGCGTGAACCCCAGGGGG - Intronic
1080438165 11:32265298-32265320 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1080472788 11:32562320-32562342 AGAATGGCGTAAAACCCAGGAGG - Intergenic
1080503276 11:32889729-32889751 AGAATGGCGTAAAACCCAGGAGG + Intergenic
1080524067 11:33095730-33095752 AGAATGGCGTGAACCCCAGGGGG + Intronic
1080621922 11:33993874-33993896 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1081131689 11:39389029-39389051 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1081170632 11:39866553-39866575 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1081171609 11:39876364-39876386 AGAACGGCGTGAACCCCGGGGGG + Intergenic
1081344622 11:41968075-41968097 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1081761836 11:45582054-45582076 AGGATGGAGAGGAACCGGGGGGG + Intergenic
1082843802 11:57711440-57711462 AGAATCGTTTGAACCCCGGGAGG - Intronic
1083301757 11:61743274-61743296 AGAATGGCGTGAACCCAGGGCGG + Intronic
1083324912 11:61868270-61868292 AGAATGGCGTGAACCCCGGCGGG + Intergenic
1083402772 11:62435498-62435520 AGAATGGCGGGAACCCCGGGGGG - Intronic
1083456376 11:62781583-62781605 AGAATGGTGTAAAACCTGGGAGG + Intronic
1083462858 11:62826163-62826185 AGAATCGTTTTGAACCTGGGAGG + Intronic
1083554727 11:63616892-63616914 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1083650261 11:64199415-64199437 AGAATGGCGTTGAACCCGGGAGG + Intronic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1083957552 11:65993494-65993516 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1083972227 11:66086225-66086247 AGAATGGCGTGAACCCCGGGGGG - Intronic
1084157798 11:67324213-67324235 AGAATGGCGTGAACCCCGGGGGG - Intronic
1084619859 11:70262411-70262433 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1084669907 11:70599516-70599538 AGAATGGCGTGAACCCCAGGGGG + Intronic
1085091957 11:73724573-73724595 AGAATGGCGTGAACCCCGGGAGG - Intronic
1085639474 11:78183722-78183744 AGAATGGCGTGAACCCTGGGAGG - Intronic
1085668962 11:78443235-78443257 AGAATGGCGTGAACCCCGGGAGG + Intronic
1085909472 11:80804452-80804474 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1086112581 11:83216411-83216433 AGAATGGCGTGAACCCCAGGGGG - Intronic
1086479801 11:87222407-87222429 AGAATGGCGTGAACCCTGGGGGG + Intronic
1086908178 11:92441157-92441179 AGAATGTGGGGGAAGCCGGGAGG - Intronic
1086997070 11:93369840-93369862 AGAATGGCGTGAACCCCAGGGGG + Intronic
1087283611 11:96240459-96240481 AGAATGGCGTGAACCCCGGGAGG + Intronic
1087295118 11:96363050-96363072 AGAATGGCGTGAACCCCGGCGGG - Intronic
1087295772 11:96371491-96371513 AGAATGGTGTGAACCCGGGAGGG + Intronic
1087346497 11:96978014-96978036 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1087455009 11:98373502-98373524 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1087681934 11:101228229-101228251 AGAATGGTGAGAACCCTGGGGGG + Intergenic
1087814941 11:102648151-102648173 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1089432099 11:118433648-118433670 AGAATGGCGTGAACCCCGGGGGG - Exonic
1089577732 11:119458689-119458711 AGAATGGCGTGAACCCCGTGGGG + Intergenic
1090032270 11:123217391-123217413 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1090270780 11:125384593-125384615 AGAATGGCGTGAACCCAGGGAGG + Intronic
1090301115 11:125640450-125640472 AGAATGGCGTGAACCCCGGGGGG + Intronic
1090327387 11:125900919-125900941 AGAATGGCGTGAACCCCAGGGGG + Intronic
1091495779 12:971835-971857 AGAATGGCGTGAACCCCGGGGGG - Intronic
1091513652 12:1155563-1155585 AGAATGGTGTGAACCCAGGGAGG - Intronic
1091558288 12:1592683-1592705 AGAATGGGCTGGAAGCCGGGAGG + Intronic
1091876366 12:3936817-3936839 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1091901719 12:4149507-4149529 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1091983573 12:4887085-4887107 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1092040401 12:5379190-5379212 AGAATGGTGTGAACCCAGGAGGG - Intergenic
1092178694 12:6429440-6429462 AGCATGGTGTGGAACCCGGGAGG - Intergenic
1092199687 12:6572644-6572666 AGAATCGCTTGGAACCCGGGAGG - Intronic
1092338073 12:7651523-7651545 AGAATGGCGTGAACCCCAGGTGG + Intronic
1092340468 12:7671749-7671771 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1092414002 12:8275652-8275674 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1092795520 12:12107291-12107313 AGAATGGCGTGAACCCCGGGGGG + Intronic
1092805580 12:12219292-12219314 AGAATCGTTTGAACCCCGGGTGG - Intronic
1092832405 12:12457578-12457600 AGAATGGCGTGAACCCCGGGGGG + Intronic
1093075384 12:14752792-14752814 AGAATGGCATGAACCCCGGGGGG + Intergenic
1093127552 12:15348696-15348718 AGAATGACGTGAACCCCGGGGGG + Intronic
1093264763 12:16989758-16989780 AGAATGGTGTGAATCCGGGAGGG + Intergenic
1093362571 12:18248482-18248504 AGAATGGTGTGAACCCGGGGCGG + Intronic
1093367750 12:18324129-18324151 AGAATGACGTGAACCCCGGGGGG + Intronic
1093589160 12:20879296-20879318 AGAAGGGTGGAGAACCTGGGAGG - Intronic
1093906798 12:24702750-24702772 AGAATGGCGTGAACCCCGAGGGG + Intergenic
1094010197 12:25799741-25799763 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1094649358 12:32360094-32360116 AGAATGGTGTGAACCCAGGAGGG + Intronic
1094720525 12:33058649-33058671 AGAATTGCTTGAAACCCGGGAGG - Intergenic
1094746152 12:33346357-33346379 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1095241604 12:39866566-39866588 AGAATGGCGTGAACCCCGGGGGG - Intronic
1095593501 12:43933287-43933309 AGAATGGCGTGAACCCTGGGGGG - Intronic
1095784804 12:46098300-46098322 AGAATGGAGTGAAACCCAGGAGG + Intergenic
1095915214 12:47471316-47471338 AGAATGGGCTTGAACCCAGGAGG + Intergenic
1095964875 12:47860050-47860072 AGAATCGCTTAGAACCCGGGAGG - Intronic
1095966815 12:47873448-47873470 AGAATGGCGTGAACCCCAGGGGG - Intronic
1096190554 12:49615037-49615059 AGAATGGCGTGAACCCAGGGAGG + Intronic
1096223229 12:49845599-49845621 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1096387599 12:51205126-51205148 AGAATGGCGTGAACCCGGGGGGG - Intronic
1096712751 12:53469635-53469657 AGAATTGCTTGAAACCCGGGAGG + Intronic
1096806181 12:54142552-54142574 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1096935214 12:55266843-55266865 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1097061678 12:56289530-56289552 AGAATGGTGTTGAACCTTGGAGG - Intronic
1097114041 12:56683868-56683890 AGAATGGCGTGAACCCCAGGGGG + Intronic
1097311862 12:58127558-58127580 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1097490832 12:60269239-60269261 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1097703389 12:62843225-62843247 AGAATTGCTTGGAACCCCGGAGG + Intronic
1097798055 12:63884806-63884828 AGAATGGCCTTGAACCTGGGTGG - Intronic
1097987066 12:65794770-65794792 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1097988833 12:65813110-65813132 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1098122452 12:67256370-67256392 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1098619997 12:72584018-72584040 AGAATGGCGTGAACCCCAGGGGG - Intronic
1098719571 12:73879902-73879924 AGAATGATGTGAACCCCGTGGGG + Intergenic
1098804672 12:75008551-75008573 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1098812593 12:75114951-75114973 AGAATGGCGTGAACCCCGGGGGG - Intronic
1098814862 12:75146041-75146063 AGAATGGTGTGAACCCCGGGAGG - Intronic
1099006857 12:77244187-77244209 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1099350880 12:81567134-81567156 AAAATGGCGTGAATCCCGGGAGG - Intronic
1099968907 12:89480687-89480709 AGAATGGCGTGAACCCCAGGGGG - Intronic
1099999839 12:89819956-89819978 AGAATGGCGTAAACCCCGGGGGG + Intergenic
1100251899 12:92834967-92834989 AGAATGGCGTGAACCCCGAGAGG - Intronic
1100592611 12:96043516-96043538 AGAATGGCGTGAACCCCGGGGGG + Intronic
1100834656 12:98554487-98554509 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1101143834 12:101822322-101822344 AGAATGGCGTGAACCCCGGGGGG + Intronic
1101146081 12:101841573-101841595 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1101356721 12:103986006-103986028 AGAATGGTGTGAACCCAGGAGGG - Intronic
1101509488 12:105379937-105379959 AGAATGGCGTGAACCCCAGGGGG + Intronic
1101934307 12:109045065-109045087 AGAATCGCTTAGAACCCGGGAGG - Intronic
1102277096 12:111590976-111590998 AGAATGGCATGAAACCCGGGAGG - Intronic
1102354848 12:112224353-112224375 AGAATGGCGTGAACCCCGGGAGG - Intronic
1102367129 12:112347418-112347440 AGAATCGCTTGCAACCCGGGAGG + Intronic
1102979295 12:117228868-117228890 AGAATGGCGTGAACCCCGGGAGG - Intronic
1102989169 12:117302503-117302525 AGAATGGCGTGAACCCCAGGGGG + Intronic
1103246863 12:119465222-119465244 AGAATGGCGTGGAACCCGGGAGG + Intronic
1103289371 12:119831778-119831800 AGAATGGCGTGAACCCAGGGGGG + Intronic
1103294487 12:119874795-119874817 AGAATGGCGTGAACCCCGGGGGG + Intronic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103376439 12:120459765-120459787 AGAATGGCGTGAACCCCAGGGGG + Intronic
1103437774 12:120940355-120940377 AAAATGGTGTGAACCCCGGGAGG - Intergenic
1103488655 12:121299047-121299069 AGAATCGCTTGAAACCCGGGAGG + Intergenic
1103489070 12:121302799-121302821 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1103532898 12:121614730-121614752 AGAATGGCCGTGAACCCGGGAGG + Intergenic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1103752796 12:123177444-123177466 AGAATCGGCTTGAACCCGGGAGG + Intronic
1104771375 12:131366755-131366777 AGGATGGCGTGGAACTCGAGGGG + Intergenic
1105494055 13:20914931-20914953 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1105758960 13:23495420-23495442 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1105885410 13:24637500-24637522 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1105975240 13:25467638-25467660 AGAATGGCGTGAACCCCGGGGGG - Intronic
1106705292 13:32273309-32273331 AGAATGGCGTGAACCCCAGGGGG - Intronic
1107053170 13:36074398-36074420 AGAATGGCGTGAACCCTGGGGGG + Intronic
1107069555 13:36255571-36255593 AGAATCGCTTGGAACCCAGGAGG + Intronic
1107261204 13:38493821-38493843 AGAATGGCGTGGAACCTGGGAGG - Intergenic
1107366511 13:39684336-39684358 AGAATGGCGTGAACCCCAGGGGG - Intronic
1107531848 13:41290184-41290206 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1107780448 13:43896635-43896657 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1107781726 13:43910681-43910703 AGAATGGCGTGAACCCCGAGGGG - Intergenic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1107926078 13:45263315-45263337 AGAATGGTGTGAACCTTGGGAGG - Intronic
1107945636 13:45415660-45415682 AGAATAGCTTTGAACCCGGGAGG + Intronic
1108114800 13:47115546-47115568 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1108407408 13:50119237-50119259 AGAATGGCGTGAACCCCAGGGGG - Intronic
1108622584 13:52198368-52198390 AGAATGTTTTGGAATCAGGGTGG - Intergenic
1108831060 13:54478612-54478634 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1109382164 13:61577040-61577062 AGAATGGCGTGAATCCTGGGGGG + Intergenic
1109486386 13:63027253-63027275 AGAATGGTGTGAACCCGGGGGGG - Intergenic
1109597219 13:64571584-64571606 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1109822062 13:67669837-67669859 AGAATGGCGTGGACCCCCGGGGG - Intergenic
1109961356 13:69636791-69636813 AGAATGGTGTGAACCCTGGAGGG - Intergenic
1110223289 13:73094930-73094952 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1110612667 13:77506235-77506257 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1110641610 13:77831029-77831051 AGAATTGTGTGAACCCGGGGAGG - Intergenic
1110709463 13:78633976-78633998 AGAATGGCGTAAACCCCGGGGGG + Intronic
1110900235 13:80813236-80813258 AGAATGGCGTGAGTCCCGGGAGG - Intergenic
1110976770 13:81847469-81847491 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1111140609 13:84113500-84113522 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1111175461 13:84589610-84589632 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1111580285 13:90213898-90213920 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1111732472 13:92094429-92094451 AAAATGGCGTTGAACCTGGGAGG + Intronic
1111734416 13:92119486-92119508 AGAATGGTGTGAACCCCGGGGGG - Intronic
1111845800 13:93506967-93506989 AGAATGGTGTGAACCCGGGAGGG + Intronic
1112091038 13:96084438-96084460 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1112274307 13:98002101-98002123 AGAATGGTGTGAACCCGGGGGGG - Intronic
1112302842 13:98246182-98246204 AGAATGGCGTGAACCCCAGGGGG - Intronic
1112373366 13:98815568-98815590 AGAATGGCCATGAACCCGGGAGG - Intronic
1112427721 13:99318730-99318752 AGAATGGCGTGGAACCCGAGAGG + Intronic
1112685519 13:101821035-101821057 AGAATGGCGTGAATCCCGGGGGG - Intronic
1113038213 13:106074551-106074573 AGAAGCCTGGGGAACCCGGGAGG + Intergenic
1113327900 13:109300350-109300372 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1113637576 13:111930334-111930356 AAAATGGTGTGAACCCGGGGGGG - Intergenic
1113794332 13:113048528-113048550 AGAATGGCGTGAACCCGGGGAGG - Intronic
1113916717 13:113878285-113878307 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1114520639 14:23332681-23332703 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1114855175 14:26430435-26430457 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1115201483 14:30858785-30858807 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1115219027 14:31040984-31041006 AGAATGGTGTGAACCCAGGGAGG + Intronic
1115271965 14:31562691-31562713 AGAATGGCGTGAACCCCGGGAGG - Intronic
1115326905 14:32149681-32149703 AGAATTGCTTTGAACCCGGGAGG + Intronic
1115403404 14:32989553-32989575 AGAATGGCGTGAACCCCAGGGGG + Intronic
1115496521 14:34010306-34010328 AGAAGGGGTTGGAACACGGGAGG + Intronic
1115693710 14:35874124-35874146 AGAATGGCGTGAACCCCAGGAGG + Intronic
1115806397 14:37056399-37056421 AGAATGGCGTGAACCCCGGGGGG + Intronic
1115898276 14:38115515-38115537 AGAATGGCCAGAAACCCGGGAGG + Intergenic
1115995833 14:39194642-39194664 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1116067334 14:40001111-40001133 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1116261905 14:42640751-42640773 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1116315716 14:43389367-43389389 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1116388810 14:44366450-44366472 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1116470147 14:45277146-45277168 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1116562292 14:46395643-46395665 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1116636299 14:47400844-47400866 AGAATGGCGTGAACCCCGGGAGG - Intronic
1116646898 14:47540100-47540122 TGAATGGCGTGAACCCCGGGGGG - Intronic
1116822093 14:49635544-49635566 AGAATGGGGTGAAACCCAGGAGG + Intergenic
1116824200 14:49656264-49656286 AGAATGGCGTGAACCCCGGGGGG + Intronic
1117220925 14:53604559-53604581 AGAGTCGTCTTGAACCCGGGAGG + Intergenic
1117269321 14:54125578-54125600 AGAATCGTTTGAACCCCGGGGGG - Intergenic
1117736797 14:58775972-58775994 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1118027193 14:61781358-61781380 AGAATGGCGTGAACCCCGGGAGG + Intronic
1118561319 14:67086560-67086582 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119055678 14:71417380-71417402 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119170482 14:72531342-72531364 AGAATCACTTGGAACCCGGGAGG + Intronic
1119412303 14:74440423-74440445 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1119467301 14:74868746-74868768 AGAATGGCGTGAACCCAGGGGGG + Intronic
1119713452 14:76840670-76840692 AGAATGGTGTGAACCCCGGGGGG - Intronic
1119832527 14:77716225-77716247 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119968033 14:78938932-78938954 AGAATGGCGTGAACCCCAGGGGG - Intronic
1120145405 14:80973314-80973336 AGAATGGCGTGAACCCCGGGGGG + Intronic
1120195715 14:81480276-81480298 AGAATGGCGTGAACCCTGGGGGG - Intronic
1120589694 14:86361457-86361479 AGAATTGCTTGAAACCCGGGAGG - Intergenic
1120741802 14:88117106-88117128 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1120895190 14:89524283-89524305 AGAATGGTGTGAAACCCGGGGGG + Intronic
1121461985 14:94087513-94087535 AGAATGGCGTGAAGCCTGGGAGG - Intronic
1121982244 14:98465068-98465090 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1122084114 14:99287640-99287662 AGATGGATGTGTAACCCGGGGGG - Intergenic
1122171343 14:99877917-99877939 ATGGTGGTGTGCAACCCGGGGGG - Intronic
1122618260 14:103036239-103036261 AGAATGGTGTGAACCCAGGAGGG - Intronic
1122700246 14:103583450-103583472 AGAATTTGCTGGAACCCGGGAGG + Intronic
1122718798 14:103710650-103710672 AGAATGGTGTGAACCCCGGGAGG + Intronic
1122729809 14:103787740-103787762 AGAATGGCGTAAAACCCGGGAGG - Intronic
1122826329 14:104372582-104372604 AGAAAGGTGTGGAGCCCTGTAGG - Intergenic
1122936662 14:104961423-104961445 AGAATGGCGTGAACCCCGGGGGG + Intronic
1123668263 15:22627481-22627503 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1123887314 15:24739533-24739555 AGAATGGGGTGAACCCGGGGAGG - Intergenic
1124285944 15:28400235-28400257 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1124296756 15:28511428-28511450 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1124435500 15:29645645-29645667 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1124507840 15:30294035-30294057 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1124530928 15:30505661-30505683 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1124551513 15:30685178-30685200 AGAATGGTGTGAACCCCGGGGGG + Intronic
1124679734 15:31720487-31720509 AGAATGGTGTGAACCCCGGGGGG - Intronic
1124735715 15:32244623-32244645 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1124767729 15:32502034-32502056 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1124877939 15:33613140-33613162 AGAAGGCTGTGGAACTCTGGAGG - Intronic
1124967595 15:34448165-34448187 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1125186423 15:36936282-36936304 AGAAAGGCGTGAACCCCGGGAGG - Intronic
1125574572 15:40746425-40746447 AGAATGGGCGTGAACCCGGGAGG + Intronic
1125707605 15:41753319-41753341 AGAATCGTTTGAATCCCGGGAGG + Intronic
1125849897 15:42892919-42892941 AGAAATCTCTGGAACCCGGGAGG + Intronic
1126026930 15:44455937-44455959 AGAATGGCGTGAACCCCAGGGGG - Intronic
1126259415 15:46670909-46670931 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1126588924 15:50319746-50319768 AGAATCGTTTTGAACCCAGGAGG + Intronic
1126594123 15:50368785-50368807 AGAATTGCTTTGAACCCGGGAGG + Intergenic
1126714687 15:51502141-51502163 AGAATGGGTGTGAACCCGGGAGG + Intronic
1126801128 15:52297235-52297257 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1127044020 15:55007234-55007256 AGAATGGCGTGAACCCCGCGGGG + Intergenic
1127119353 15:55757884-55757906 AGAAGGGCGTGAAACCCGGGAGG + Intergenic
1127126013 15:55812760-55812782 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1127168157 15:56269740-56269762 AGAATGGTGTAAAACCTGGGAGG - Intronic
1127446783 15:59071207-59071229 AGAATGGGCCTGAACCCGGGAGG + Intronic
1127486268 15:59420806-59420828 AGAATGGCGTGAACCCCAGGGGG - Intronic
1127510836 15:59639549-59639571 AGAATGGCGTGAACCCCCGGGGG - Intronic
1128117262 15:65117618-65117640 AGAATGGTGTAAAACCCAGGAGG - Exonic
1128140451 15:65296770-65296792 AGAATGGTGTGAACCCGGGAGGG + Intronic
1128187755 15:65657552-65657574 AGAATGGCGTGAACCCCGGGGGG + Intronic
1128564436 15:68691238-68691260 AGAATGGCGTGAACCCCGGGGGG + Intronic
1128836424 15:70812577-70812599 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1129010300 15:72409976-72409998 AGAATTGCTTGAAACCCGGGAGG + Intergenic
1129146510 15:73652840-73652862 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1129289019 15:74549161-74549183 AGAATGGCGTGAACCCCGGGGGG - Intronic
1129346335 15:74922294-74922316 AGAATCGGCTTGAACCCGGGAGG + Intronic
1129418881 15:75406596-75406618 AGAATGGCGTGAACCCCAGGAGG + Intronic
1129427208 15:75472368-75472390 AGAATGGCGTGAACCCCGGTGGG + Intronic
1129469728 15:75745004-75745026 AGAATGGCCATGAACCCGGGAGG + Intergenic
1129533643 15:76291659-76291681 AGAATGGCGTGAACCCCGGGGGG + Intronic
1130080244 15:80726599-80726621 AGAATGGTGTGAACGCGGGGGGG - Intronic
1130191189 15:81737867-81737889 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1130343758 15:83022580-83022602 AGAATTGCTTAGAACCCGGGAGG + Intronic
1130352721 15:83106397-83106419 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1130649739 15:85755765-85755787 GGGATGGTGGGGAACCAGGGAGG - Intergenic
1130683632 15:86018111-86018133 AGAATGGCGTAAAACCTGGGAGG + Intergenic
1131243571 15:90770261-90770283 AGAATGGCGTGAACCCCGGGAGG - Intronic
1131415949 15:92257891-92257913 AGAATGGTGTGAACCCAGGGAGG + Intergenic
1131432528 15:92398042-92398064 AGAATGGCTTGAAACCTGGGAGG + Intronic
1131622967 15:94086989-94087011 AGAATGGCATAAAACCCGGGAGG - Intergenic
1131890195 15:96964332-96964354 AGAATGGCTTGAACCCCGGGGGG + Intergenic
1132164576 15:99573197-99573219 AGAATGGCGTGAACCCTGGGAGG + Intronic
1132836422 16:1955634-1955656 AGAATGGTGTGAACCCGGGAGGG - Intronic
1132848605 16:2013040-2013062 AGAATCGCTTTGAACCCGGGAGG + Intronic
1132943927 16:2521871-2521893 AGAATGGCGTGAACCCTGGGGGG - Intronic
1133177344 16:4025282-4025304 AGAATTGCCTTGAACCCGGGAGG + Intronic
1133353884 16:5121616-5121638 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1133543214 16:6776320-6776342 AGAATGGTGTGAACCCAGGAGGG + Intronic
1133647942 16:7781908-7781930 AGAATCGCTTAGAACCCGGGAGG - Intergenic
1133753069 16:8739627-8739649 AGAATGGGTTAGAACCCAGGAGG + Intronic
1133965216 16:10526223-10526245 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1134259307 16:12638071-12638093 AGAATGGCTTGAACCCCGGGGGG - Intergenic
1134392277 16:13830933-13830955 AGAATGGTGTGAACCCAGGAGGG - Intergenic
1134394550 16:13851223-13851245 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1135014826 16:18916424-18916446 AGAATGGCGTGAACCCCGGGGGG + Intronic
1135028529 16:19017757-19017779 AGACTGGCGTGAACCCCGGGGGG - Intronic
1135163920 16:20121887-20121909 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1135430228 16:22376045-22376067 AGAATTGCTTGAAACCCGGGAGG + Intronic
1135837573 16:25841092-25841114 AGAATGGCATGAACCCCGGGGGG - Intronic
1136224954 16:28853910-28853932 AGAATGGCGTAAAACCCGGGAGG + Intronic
1136407887 16:30059407-30059429 AGAATGCTGTAAAACCCGGGAGG + Intronic
1136506250 16:30705486-30705508 AGAATGGCTGTGAACCCGGGAGG - Intronic
1136564090 16:31059564-31059586 AGAATCGGCTTGAACCCGGGAGG - Intergenic
1136735054 16:32459599-32459621 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1137011665 16:35327778-35327800 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137389500 16:48069647-48069669 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137475578 16:48805549-48805571 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1137768287 16:50994700-50994722 AGGATGGTGTGGAAACAGGAGGG + Intergenic
1137809823 16:51342491-51342513 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137831609 16:51549025-51549047 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1137840460 16:51636393-51636415 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1138462717 16:57161599-57161621 AGAATGGCATTGAACCCAGGAGG - Intronic
1138614411 16:58153144-58153166 AGGATGGCGTGAACCCCGGGAGG + Intergenic
1138780476 16:59779106-59779128 AGAATGGCGTAAAACCCGGAAGG - Intergenic
1138827262 16:60335235-60335257 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1138897202 16:61221588-61221610 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1139695599 16:68672101-68672123 AGAATGGCGTGAACCCCAGGGGG + Intronic
1139904048 16:70350965-70350987 AGAATGGTTATGAACCCAGGAGG - Intronic
1140076709 16:71707041-71707063 AGAATGGCGTGAACCCCAGGGGG - Intronic
1140077992 16:71720056-71720078 AGAATGGCATGAACCCCGGGGGG - Intronic
1140356491 16:74311310-74311332 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1140380390 16:74481872-74481894 AGAATGGTGTAAAACCCGGGAGG - Intronic
1140499171 16:75418393-75418415 AGAATGGCGTAAAACCCGGGAGG - Intronic
1141120700 16:81353200-81353222 AGAATGGCGTGAACCCCAGGGGG + Intronic
1141252039 16:82367957-82367979 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1141454565 16:84131766-84131788 AGAATGGCGTGAACCCCAGGGGG - Intronic
1142150969 16:88512417-88512439 GGAATGTTCTGGAACCCGAGGGG + Intronic
1142209680 16:88803130-88803152 AGAATGGCGTGAACCCCGTGGGG - Intergenic
1203018025 16_KI270728v1_random:369994-370016 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1203036360 16_KI270728v1_random:643152-643174 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1142594924 17:1025030-1025052 AGAATGGCGTGAACCCCAGGGGG + Intronic
1142718007 17:1757920-1757942 AGAATGGCATGAACCCCGGGGGG - Intergenic
1143298943 17:5895000-5895022 AGAATGGCGTGAACCCCAGGGGG - Intronic
1143308221 17:5966007-5966029 AGAATGGTGTGAACCCCCAGGGG - Intronic
1143346384 17:6252394-6252416 AGAATGGTGTGAACCCCGGCGGG + Intergenic
1143360243 17:6363405-6363427 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1143416420 17:6754272-6754294 AGAATGGCGTGAACCCAGGGTGG - Intergenic
1143459145 17:7089332-7089354 AAAATGGCGTGAACCCCGGGGGG + Intergenic
1143465847 17:7135773-7135795 AGAATGGTGTGGTCGCCAGGGGG + Intergenic
1143726598 17:8851405-8851427 AGAATGGCGTGAACCCCGGGAGG + Intronic
1144144112 17:12380801-12380823 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1144234888 17:13250410-13250432 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1144311621 17:14019176-14019198 AGAATTGTTTGAACCCCGGGAGG + Intergenic
1144477649 17:15602714-15602736 AGAATGGCGTGAACCCCAGGGGG - Intronic
1144487166 17:15676522-15676544 AGAATGGCGTGAACCCCAGGAGG - Intronic
1144612391 17:16733412-16733434 AGAATGGCGTGAACCCTGGGTGG + Intronic
1144774780 17:17779862-17779884 AGAATGGCGTGAACCCCGGGGGG - Intronic
1144829931 17:18125613-18125635 AGAATGGCGTGAACCCCAGGAGG + Intronic
1144868393 17:18352233-18352255 AGAATGGCGTGAACCCCAGGGGG - Intronic
1144900338 17:18581876-18581898 AGAATGGCGTGAACCCTGGGTGG - Intergenic
1144913868 17:18705796-18705818 AGAATGGCGTGAACCCCAGGAGG + Intronic
1145006765 17:19342795-19342817 GGAATGGTGAGGTACCCCGGGGG - Intronic
1145735623 17:27229044-27229066 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1145767328 17:27467898-27467920 AGAATGGAATGGAACCCAGGAGG - Intronic
1145949042 17:28801362-28801384 AGAATGGTGTGAACCCCGGGGGG + Intronic
1145992607 17:29088141-29088163 AGAATGGCGTGAACCCCGGGGGG - Intronic
1146007369 17:29169137-29169159 AGAATGGCGTGAACCCTGGGAGG - Intronic
1146030943 17:29365509-29365531 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1146101456 17:29986734-29986756 AGAATGGCGTGAACCCCAGGGGG - Intronic
1146122379 17:30207198-30207220 AGAAGGGTGGGGAACCATGGTGG + Intronic
1146144373 17:30399899-30399921 AGAATGCTTAGGAAACCGGGAGG + Intronic
1146188740 17:30746547-30746569 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1146214281 17:30966582-30966604 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1146237798 17:31184558-31184580 AGAATGGCGTGAACCCCAGGGGG + Intronic
1146241678 17:31234585-31234607 AGAATGGTGTGAACCCAGGAGGG + Intronic
1146333629 17:31950867-31950889 AGAATGGCGTGAACCCCGGCGGG - Intronic
1146339271 17:32006226-32006248 AGAATGGCGTAAAATCCGGGAGG - Intergenic
1146352789 17:32109923-32109945 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1146409925 17:32573939-32573961 AGAATGGCGTGAACCCTGGGGGG - Intronic
1146508520 17:33426020-33426042 AGAATGCTGAGGAACACAGGAGG - Intronic
1146795279 17:35775961-35775983 AGAATGGTGTGAACCCGGGGAGG - Intronic
1146840334 17:36148187-36148209 AGAATGATGTGAAACCTTGGGGG - Intergenic
1147004984 17:37395629-37395651 AGAATTGGTTTGAACCCGGGCGG - Intronic
1147222678 17:38947819-38947841 AGAATGGGTGTGAACCCGGGAGG + Intronic
1147404375 17:40200396-40200418 AGAATGGCGTGAAACCGGGAGGG + Intergenic
1147407236 17:40220862-40220884 AGAATGGGCGTGAACCCGGGAGG - Intronic
1147452235 17:40512831-40512853 AGAATGGCGTGAAACCCGGGAGG - Intergenic
1147737818 17:42652061-42652083 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1147750912 17:42732677-42732699 AGAATGGCGTGAACCCCAGGGGG + Intronic
1147999404 17:44379033-44379055 AGAATGGCGTGAACCCCGGGGGG - Intronic
1148037984 17:44682765-44682787 AGAATGGCGTGAACCCGGGGAGG + Intronic
1148121475 17:45214874-45214896 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1148176402 17:45569335-45569357 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1148294974 17:46493624-46493646 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1148509820 17:48158869-48158891 AGAATGGCGTGAACCCCAGGGGG + Intronic
1148534130 17:48424312-48424334 AGAATGGTGTGAACCCGGGAGGG - Intronic
1149054282 17:52344127-52344149 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1149617891 17:58016873-58016895 AGAATGGTGTAAAACCTGGGAGG + Intergenic
1149767797 17:59294468-59294490 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1149899679 17:60462859-60462881 AGAATGATGTGAACCCTGGGGGG + Intronic
1150052365 17:61977538-61977560 AGAATGGTGTGAACCCGGGAGGG - Intronic
1150407628 17:64916314-64916336 AGAATGGTGTGAACCCGGGAGGG + Intronic
1150428135 17:65093674-65093696 AGAATGGCTTGAACCCCGGGGGG - Intergenic
1150681922 17:67291447-67291469 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1150850107 17:68696167-68696189 TAAATGGTGTGGAAGCCCGGAGG - Intergenic
1150917261 17:69449700-69449722 AGAATGGCGTGAACCCCAGGGGG - Intronic
1150970673 17:70023947-70023969 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1151211988 17:72551317-72551339 ACAATGGCGTGAATCCCGGGGGG - Intergenic
1151217852 17:72590035-72590057 AGAATGGCGTGAATCCCGCGGGG + Intergenic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1151739133 17:75967378-75967400 AGAATGGCTTTGAACCCAGGAGG + Intronic
1151794292 17:76332978-76333000 AGAATGGCGTGAACCTCGGGGGG - Intronic
1151897711 17:76991545-76991567 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1152329555 17:79664433-79664455 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1152680059 17:81662908-81662930 AGAATGGCTTTGAACCCAGGAGG + Intronic
1152914818 17:83028433-83028455 AGAATGGCGTGAACCCCAGGGGG + Intronic
1153408512 18:4767496-4767518 AGAATGGCGTGAACCCGGGGCGG - Intergenic
1153586267 18:6623979-6624001 AGAATCGTTTTGAACCTGGGAGG - Intergenic
1153926119 18:9836681-9836703 AGAATGGAGTGGAACACATGGGG + Intronic
1154064152 18:11090822-11090844 AGAATGGTGTGAACCCGGGGGGG + Intronic
1154481537 18:14831088-14831110 AGAATGGCATGAACCCCGGGAGG + Intronic
1154997015 18:21649848-21649870 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1155148076 18:23100553-23100575 AGAATGGTGTGAACCCGGGATGG - Intergenic
1155862707 18:30923360-30923382 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1155948015 18:31877521-31877543 AGAATGGCATGAACCCCGGGGGG + Intronic
1155955893 18:31956401-31956423 AGAATGCGCTTGAACCCGGGGGG + Intergenic
1156687729 18:39670044-39670066 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1157358556 18:46957341-46957363 AGAATGGCGTGAACCCCGGGGGG - Intronic
1158039354 18:53073434-53073456 AGAATGGTATGAAACCTGGGGGG + Intronic
1158301479 18:56057851-56057873 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1158424585 18:57327616-57327638 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1158636352 18:59162056-59162078 AGAATGGGCATGAACCCGGGCGG - Intergenic
1159156737 18:64592958-64592980 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1159278898 18:66258409-66258431 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1159400797 18:67931445-67931467 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1159420911 18:68218229-68218251 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1159565400 18:70042462-70042484 AGAATGGTGTGAACCCGGGACGG - Intronic
1159658131 18:71057327-71057349 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1159701688 18:71637055-71637077 AGAATGGCGTGAAACCAGGGGGG + Intergenic
1160051831 18:75440940-75440962 AGGTTGGTGTGGGACCAGGGTGG + Intergenic
1160192998 18:76730541-76730563 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1160334150 18:78022474-78022496 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1160934744 19:1588687-1588709 AGAATTGGGTTGAACCCAGGAGG + Intronic
1160964128 19:1738432-1738454 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1161145146 19:2673166-2673188 AGAATGGCCGTGAACCCGGGAGG + Intronic
1161183985 19:2903802-2903824 AGAATGGCGTGAACCCCGGAGGG - Intronic
1161214392 19:3086340-3086362 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1161249230 19:3271333-3271355 AGCAGGGTGTGGTACCCAGGTGG + Intronic
1161259544 19:3329644-3329666 AGAATTGTTTGAAACCCAGGAGG + Intergenic
1161785585 19:6323329-6323351 AGAATGGTGTGAACCCTAGGGGG + Intronic
1161794314 19:6377711-6377733 AGAATCGCTTGGAACCCAGGAGG + Intronic
1161824612 19:6554046-6554068 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1162028277 19:7906254-7906276 GGGCTGGTATGGAACCCGGGGGG - Intronic
1162197716 19:8998519-8998541 AGAATGGCGGTGAACCCAGGAGG + Intergenic
1162217324 19:9147427-9147449 AGAATGGTGTGAAACCCAGGAGG - Intronic
1162221845 19:9183866-9183888 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1162406066 19:10474597-10474619 AGAGTGGCGTGAACCCCGGGGGG + Intergenic
1162421939 19:10570458-10570480 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1162476961 19:10906036-10906058 AGAATCGCCTTGAACCCGGGAGG - Intronic
1162558677 19:11403122-11403144 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162573559 19:11486037-11486059 AGAATGGTGTGAACCCGGGGGGG - Intronic
1162692667 19:12446985-12447007 AGAATGGCGTGAACCCCAGGGGG - Intronic
1162698027 19:12492268-12492290 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162741462 19:12775964-12775986 AGAATGGCGTGAACCCCAGGGGG - Intronic
1162800353 19:13106910-13106932 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162832330 19:13293533-13293555 AGAATGGTGTAAAACCCGGGAGG - Intronic
1163036101 19:14569978-14570000 AGAATTGGCTGGAACCCAGGAGG - Intronic
1163053670 19:14703113-14703135 AGAATGGCGTGAACCCCAGGGGG + Intronic
1163288888 19:16365725-16365747 AGAGTGGTGAGGGACCCTGGGGG - Intronic
1163486237 19:17588198-17588220 AGAATTGAGGAGAACCCGGGAGG + Intergenic
1163590144 19:18188700-18188722 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1163684882 19:18706292-18706314 AGAATCGCTTTGAACCCGGGAGG - Intronic
1163818833 19:19484620-19484642 AGAATGGCATGAACCCCGGGGGG - Intronic
1163915476 19:20237393-20237415 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1163915545 19:20237872-20237894 AAAAATGTGTGGAATCCGGGAGG - Intergenic
1163971218 19:20797293-20797315 AGAATGGCGTGAACCCCAGGGGG - Intronic
1164215631 19:23143153-23143175 AGAATGGTGTGAACCCCGGGAGG + Intronic
1164318673 19:24118140-24118162 AGAATCGCTTGAAACCCGGGAGG - Intronic
1164618263 19:29679350-29679372 AGAATCGCTTAGAACCCGGGAGG - Intergenic
1164948712 19:32318081-32318103 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1165019609 19:32912951-32912973 AGAATGGCGTGAACCCCGGGGGG + Intronic
1165093223 19:33397252-33397274 AGAATGGTCAGGACCCTGGGGGG - Intronic
1165221868 19:34323118-34323140 AGAATGGCGTGAACCCCGGGGGG - Intronic
1165239978 19:34458469-34458491 AGAATGGCGTGAACCCCAGGGGG + Intronic
1165300668 19:34966501-34966523 AGAATGGCATGAACCCCGGGAGG + Intergenic
1165323928 19:35103140-35103162 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1165376709 19:35448242-35448264 AAAATGGTGAGGAACCTGGCTGG - Intronic
1165497627 19:36162807-36162829 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1165573354 19:36793622-36793644 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1165687499 19:37834573-37834595 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1165737757 19:38187626-38187648 AGAATGGCGTGAACCCCAGGGGG + Intronic
1165762362 19:38329139-38329161 AGAATGGCGTGAACCCCGGTGGG + Intergenic
1166058203 19:40306876-40306898 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1166125516 19:40713457-40713479 AGAATCGGCTTGAACCCGGGAGG + Intronic
1166189892 19:41169589-41169611 AGAATGGCGTGAACCCCGAGAGG - Intergenic
1166377843 19:42337593-42337615 AGAATGGCGTGAAACCCGGGGGG - Intronic
1166402375 19:42492980-42493002 AGAATGGTGTGAACCCAGGAAGG - Intergenic
1166408700 19:42542098-42542120 AGAATGGCGTGAACCCCGGGGGG - Intronic
1166839825 19:45690240-45690262 AGAATGGCGTGAACCCCAGGGGG + Intronic
1166858777 19:45797289-45797311 AGAATGGCGTGAACCCTGGGAGG + Intronic
1167090789 19:47342264-47342286 AGAATCGTTTTGAACCCGGGAGG + Exonic
1167443980 19:49526576-49526598 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1167458904 19:49614017-49614039 AGAATCGGCTTGAACCCGGGAGG + Intronic
1167481874 19:49737703-49737725 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1167519850 19:49947798-49947820 AGAATCGCTTGAAACCCGGGAGG + Intronic
1167773476 19:51538492-51538514 AGAAAGGTGTGGAACCCAGCAGG + Intergenic
1167990499 19:53356838-53356860 AGAATGGCGTGAACCCAGGGGGG + Intergenic
1168180180 19:54657089-54657111 AGAATGGTGTGAACCCCGAGGGG - Intronic
1168282022 19:55311048-55311070 AGAATCATTTGAAACCCGGGAGG - Intronic
1168578615 19:57534864-57534886 TGAATGGTGTGCAACCGGGGAGG + Intronic
1168598471 19:57698881-57698903 AGAATTGTTTGAACCCCGGGAGG - Exonic
1168698882 19:58423247-58423269 AGAATGGCGAGAACCCCGGGAGG - Intergenic
1168717336 19:58537250-58537272 ACAGTGGTGTGGAACCTGGTGGG + Intronic
1202699343 1_KI270712v1_random:151974-151996 AGAATAGTGTGACCCCCGGGAGG - Intergenic
925631195 2:5895259-5895281 AGAATGGCGTGAACCCCAGGGGG - Intergenic
926118433 2:10227848-10227870 AGAATGGTGTGAACCCCGGGAGG - Intergenic
926736197 2:16074838-16074860 AGAGTGGAGTGAACCCCGGGGGG + Intergenic
926835812 2:17018643-17018665 AGAATGGCGTGAACCCCAGGGGG + Intergenic
927422258 2:22945852-22945874 AGAATGGCGTGAACCCCGGGGGG + Intergenic
927541415 2:23914751-23914773 AGAATGGCGTGAACCCCGGGGGG + Intronic
927542325 2:23924092-23924114 AGAATGGCGTGAACCCCGGGGGG + Intronic
927560387 2:24068050-24068072 AGAATGGCGTGAACCCCAGGGGG - Intronic
927629827 2:24763448-24763470 AGAATGGCATGAACCCCGGGGGG + Intronic
927668174 2:25046590-25046612 AGAATGGCGTGAACCCCAGGGGG - Intronic
927753264 2:25688606-25688628 AGAATGGAGTGAACCCCAGGGGG - Intergenic
928156460 2:28881251-28881273 AAAATGGCGTGAACCCCGGGGGG + Intergenic
928159894 2:28913040-28913062 AGAATGGCGGTGAACCTGGGAGG - Intronic
928162392 2:28940020-28940042 AGAATGGCGTGAACCCGGGGGGG + Intronic
928501043 2:31895930-31895952 AGAGTGGTGTGAACCCCGGGGGG - Intronic
929106424 2:38370063-38370085 AGAATGGCGTGAACCCCGGGGGG + Intronic
929137328 2:38637449-38637471 AGAATGGCGTGAACCCCGGGGGG + Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
929681733 2:43998639-43998661 AGAATCGCGTGGACCCGGGGAGG - Intergenic
929854149 2:45621613-45621635 AGAATGGTGTGAACCCAGGGAGG + Intergenic
930415096 2:51080564-51080586 AGAATGGTGTGAATCCGGGAGGG + Intergenic
930515753 2:52405801-52405823 AGAATGGCGTGAACCCCGGGGGG + Intergenic
930727105 2:54693122-54693144 AGAATGGCGTGAAACCCAGGAGG - Intergenic
930836891 2:55803440-55803462 AGAATCGCTTAGAACCCGGGAGG + Intergenic
931731911 2:65160837-65160859 AGAATGGCGTTGAACCCGGGAGG + Intergenic
931781180 2:65580471-65580493 AGAATGGCGTGAACCCCAGGGGG - Intergenic
931907860 2:66862285-66862307 AGAATGGCGTTGAACCCAGGAGG - Intergenic
931958862 2:67459338-67459360 AGAATTGCTTGAAACCCGGGAGG - Intergenic
932041322 2:68302934-68302956 AGAATGGCGTGAACCCCGGGGGG - Intronic
932225188 2:70034063-70034085 AGAATGGCGTGAACCCCGGGGGG + Intergenic
932241081 2:70157363-70157385 AGAATGGCGTGAACCCCAGGGGG + Intronic
932245033 2:70189626-70189648 AGAATGGCGTGAACCCTGGGGGG + Intronic
932278080 2:70466416-70466438 AGAATGGCGAGAACCCCGGGGGG + Intronic
932561567 2:72876236-72876258 AGAATGGCGTGAGCCCCGGGGGG - Intergenic
932933213 2:76067353-76067375 AGAATAGTTTTGAATCCGGGAGG + Intergenic
933452067 2:82467247-82467269 AGAATGGCGTGAACCCCGAGGGG + Intergenic
933593728 2:84261381-84261403 AGAATGGCGTGAACCCCAGGGGG + Intergenic
933726946 2:85432487-85432509 AGAATGGCGTGAACCCCAGGGGG - Intronic
933865716 2:86515409-86515431 AGAATCGCTTAGAACCCGGGAGG - Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934649791 2:96084330-96084352 ATGATGGGGTGGAACCCAGGGGG - Intergenic
934683175 2:96300672-96300694 AGAATGGCGCGAAACCTGGGAGG + Intronic
935204081 2:100882521-100882543 AGAATGGCGTAAAACCCGGGAGG + Intronic
935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG + Intronic
935668297 2:105533787-105533809 AGAATGGCGTGAACCCTGGGGGG - Intergenic
935808878 2:106775678-106775700 AGAATTGCTTGAAACCCGGGAGG + Intergenic
936029450 2:109059484-109059506 AGAATGGTGTGAATCCCGGGAGG + Intergenic
936284370 2:111170608-111170630 AGAATGGCGTGAACCCCGGGGGG + Intergenic
936400048 2:112157984-112158006 AGAATGGCGTGAACCCCGGGGGG - Intronic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
936912893 2:117611010-117611032 AGAATGGCGTGAACCCCAGGGGG + Intergenic
937395573 2:121531504-121531526 AGAATGGCGTGAATCCGGGGGGG + Intronic
937402025 2:121592739-121592761 AGAATGGCGTGAACCCTGGGGGG - Intronic
937563009 2:123247775-123247797 AGAATGGTGTGAACCCTGGGAGG + Intergenic
938043997 2:128100117-128100139 AGAATGGGCTTGAACCTGGGAGG - Intronic
938138002 2:128774960-128774982 AGAATGTGGTGGGACCCTGGAGG + Intergenic
938394159 2:130929980-130930002 AGAATGGCGGGAACCCCGGGAGG - Intronic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
938486483 2:131714906-131714928 AGAATGGCGTGAACCCCGGGGGG + Intergenic
939475118 2:142677160-142677182 AGAATGGCGTGAACCCCAGGGGG - Intergenic
939491573 2:142883281-142883303 AGAATGGCGTGAACCCCGGGGGG - Intronic
940242042 2:151574061-151574083 AGAATGGCGTGAAACCCAGGAGG - Intronic
940288116 2:152052388-152052410 AGAATTGCTTTGAACCCGGGAGG - Intronic
940342750 2:152598598-152598620 AGAATTGCTTGAAACCCGGGAGG + Intronic
940660457 2:156538730-156538752 AGAATGGTGTGAATCCAGGAGGG + Intronic
940846025 2:158643176-158643198 AGATTGGTGAGGAACACAGGTGG + Intronic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
941234198 2:162948471-162948493 AGAATGGTGTGAACCCCGGGGGG + Intergenic
941446189 2:165602982-165603004 AGAATGGCGTGAACCCCGTGGGG - Intronic
941521492 2:166550201-166550223 AGAATGGCGTGAACGCCGGGGGG - Intergenic
941729286 2:168898484-168898506 AGAATCGCTTGAAACCCGGGAGG - Intronic
941893897 2:170610249-170610271 AGAATGGCGTGAACCCCGGAGGG + Intronic
941962008 2:171262986-171263008 AGAATCGCTTGGAACCCGAGAGG - Intergenic
942047993 2:172111135-172111157 AGAATGGCGTGAACCCCAGGGGG + Intergenic
942627407 2:177916847-177916869 AGAATGGCGGTGGACCCGGGAGG - Intronic
942871304 2:180737355-180737377 ACAATGGCGTGAACCCCGGGGGG - Intergenic
943017645 2:182532854-182532876 AGAATGGCGTGAACCCCGGGAGG + Intergenic
943089259 2:183354617-183354639 AGAATGGCGGAGAACCCGGGAGG - Intergenic
943512807 2:188847277-188847299 AGAATGGTGTGAATCCGGGACGG - Intergenic
943632608 2:190271376-190271398 AGAATCGCTTGAAACCCGGGAGG - Intronic
944025872 2:195166678-195166700 AGAATGGCGTGAACCCCAGGGGG - Intergenic
944085899 2:195847913-195847935 AGGATGCTCAGGAACCCGGGCGG + Intronic
944237280 2:197452159-197452181 AGAATGGCGTGAACCCCAGGGGG - Intergenic
944487100 2:200218381-200218403 AGAATGGCGTGAACCCCGTGGGG + Intergenic
944553687 2:200867711-200867733 AGAATTGTTTGAACCCCGGGAGG - Intergenic
944701144 2:202247441-202247463 AGAATGGTGTGAACCCAGGAGGG - Intergenic
944702149 2:202255401-202255423 AGAATGGCGTAAAACCCAGGAGG - Intergenic
944704181 2:202272239-202272261 AGAATGGCGTGAACCCCAGGGGG - Intronic
944706865 2:202298541-202298563 AGAATTGCTTGAAACCCGGGAGG + Intronic
944715228 2:202371123-202371145 AGAATGGCGTGAAACACGGGAGG - Intergenic
944730666 2:202514223-202514245 AGAATGGCGTGAACCCTGGGGGG - Intronic
944744866 2:202645376-202645398 AGAATGGCGTGAACCCCGGGGGG - Intronic
944816752 2:203385218-203385240 AGAATGGCGTGAAACCTGGGAGG - Intronic
944833021 2:203551429-203551451 AGAATGGTGTGAACCCCGCAGGG + Intergenic
944992554 2:205254751-205254773 AGAATGGCGTGAACCCCGGGGGG - Intronic
945302829 2:208230124-208230146 AGAATGGCATGAACCCCGGGGGG + Intergenic
945392495 2:209280921-209280943 AGAATGGCGTGAACCCCGTGGGG - Intergenic
945551498 2:211227043-211227065 AGAATGGCGTGAACCCCAGGGGG - Intergenic
945877852 2:215296827-215296849 AGAATGGCGTGAACCCCGGGGGG + Intergenic
945879177 2:215309112-215309134 AGAATGGCATGAACCCCGGGGGG - Intergenic
945911131 2:215651030-215651052 AGAATGGCGTGAATCCCGCGGGG - Intergenic
946272922 2:218609051-218609073 AGAATAGCGTGAACCCCGGGGGG + Intronic
946384661 2:219375219-219375241 AGAATGGATTGGAACTAGGGTGG - Intronic
946411804 2:219518991-219519013 AGAATGGCATGAACCCCGGGGGG - Intronic
946835628 2:223769831-223769853 AGAATGGCGTGAACCCCGGGGGG - Intronic
946929548 2:224658271-224658293 AGAATGGCGTGAACCCCGGGAGG - Intergenic
947059740 2:226149998-226150020 AGAATGGTGTAAAACCCAGGAGG + Intergenic
947489501 2:230581455-230581477 AGAATGGCGTGAACCCCGGGGGG + Intergenic
947517823 2:230822678-230822700 AGAATGGTGTGAACCCGAGGTGG - Intergenic
948116542 2:235497681-235497703 AGAATGGCGTGAACCCGGGGCGG - Intronic
948120768 2:235528764-235528786 AGAATTGCTTGCAACCCGGGAGG - Intronic
948913179 2:241016282-241016304 AGAATAGCGTGAACCCCGGGTGG - Intronic
1168985884 20:2048932-2048954 AGAATGCTGTGGGACACTGGAGG + Intergenic
1169179930 20:3555088-3555110 AGAATGGCGTGAACCCCAGGGGG - Intronic
1169181143 20:3568200-3568222 AGAATGATGTGAACCCCAGGAGG + Intronic
1169615952 20:7445509-7445531 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1169736673 20:8845023-8845045 AGAATGGTGTGAACCCGGGATGG + Intronic
1170107937 20:12772198-12772220 AGAATGGTGTGAACCCCGTGGGG - Intergenic
1170167229 20:13374435-13374457 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1170547827 20:17450115-17450137 AGAATGGCGTGAACCCCAGGGGG - Intronic
1170677928 20:18499644-18499666 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1170866067 20:20159483-20159505 AGAAAGGTGTGAAACCCATGGGG - Intronic
1171061211 20:21962282-21962304 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1172048342 20:32097488-32097510 AGAATGGCGTGAAAGCCGGGAGG + Intronic
1172555420 20:35836753-35836775 AGAATGGCGTGAACCCCCGGCGG + Intronic
1172751642 20:37255570-37255592 AGAATGGTGTGAACCCGGGAGGG + Intronic
1173116487 20:40248298-40248320 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1173219196 20:41117473-41117495 AGAATGGCGTGAACCCCAGGAGG - Intronic
1173517391 20:43674474-43674496 AGAATTGCTTGGAACCTGGGAGG - Intronic
1173804589 20:45915860-45915882 AGAATCGCTTAGAACCCGGGAGG - Intergenic
1173876940 20:46379080-46379102 AGAATTGCTTGAAACCCGGGAGG - Intronic
1174165208 20:48579393-48579415 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1174247997 20:49196345-49196367 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1174312305 20:49667338-49667360 AGAATGGCGTGAACCCCTGGGGG - Intronic
1174324023 20:49764744-49764766 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1174372844 20:50104566-50104588 AGAATGGCGTGAACCCCAGGGGG + Intronic
1174632141 20:51967409-51967431 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1174824819 20:53759550-53759572 AGAAAGGCGTGAACCCCGGGGGG - Intergenic
1174960811 20:55154907-55154929 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1175116561 20:56686889-56686911 AGAATGGCGTGAACCTCGGGGGG - Intergenic
1175143873 20:56881378-56881400 AGAATGGTGAGAACCCAGGGAGG - Intergenic
1175231875 20:57478958-57478980 AGAATCGCTTGGAACCCAGGAGG + Intergenic
1175886287 20:62292955-62292977 AGAATGGTGTGAACCCGGAGGGG - Intronic
1176149785 20:63584534-63584556 AGAATGGTGTGAAACCGGGGAGG - Intergenic
1176202238 20:63866548-63866570 AGAATGGCAGTGAACCCGGGAGG - Intronic
1176727224 21:10448165-10448187 AGATTGCTGTGGAAGCAGGGAGG + Intergenic
1176799069 21:13405516-13405538 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1177157084 21:17511455-17511477 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1177173144 21:17675818-17675840 AGAATCGCTTAGAACCCGGGAGG + Intergenic
1177174745 21:17691442-17691464 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1177200306 21:17946328-17946350 AGAATGGCGTGAACCCCCGGGGG + Intronic
1177205300 21:18003032-18003054 AGAATGGCGTGAACCCCGGGGGG + Intronic
1177315783 21:19459109-19459131 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1177441021 21:21123934-21123956 AGAATGGTCTTGAATCCGGAAGG - Intronic
1177488966 21:21796635-21796657 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1177545391 21:22551387-22551409 AGAATGGCGGTGAACCCAGGAGG - Intergenic
1177648750 21:23933957-23933979 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1177715500 21:24835768-24835790 AGAATGGCGTGAACCCCTGGGGG - Intergenic
1177945817 21:27468618-27468640 AGAATGGCGTGGAACCTGGGAGG + Intergenic
1177973372 21:27817708-27817730 AGAATGGTGTGAATCCAGGAGGG + Intergenic
1178325338 21:31641215-31641237 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1178559062 21:33620992-33621014 AGAATGGCGTGAACCCCAGGGGG - Intronic
1178586297 21:33874064-33874086 AGAATTGCTTGAAACCCGGGAGG + Intronic
1178611460 21:34085689-34085711 AGAATGGCGTGAAACCCGGGAGG - Intronic
1178727691 21:35069166-35069188 AGAATTGGCTTGAACCCGGGAGG + Intronic
1178836361 21:36100813-36100835 AGAATGGCGTTGAACCCGGGAGG + Intergenic
1179158738 21:38874531-38874553 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1179202968 21:39244151-39244173 AGAATGGCATTGAACCCAGGAGG - Intronic
1179214771 21:39358041-39358063 AGAATCGCTTAGAACCCGGGAGG - Intergenic
1179327266 21:40360219-40360241 AGAATGGTGTGAACCCCGGGAGG - Intronic
1179809069 21:43858878-43858900 AGTAGGGTGTGGGCCCCGGGAGG + Intergenic
1180206250 21:46262876-46262898 AGAATGGCGTGAACCCCGGGGGG + Intronic
1180211656 21:46298516-46298538 AGAATGGCGTGAACCCCGGCGGG - Intergenic
1180303527 22:11055448-11055470 AGAATGGTGTGAACCTGGGGAGG - Intergenic
1180672616 22:17565167-17565189 AGAATGGCGTGAACCCGGGGGGG - Intronic
1180698409 22:17768781-17768803 AGAATGGCGTGAAACTCGGGAGG + Intronic
1180736257 22:18019899-18019921 AGAATGGCGTGAACCCCGGGGGG - Intronic
1180791942 22:18579586-18579608 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1180792785 22:18585773-18585795 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1181091551 22:20476500-20476522 AGAATGGTGTGAACCCCGGGGGG - Intronic
1181228951 22:21409546-21409568 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1181229794 22:21415723-21415745 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1181248855 22:21519143-21519165 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1181249700 22:21525319-21525341 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1181382504 22:22518012-22518034 AGAATGGCGTGAACCCCGCGGGG - Intronic
1181576247 22:23797085-23797107 AGAATGGCGTGAACCCCAGGGGG - Intronic
1182086943 22:27567704-27567726 AGAATGTTGTGGAGCCCTTGGGG + Intergenic
1182100435 22:27654010-27654032 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1182217249 22:28729451-28729473 AGAATGGCGTGAACCCCAGGGGG + Intronic
1182337292 22:29592719-29592741 AGAATGGCGTAAACCCCGGGGGG - Intergenic
1182412791 22:30201504-30201526 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1182648288 22:31828360-31828382 AGAATCGCTTTGAACCCGGGAGG + Intronic
1182914361 22:34015515-34015537 AGAATTGGCTTGAACCCGGGAGG - Intergenic
1182943990 22:34305250-34305272 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1183012170 22:34955762-34955784 AGAATGGCGTGAAACCTAGGAGG + Intergenic
1183599883 22:38833763-38833785 AGAATGGCGTGAACCCCAGGGGG - Intronic
1183757347 22:39780908-39780930 AGAATGGTGTGAACCCAGGAGGG + Intronic
1183997913 22:41649764-41649786 AGAATGGCGTGAACCCCGGTGGG + Intronic
1184374209 22:44101318-44101340 AGAATGGCATGAACCCCGGGGGG + Intronic
1184623054 22:45697717-45697739 AGAATGGCGTGAACCCCAGGGGG - Intronic
1184755533 22:46513879-46513901 AGAATGGCGTGAACCCCGGGAGG - Intronic
1185160003 22:49218640-49218662 ACAGTTGTGTGGAAGCCGGGAGG + Intergenic
949186892 3:1202449-1202471 AGAATGGCGGGAACCCCGGGGGG + Intronic
949598890 3:5577609-5577631 AGAATGGCTTGAAGCCCGGGAGG - Intergenic
950250564 3:11461939-11461961 AGAATGGTTATGAACCCGGGAGG + Intronic
950626289 3:14249591-14249613 AGAATGGTGTGAACCCGGGAAGG - Intergenic
950838884 3:15947757-15947779 AGAATGGCATGAACCCCGGGGGG + Intergenic
951382986 3:22008440-22008462 AGAATGTTGTGAACTCCGGGGGG - Intronic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
951553539 3:23898530-23898552 AGAATCGCTTGAAACCCGGGAGG - Intronic
952145311 3:30525808-30525830 AGAATGGCGTGAACCCCAGGGGG + Intergenic
952381656 3:32810056-32810078 AGAATGGTGTGAACCCCGGGGGG - Intergenic
952417407 3:33101789-33101811 AGAATGGCGTGGAACCCGGGAGG + Intergenic
952434586 3:33259646-33259668 AGAATGGCGTGAACCCCAGGGGG + Intergenic
952456494 3:33477578-33477600 AGAATGGCGTGAACCCCGGGGGG + Intergenic
952539629 3:34354086-34354108 AGAATGGAGTAGAACTAGGGAGG - Intergenic
952896973 3:38084208-38084230 AGTATGGCGTGGAAGGCGGGAGG - Exonic
953318557 3:41951053-41951075 AGAATGGCGTGAACCCCGGGAGG + Intronic
953321742 3:41978847-41978869 AGAATGGCGTGAACCCTGGGAGG - Intergenic
953478325 3:43225727-43225749 AGAATGGCGTGAACCCCAGGGGG - Intergenic
953608253 3:44426052-44426074 AGAATGGTGTGAACCCGGGGAGG - Intergenic
953956902 3:47238748-47238770 AGAATGGTGTAAAACCCGGGAGG - Intronic
953977054 3:47389749-47389771 AGAATGGCGTGAACCCGGGGGGG + Intronic
953978818 3:47403139-47403161 AGAATGGCGTGAACCCCCGGGGG - Intronic
954086987 3:48252709-48252731 AGAATGGCGTGAACCCCAGGGGG - Intronic
954273248 3:49525645-49525667 AGAATGGCAGTGAACCCGGGGGG - Intronic
954309290 3:49752397-49752419 AGAATGGCGTGGAACCTGGGAGG + Intronic
954617990 3:51980009-51980031 AGAATGGCATGAACCCCGGGGGG - Intronic
954898819 3:54001270-54001292 AGAATGGCGTGAACCCCGGGGGG - Intergenic
954899512 3:54006983-54007005 AGAATGGCGTGAACCCCGGGGGG - Intergenic
954941875 3:54380647-54380669 AGAATGGTGTGAACCCGGGAGGG + Intronic
955044462 3:55346802-55346824 AGAATGGCGTGAACCCCAGGGGG + Intergenic
956156114 3:66299279-66299301 AGAATCGCTTGGAACCCAGGAGG - Intronic
956395439 3:68821434-68821456 AGAATGGCGTGAACCCCAGGGGG - Intronic
956797475 3:72729905-72729927 AGAATGGCGTGAACCCCGGGGGG - Intergenic
957059029 3:75466522-75466544 AGAATGGCGTGAACCCCGGGAGG + Intergenic
957464221 3:80565566-80565588 AGAATTGCTTGGAACCTGGGAGG + Intergenic
957747333 3:84362753-84362775 AGAATGGCGTGAACCCCAGGAGG - Intergenic
957883714 3:86255725-86255747 AGAATGGCGTGAACCCCAGGAGG - Intergenic
957886425 3:86294197-86294219 AGAATGGCGTGAACCCCAGGAGG + Intergenic
957977461 3:87465416-87465438 AGAATGGCGTGAACCCCAGGGGG + Intergenic
958054816 3:88396192-88396214 AGAATGGCGTGAACCCCAGGGGG - Intergenic
958547435 3:95572639-95572661 AGAATGGCGTGAACCCAGGGAGG - Intergenic
958766418 3:98373361-98373383 AGAATGGCGTGAACCCCGGGGGG - Intergenic
959018714 3:101165242-101165264 AGAATGGCGTGAACCCCGGGGGG - Intergenic
959055407 3:101562560-101562582 AGAATGGCGTGAACCCTGGGAGG + Intronic
959700135 3:109290980-109291002 AGAATGGCATGAACCCCGGGGGG - Intergenic
959935881 3:112027711-112027733 AGAATGGTGTGAACCCGGGAGGG + Intergenic
960064937 3:113361582-113361604 AGAATGGCGTGAAACCTGGGAGG - Intronic
960194439 3:114747827-114747849 AGAATGGCGTGAACCCCAGGGGG + Intronic
960226535 3:115175773-115175795 AGAATGGCATGAACCCCGGGGGG + Intergenic
960347836 3:116556627-116556649 AGAATGGCGTGAACCCCAGGGGG + Intronic
960447545 3:117766208-117766230 AGAATGGCGTGAACCCCAGGGGG + Intergenic
960621923 3:119645471-119645493 AGAATGGCGGTGAACCCGGGAGG + Intronic
960802738 3:121555651-121555673 AGAATGGCGTGAACCCCAGGGGG - Intergenic
961177383 3:124846843-124846865 AGAATCGGCTTGAACCCGGGAGG + Intronic
961246531 3:125458723-125458745 AGAATGGCGTGAATCCCGGGGGG + Intronic
961250531 3:125500708-125500730 AGAATGGTGTGAACCCCAGAGGG + Intronic
961294418 3:125873209-125873231 AGAATGGCATGAACCCCGGGAGG - Intergenic
961715183 3:128853092-128853114 AGAATGGCGTGAACCCCCGGGGG - Intergenic
961759368 3:129154151-129154173 AGAATGGCGTGAACCCCGGGGGG + Intronic
961803183 3:129468431-129468453 AGAATCGCTTAGAACCCGGGAGG - Intronic
961953331 3:130773266-130773288 AGAATGGCGTGAACCCCAGGGGG - Intergenic
962182927 3:133227280-133227302 AGAATGGCGTGAACCCCAGGGGG - Intronic
962791710 3:138817247-138817269 AGAATGGCATGAACCCCGGGGGG + Intronic
962871935 3:139504609-139504631 AGAATGGCGTGAATCCCGGGAGG - Intergenic
963166854 3:142212921-142212943 AGAATGGCGTGAACCCCAGGGGG - Intronic
963185537 3:142411909-142411931 AGAATGGCGTGAACCCCCGGGGG - Intronic
963189595 3:142454528-142454550 AGAATGGCGTGAACCCCAGGGGG - Intronic
963289305 3:143471194-143471216 AGAATGGTGAGGCTGCCGGGTGG + Intronic
963336994 3:143986633-143986655 AGAATGGCGTGAACCCCAGGGGG + Intronic
963448860 3:145451813-145451835 AGAATGGCATGAAACCAGGGAGG - Intergenic
963533905 3:146504116-146504138 AGAATGGCGTGAACCCCGGGAGG - Intergenic
963737416 3:149035567-149035589 AGAATGGCCTGAACCCCGGGAGG + Intronic
963739093 3:149057018-149057040 AGAATGGCGTGAACCCCAGGGGG + Intronic
964096321 3:152935568-152935590 AGAATTGCTTGAAACCCGGGGGG - Intergenic
964112435 3:153101603-153101625 AGAATGGCTTGAACCCCGGGGGG + Intergenic
964352454 3:155816313-155816335 AGAATGGCGTGAACCCCAGGGGG + Intergenic
964365376 3:155945269-155945291 AGAATGGCGTGAACCCCAGGGGG + Intergenic
964366395 3:155955074-155955096 AGAATGGCATCGAACCCAGGAGG - Intergenic
964411081 3:156398501-156398523 AGAATGGCATGAACCCCGGGGGG + Intronic
964568662 3:158088491-158088513 AGAATGGCGTGAACCCCAGGAGG + Intergenic
964811440 3:160668974-160668996 AGAATGGCGTGAAACCCGGGAGG - Intergenic
964838772 3:160970877-160970899 AGAATGGCGTGAACCCCAGGGGG - Intronic
964928458 3:161985469-161985491 AGAATGGCGTGAACCCCAGGGGG - Intergenic
965090327 3:164153524-164153546 AGAATGGCGTGAACCCCAGGGGG + Intergenic
965544141 3:169898288-169898310 AGAATGGCGTGAACCCCGGGGGG + Intergenic
965958917 3:174405551-174405573 AGAATGGCGTGAACCCCGGGGGG + Intergenic
966219257 3:177534507-177534529 AGAATGGCGTGAACCCCGGGGGG - Intergenic
966377686 3:179313471-179313493 AGAATGGCGTGAACCCCGGGGGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966837096 3:184057643-184057665 AGAATGGCGTGAAACTCGGGAGG + Intronic
967142556 3:186573472-186573494 AGAATGGCGTAAAACCCAGGAGG - Intronic
967415898 3:189218200-189218222 AGAATGGTGTGAACCCCGGGAGG - Intronic
967470695 3:189858314-189858336 AGAATGGCGTGAACCCCAGGGGG + Intronic
967779242 3:193418226-193418248 AGAATGGCGTGAACCCCGAGGGG + Intronic
968398562 4:267213-267235 AGAATGGTGTGAACCCTGGGGGG + Intergenic
968511834 4:999114-999136 AGAATGGTGTGAACCCGGGAGGG + Intronic
968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG + Intronic
969029508 4:4200384-4200406 AGAATAGTGTGACTCCCGGGAGG + Intronic
969372834 4:6744949-6744971 AGAATGGTGTGAACCCGGGAGGG + Intergenic
969400693 4:6953540-6953562 AGAATGGCGTGAACCCCAGGGGG + Intronic
969520339 4:7674482-7674504 AGAATGGTGTGAACCCGGGGGGG + Intronic
969751079 4:9111813-9111835 AGAATGGCGTGAACCCCAGGAGG - Intergenic
969810991 4:9648105-9648127 AGAATGGCGTGAACCCTGGGAGG - Intergenic
970081742 4:12294828-12294850 AGAATGGCGTGAACCCCGGGGGG + Intergenic
970213313 4:13733110-13733132 AGAATGGCGTTGAACCCGGGAGG - Intergenic
970415500 4:15852897-15852919 AGAATGGCGTGAACCCCAGGGGG - Exonic
970607519 4:17694432-17694454 AGAATGGTGTGAACCCAGGAGGG + Intronic
970660096 4:18275708-18275730 AGAATGGCATGAACCCCGGGGGG - Intergenic
971252627 4:24986068-24986090 AGAATGGCGTGAACCCCAGGGGG - Intergenic
971289639 4:25325152-25325174 AGAATGGCGTGAATCCCGGGAGG + Intronic
971398599 4:26254108-26254130 AGAATGATGTGGACCCAGGATGG - Intronic
971407486 4:26335707-26335729 AGAATGGCGTAAAACCCAGGAGG - Intronic
971736215 4:30455833-30455855 AGAATGGCGTGAACCCCGGGGGG + Intergenic
971951895 4:33361425-33361447 AGAATGGCGTGCAACTTGGGAGG + Intergenic
972176136 4:36408979-36409001 AGAATGGCGTGAACCCCGGGAGG - Intergenic
972508105 4:39740451-39740473 AGAATGGCGTGAACCCCGGGAGG + Intronic
972625383 4:40792660-40792682 AGAATGGCTTGAACCCCGGGGGG + Intronic
972770687 4:42194350-42194372 AGAATGGCGTGAACCCCGGGGGG - Intergenic
972878699 4:43396700-43396722 AGAATGGCGGGAACCCCGGGAGG + Intergenic
972920163 4:43929671-43929693 AGAATGGTGTGAACCCGGGAGGG - Intergenic
973059231 4:45699672-45699694 AGAATGGCGTGAACCCCAGGGGG - Intergenic
973761154 4:54117066-54117088 AGAATGGCGTGAACCCCGGGGGG - Intronic
974484203 4:62485631-62485653 AGAATGGCGTGAACCCCGGGAGG + Intergenic
974910821 4:68117376-68117398 AGAATGGAGTGAACCCTGGGTGG + Intronic
975229825 4:71919417-71919439 AGAATGACGTGAACCCCGGGGGG + Intergenic
975600933 4:76098668-76098690 AGAATTGCTTGAAACCCGGGAGG + Intronic
975602668 4:76118914-76118936 AGAATGGCGGAAAACCCGGGAGG + Intronic
976028610 4:80722809-80722831 AGAATGGCGTGAACCCCGGGGGG + Intronic
976171032 4:82304577-82304599 AGAATGGCGTGAACCCCGGGGGG - Intergenic
976307441 4:83574963-83574985 AGAATGGCGTGAACCCCAGGGGG - Intronic
976671663 4:87661308-87661330 AGAATGGCGTGAACCCCAGGGGG - Intronic
976765780 4:88595936-88595958 AGAATGGCATGAACCCCGGGGGG - Intronic
976958141 4:90930521-90930543 AGAATGGTGTAAAACCAGGGAGG + Intronic
977197036 4:94076288-94076310 AGAATGGCGTGAATCCCGGAGGG + Intergenic
977315645 4:95444418-95444440 AGAATGGCGTGAAGCCAGGGGGG - Intronic
977372805 4:96161624-96161646 AGAACGGCGTGAACCCCGGGGGG + Intergenic
977553449 4:98466117-98466139 AGAATGGTGTGAACCCAGGAGGG - Intergenic
977636539 4:99304576-99304598 AGAATGGCGTGAACCCCGGGGGG + Intergenic
977772093 4:100871465-100871487 TCAAGGGTGTGGAACCTGGGTGG - Intronic
978145266 4:105365145-105365167 AGAATGGCGTGAACCCCGGGGGG - Intergenic
978516827 4:109577697-109577719 AGAATGGCGTGAACCCCGGGGGG - Intronic
978787434 4:112625494-112625516 AGAATGGCGTGAAACCCGGGAGG + Intronic
978967179 4:114754406-114754428 AGAATGGCGTGAACCCCGGGGGG + Intergenic
978969613 4:114787293-114787315 AGAATGGCGTAAAACCTGGGAGG - Intergenic
979009293 4:115346403-115346425 AGAATGTTGTGAACCCGGGGAGG - Intergenic
979333905 4:119445828-119445850 AGAATTGTTTGAACCCCGGGGGG + Intergenic
979369616 4:119868642-119868664 AGAATGGCCATGAACCCGGGAGG - Intergenic
979755771 4:124338767-124338789 AGAATGGCGTTGAACCCGGGAGG - Intergenic
979772353 4:124543467-124543489 AGAATGGCGTGAACCCTGGGGGG + Intergenic
979815421 4:125096556-125096578 AGAATGGTTTGAACCCTGGGAGG - Intergenic
980048076 4:128011235-128011257 AGAATGGTGTGAACCCTGGGGGG - Intronic
980050150 4:128031376-128031398 AGAATGGCATAAAACCCGGGAGG + Intronic
980104679 4:128576229-128576251 AGAATGTTGTGAACCCCGGGAGG + Intergenic
980471334 4:133256462-133256484 AGAATGGCGTGAACCCCGCGGGG - Intergenic
980694944 4:136342347-136342369 AGAATGGCGTGAACCCCCGGGGG + Intergenic
980726027 4:136761800-136761822 AGAATGGTGTGAACCCGGGAAGG + Intergenic
980821190 4:138019731-138019753 AGAATGGCGTGAACCCCGGGGGG + Intergenic
980825510 4:138067121-138067143 AGAATGGCGTGAACCCCAGGGGG + Intergenic
981449523 4:144880038-144880060 AGAATGGCGTGAACCCCGGGGGG + Intergenic
981947188 4:150361858-150361880 AGAATGGGCATGAACCCGGGAGG - Intronic
981995172 4:150966395-150966417 AGAATGGCTTTGAACCTGGGAGG - Intronic
982041264 4:151399200-151399222 AGAATGGCGTGAACCCTGGGGGG + Intergenic
982237480 4:153265430-153265452 AGAATGGTGTGAATCCAGGAGGG - Intronic
982242815 4:153317558-153317580 AGAATGGTGTGAACCCCGGGAGG + Intronic
982495082 4:156080999-156081021 AGAATGGCGTGAACCCCAGGGGG - Intergenic
982506611 4:156226545-156226567 AGAATGGCGTGAACCCCGGGAGG + Intergenic
982739556 4:159043434-159043456 AGAATGGCGTGAACCCTGGGAGG - Intergenic
982747714 4:159121947-159121969 AGAATGGCGTAAAACCCGGGAGG + Intronic
983216174 4:165004922-165004944 AGAATGGCGTGAACCCCGGGGGG + Intergenic
983226324 4:165089408-165089430 AGAATGGCGTGAAACCTGGGAGG - Intronic
983226596 4:165091176-165091198 AGAATGGCCTGAAACCCGGGAGG + Intronic
983272471 4:165579183-165579205 AGAATCGCTTGAAACCCGGGAGG - Intergenic
983418127 4:167484123-167484145 AGAATGGCGTGAACCCCAGGGGG - Intergenic
983619951 4:169750578-169750600 ATAATGGTCTGGAACTCAGGAGG + Exonic
983634890 4:169887458-169887480 AGAATGGCGTGAACCCCAGGGGG + Intergenic
983840594 4:172453110-172453132 AGAATCGTTTAGAACCCAGGAGG + Intronic
984039913 4:174719050-174719072 AGAATGGGGTGAACCCCAGGGGG - Intronic
984077209 4:175197677-175197699 AGAATGGCGTGAAACCCAGGAGG + Intergenic
984153723 4:176167555-176167577 AGAATGGCGTGAACCCCAGGGGG + Intronic
984314002 4:178102807-178102829 AGAATGGCCGTGAACCCGGGAGG - Intergenic
984384877 4:179043797-179043819 AGAATGGCGTGAACCCCAGGGGG - Intergenic
984696862 4:182787643-182787665 AGAATGGCTTGAACCCCGGGAGG + Intronic
985285887 4:188336320-188336342 AGAATGGCGGGAACCCCGGGGGG - Intergenic
985312454 4:188617128-188617150 AGAATGGCATGAACCCCGGGAGG - Intergenic
985340563 4:188948526-188948548 AGAATGGCGGGAACCCCGGGGGG - Intergenic
985356201 4:189122195-189122217 AGAATGGCGGGAACCCCGGGAGG + Intergenic
985648334 5:1095572-1095594 AGAATGGTGTGGGACCCTGAGGG + Intronic
985857039 5:2436630-2436652 AGAATGGCGTGAACCCCAGGGGG - Intergenic
986588768 5:9346633-9346655 AGCATGGGGTGGAACACGGAGGG + Intronic
986809272 5:11339025-11339047 AGAATGGCGTGAACCCCAGGGGG - Intronic
987226388 5:15845880-15845902 AGAATGGCGTGAACCCCAGGAGG + Intronic
987358622 5:17086625-17086647 AGAATGGTGTGAACCCTGGAAGG + Intronic
987554864 5:19433877-19433899 AGAATGGTGTGAACCCGGGAGGG - Intergenic
987620518 5:20334220-20334242 AGAATGGCGTGAACCCCAGGGGG - Intronic
987772618 5:22326322-22326344 AGAATGGCGTGAACCCCGGGGGG - Intronic
987896543 5:23953739-23953761 AGAATGGCATGAACCCCGGGGGG - Intronic
987927247 5:24358604-24358626 AGAATGGCGTGAACCCCGGGGGG - Intergenic
988175142 5:27713359-27713381 AGAATGGCGTAAACCCCGGGGGG + Intergenic
988512641 5:31878647-31878669 AGAATGGCGTGAACCCCGGGGGG - Intronic
988522030 5:31954845-31954867 AGAATCGCTTGAAACCCGGGAGG + Intronic
988864620 5:35321316-35321338 AGAATGGCGTGAACCCCGGGGGG + Intergenic
989169703 5:38462077-38462099 AGAATGGCGTGAACCCCGGGGGG + Intronic
989186982 5:38635526-38635548 AGAATGGCGTGAACCCCGGGGGG - Intergenic
989228104 5:39053801-39053823 AGAATGGCGTGAACCCCAGGGGG + Intronic
989266521 5:39481233-39481255 AGAATGGCGTGAACCCCGGGGGG - Intergenic
989534930 5:42552279-42552301 AAAATGGTGTGGAAGCAGGAAGG - Intronic
989586609 5:43078657-43078679 AGAATGGCGTGAACCCCAGGGGG + Intronic
989650319 5:43681486-43681508 AGAATTGCTTTGAACCCGGGAGG - Intronic
989673762 5:43950132-43950154 AGAATGGCGTGAACCCCAGGGGG + Intergenic
989711849 5:44407701-44407723 AGAATCGCTTGAAACCCGGGAGG + Intergenic
990074246 5:51823101-51823123 AGAATGGCGTGAAACCCAGGAGG + Intergenic
990656529 5:57962866-57962888 AGAATGGTGTGAACCCCGGGGGG - Intergenic
990740124 5:58903845-58903867 AGAATGGCGGTGAACCTGGGAGG + Intergenic
990848067 5:60167355-60167377 AGAATGGCGTGAACCCCAGGGGG - Intronic
991944056 5:71882668-71882690 AGAATGGCATGAACCCCGGGGGG + Intergenic
991972910 5:72158095-72158117 AGAATGGCGTGAACCCCGGGGGG - Intronic
992403499 5:76433088-76433110 AGAATTGTGGGGTACCTGGGAGG + Intronic
992436472 5:76760036-76760058 AGAATGGCGTGAACCCCGCGGGG + Intergenic
992527016 5:77621402-77621424 AGAATGGCGTAAAACCCGGGAGG + Intergenic
992545357 5:77809600-77809622 AGAATGGCGTGAACCCCAGGGGG + Intronic
992629938 5:78670117-78670139 AGAATGGCGTGAACCTCGGGAGG - Intronic
992844259 5:80729324-80729346 AGAATGGCGTGAACCCAGGGAGG + Intronic
993033042 5:82726752-82726774 AGAACGGCGTGAACCCCGGGGGG + Intergenic
993780077 5:92055597-92055619 AGAATGGTGGTGAACCCAGGAGG - Intergenic
993887988 5:93439381-93439403 AGAATGGCGTGAACCCCGGGGGG - Intergenic
994159627 5:96542219-96542241 AGAATGGCGTGAACCCCGGGGGG + Intronic
994194943 5:96912099-96912121 AGAATGGTGTGAACCCCGGGGGG + Intronic
994814574 5:104568714-104568736 AGAATGGCGTGAACCCCAGGGGG + Intergenic
994933332 5:106218140-106218162 AGAATGGCGTGAACCCCAGGGGG + Intergenic
995181688 5:109235756-109235778 AGAATGGCGTGAACCTCGGGGGG + Intergenic
995359772 5:111281967-111281989 AGAATGGCGTGAACCCCAGGGGG + Intronic
995440045 5:112181360-112181382 AGAATGGCGTGGAACCCGGGAGG + Intronic
995483779 5:112618909-112618931 AGAATGGTGTGAACCCAGGAGGG - Intergenic
995813299 5:116134708-116134730 AGAATGGCGTGAACCCCAGGGGG - Intronic
995880789 5:116842396-116842418 AGAATGGCGTGAACCCCGGAGGG + Intergenic
996064437 5:119066096-119066118 AGAATGGTGTAAAACCCGGGAGG - Intronic
996202568 5:120694593-120694615 AGAATGGCGTGAACCCCAGGGGG + Intergenic
996243371 5:121229424-121229446 AGAATGGCGTGAACCCCAGGGGG - Intergenic
996694143 5:126375456-126375478 AGAATGGTGTGAACCCAGGAAGG - Intronic
996734302 5:126744307-126744329 AGAATGGCGTGAACCCCAGGGGG + Intergenic
996741013 5:126799105-126799127 AGAATGGCGTGAACCCCAGGGGG - Intronic
996774946 5:127122798-127122820 AGAATGGCGTAAAACCCGGGAGG - Intergenic
997082246 5:130753926-130753948 AGAATGGCGTGAACCCCAGGGGG - Intergenic
997116402 5:131130392-131130414 AGAATGGCGTGAACCCCAGGGGG - Intergenic
997501236 5:134375708-134375730 AGAATGGCGTGAACCCCAGGGGG + Intronic
997733448 5:136196877-136196899 AGAATTGCTTTGAACCCGGGAGG - Intergenic
997924027 5:138011506-138011528 AGAATGGCGTGAACCCGGGGAGG - Intronic
997930358 5:138067710-138067732 AGAATGGCGTGAACCCCGGGGGG - Intergenic
997931982 5:138080232-138080254 AGAATGGCTTTGAACCCAGGAGG + Intergenic
997942094 5:138167393-138167415 TGAATGGTGTTGAACTTGGGTGG - Intronic
997948193 5:138221033-138221055 AGAATGGCGTGAACCCCGGGGGG - Intergenic
998097674 5:139405748-139405770 AGAATGGTGTGAACCCCGGTTGG - Intergenic
998572826 5:143279514-143279536 AAGATGGTGTGTAACCCGGCTGG - Intronic
998631576 5:143904598-143904620 AGAATGGCGTGAACCCCGGGGGG - Intergenic
998777045 5:145615413-145615435 AGAATGGCGTGAACCCCAGGGGG - Intronic
999014299 5:148082696-148082718 AGAATGGCGTGAACCCCAGGGGG - Intronic
999151078 5:149426686-149426708 AGAATGGTTTGAACCCGGGGAGG - Intergenic
1000398307 5:160798838-160798860 AGAATTGCTTGAAACCCGGGAGG - Intronic
1000737215 5:164919778-164919800 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1000760935 5:165223705-165223727 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1001463867 5:171944484-171944506 AGAATGGCGTGAACCCCGGCAGG + Intronic
1001910443 5:175513209-175513231 AGAATCGCTTTGAACCCGGGAGG + Intronic
1002117493 5:176974721-176974743 AGAATCGTTATGAACCCGGGAGG + Intronic
1002404596 5:179020486-179020508 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1002514571 5:179747719-179747741 AGAATGGCGTGAACCCCGGGAGG + Intronic
1002558228 5:180060978-180061000 AGAATGGCGTGAACCCCGGGGGG + Intronic
1003288662 6:4759055-4759077 AGAATGGCGTGAACCCGGGGAGG - Intronic
1003291253 6:4780320-4780342 AGAATAGCTTTGAACCCGGGAGG - Intronic
1004142635 6:13034104-13034126 AGAATGGCGTGAACCCCAGGGGG - Intronic
1004388676 6:15191129-15191151 AGAATGGCGTAAAACCCAGGAGG - Intergenic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1005005478 6:21283364-21283386 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1005041666 6:21605938-21605960 ACAATGGTGGTGAACCCAGGAGG + Intergenic
1005156645 6:22814575-22814597 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1005897159 6:30188128-30188150 AGAATGGCGTGAACCCCAGGAGG + Intronic
1005964218 6:30715425-30715447 AGAATTGCTTGAAACCCGGGAGG - Intronic
1005983267 6:30853722-30853744 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1005990829 6:30900713-30900735 AGAATTGCTTAGAACCCGGGAGG + Intergenic
1006095570 6:31654153-31654175 AGAATTGCTTTGAACCCGGGAGG + Intronic
1006239009 6:32661330-32661352 AGAAAGGTGAGGAACCCCAGGGG - Exonic
1006248078 6:32757756-32757778 AGAAAGGTGAGGAACCCAAGGGG - Intronic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1006662382 6:35658284-35658306 AGAATGGCGTGAACCCCAGGAGG + Intronic
1006675056 6:35756654-35756676 AGAATGGCGTGAAATCAGGGAGG - Intergenic
1007372599 6:41436433-41436455 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1007460440 6:42014276-42014298 AGAATGGCGTGAACCCCGGGGGG + Intronic
1007486460 6:42184176-42184198 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1007579149 6:42945660-42945682 AGAATGGTGTGAACCCAAGGAGG - Intergenic
1007586845 6:42995948-42995970 AGAATGGCGTGAACCCCGGGGGG - Intronic
1007847669 6:44773603-44773625 AGAATAGTGTGGAACTGGGGAGG - Intergenic
1007950962 6:45871907-45871929 AGAATGGCCTCGAACCCAGGAGG + Intergenic
1008197564 6:48543154-48543176 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1008739851 6:54593884-54593906 AGAATGGTGTGAACCTCAGGAGG - Intergenic
1008980172 6:57474262-57474284 AGAATGGCATGAACCCCGGGAGG - Intronic
1008985928 6:57543026-57543048 AGAATGGCGTGAAGCCCAGGGGG - Intronic
1009168274 6:60367193-60367215 AGAATGGCATGAACCCCGGGAGG - Intergenic
1009177789 6:60481844-60481866 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1009351125 6:62680178-62680200 AGAATGGTTGTGAACACGGGAGG + Intergenic
1009400785 6:63253260-63253282 AGAATCGCCTTGAACCCGGGAGG + Intergenic
1009763228 6:68035878-68035900 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1009821445 6:68807325-68807347 AGAATGGCGTGAACCCCGCGGGG - Intronic
1010178669 6:73058321-73058343 AGAATGGCGTGAACCCCGGGGGG + Intronic
1010329061 6:74600642-74600664 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1010347384 6:74827481-74827503 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1010697248 6:78992049-78992071 AGAATGGTGTGAACCCCGGGGGG - Intronic
1011159349 6:84370679-84370701 AGAATGGGGTGAAATCAGGGAGG + Intergenic
1011486129 6:87844066-87844088 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1011683464 6:89804945-89804967 AGAATGGTGTGAACCCCGGGAGG + Intronic
1011690741 6:89865357-89865379 AGAATTGGCTTGAACCCGGGAGG + Intronic
1011812253 6:91146197-91146219 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1012513043 6:100026622-100026644 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1012707528 6:102550833-102550855 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1013444104 6:110204100-110204122 AGAATGGCGTTGAACCCAGGAGG - Intronic
1013641157 6:112083405-112083427 AAAATGGCGTGAACCCCGGGGGG - Intronic
1014585599 6:123194118-123194140 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1014905769 6:127025250-127025272 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1015025750 6:128530408-128530430 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1015363885 6:132375512-132375534 AGAATGGCGTGAACCCTGGGAGG - Intronic
1015468343 6:133573687-133573709 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1015667210 6:135645177-135645199 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1016019644 6:139222715-139222737 AGAATCGCTTAGAACCCGGGAGG + Intergenic
1016022725 6:139252900-139252922 AGAATGGCGTGAACCCCGGGAGG + Intronic
1016153654 6:140776662-140776684 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1016723829 6:147335709-147335731 AGAATGGCGTGAACCCCAGGGGG + Intronic
1016835570 6:148473340-148473362 AGAATTGCTTTGAACCCGGGAGG - Intronic
1017074301 6:150602990-150603012 AGAATGGCGTGAACCCCGGGGGG + Intronic
1017140910 6:151189262-151189284 AGATTGCAGTGGAACCCGGGAGG - Intergenic
1017372466 6:153728774-153728796 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1017457259 6:154612956-154612978 AGAAGGGTGTGGAACCAAGTAGG - Intergenic
1017883787 6:158581664-158581686 AGAATGGTGTGAACCCGGGCGGG + Intronic
1018135544 6:160775182-160775204 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1018274732 6:162118314-162118336 AGAATGGTTGTGAAGCCGGGAGG + Intronic
1018524190 6:164689646-164689668 AGAATGGTGTGAAACCCGGGAGG - Intergenic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1018959507 6:168437687-168437709 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1019378463 7:708879-708901 AGAATTGGCTTGAACCCGGGAGG - Intronic
1019393016 7:800329-800351 AGAATGGTGTGAACCTTGGGAGG - Intergenic
1019395205 7:814398-814420 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1019521981 7:1465079-1465101 AGAATCCTTTGAAACCCGGGAGG - Intergenic
1019585586 7:1800659-1800681 AGAATTGTTTGAAACCCGGGAGG + Intergenic
1019630230 7:2045153-2045175 AGAGGGGTGTGGAGGCCGGGTGG - Intronic
1019672166 7:2286605-2286627 AGAATGGCGTGAACCCCGGGAGG - Intronic
1019686664 7:2385553-2385575 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1019718131 7:2551149-2551171 AGAATCGTTTGAAACCCAGGAGG + Intronic
1019771257 7:2884965-2884987 AGAATGGCCTGAACCCCGGGGGG - Intergenic
1019853696 7:3583986-3584008 AGAATGGTGTGGACTTGGGGTGG - Intronic
1019988227 7:4673769-4673791 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1020052638 7:5092161-5092183 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1020155701 7:5722477-5722499 AGAATGGCGTGAACCCCGGGGGG - Intronic
1020169719 7:5835771-5835793 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1020230192 7:6312607-6312629 AGAATGGGCATGAACCCGGGAGG - Intergenic
1020321893 7:6944860-6944882 AGAATGGCATGAACCCCGGGAGG + Intergenic
1020401587 7:7784849-7784871 AGAATGGCGTGAACCCCAGGGGG - Intronic
1020585424 7:10059943-10059965 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1020610104 7:10385157-10385179 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1020930933 7:14393076-14393098 AGAATGGCGTGAACCCCAGGGGG - Intronic
1021692485 7:23243858-23243880 AGAATGGCGTGAACCCTGGGGGG + Intronic
1022004216 7:26252262-26252284 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1022011389 7:26310769-26310791 AGAATGGCGTGAACCCCAGGAGG - Intronic
1022164519 7:27744212-27744234 AGAATGGCGTGAACCCTGGGGGG - Intronic
1022353270 7:29586109-29586131 AGAATCGTTTGAACCCCGGGAGG - Intergenic
1022721376 7:32944191-32944213 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1022731503 7:33031008-33031030 AGAATGGCATGAACCCCGGGGGG + Intronic
1022741351 7:33124543-33124565 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1023373977 7:39538025-39538047 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1023961260 7:44928183-44928205 AGAATGGTGTGAACCCTGGGTGG + Intergenic
1024139701 7:46449430-46449452 AGAATGGTATGAACCCAGGGAGG - Intergenic
1024357131 7:48425828-48425850 AGAATGGCGTGAACCCCAGGGGG - Intronic
1024480497 7:49856918-49856940 AGAATGGTGTGAACCTGGGGAGG + Intronic
1024545024 7:50510058-50510080 AGAATGGCCTGAACCCCGGGAGG - Intronic
1024746840 7:52417078-52417100 AGAATGGCGTAAAACCTGGGAGG + Intergenic
1024995788 7:55272409-55272431 GGAAGGGTGTGGGAGCCGGGGGG - Intergenic
1025091146 7:56065101-56065123 AGAATGGCGTGAACCCCGGGGGG + Intronic
1025232781 7:57213826-57213848 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025630164 7:63264392-63264414 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1025652104 7:63479639-63479661 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025939032 7:66060312-66060334 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025961076 7:66222294-66222316 AGAATGGCATGAACCCCGGGAGG + Intronic
1026208205 7:68278066-68278088 AGAATGGTGTAAAACCCGGGAGG - Intergenic
1026329490 7:69339243-69339265 AGAATGGCATGAACCCCGGGGGG + Intergenic
1026431197 7:70348719-70348741 AGAATGGCGTGAACCCCGGGAGG + Intronic
1026914140 7:74109754-74109776 AGAATGGCGTTGAACCCAGGGGG + Intronic
1027026060 7:74852388-74852410 GGAATGGTGTGGAGCGTGGGAGG - Intergenic
1027061696 7:75091722-75091744 GGAATGGTGTGGAGCGTGGGAGG + Intergenic
1027240628 7:76325733-76325755 AGAATAGCTTGGAACCTGGGAGG + Intergenic
1027243374 7:76348490-76348512 AGAATGGCGTGAACCCGGGGTGG - Intronic
1027373498 7:77531746-77531768 AGAATGGCATGGAACCCGGGAGG + Intergenic
1027450922 7:78330526-78330548 AGAATGGCGTGAACCCCAGGGGG + Intronic
1027925318 7:84453323-84453345 AGAATGGCGTGAACCCCAGGGGG - Intronic
1028026165 7:85843364-85843386 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1028054986 7:86230132-86230154 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1028511643 7:91631748-91631770 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1028565267 7:92223354-92223376 AGAATGGCGTGAACCCCGGGAGG + Intronic
1028701229 7:93783160-93783182 AGAATGGCGTGAACCCCGGGGGG - Intronic
1028713422 7:93936858-93936880 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1029210511 7:98904392-98904414 AGAATGGTGTGAACCCAGGAAGG + Intronic
1029282171 7:99442565-99442587 AGAATGGTGTGAACCCCGGTGGG + Intronic
1029576202 7:101405131-101405153 AGAATGGCGTGAACCCCGGGAGG + Intronic
1029756834 7:102579196-102579218 AGAATTGGATTGAACCCGGGAGG - Intronic
1029774773 7:102678257-102678279 AGAATTGGATTGAACCCGGGAGG - Intergenic
1029807802 7:103014832-103014854 AGAATGGCATGAACCCCGGGGGG + Intronic
1029842926 7:103385249-103385271 AGAATGGTGTGAACCCGGGGAGG - Intronic
1029982358 7:104890789-104890811 AGACTGATGTGGCTCCCGGGAGG + Intronic
1030103761 7:105969308-105969330 AGAATGGCGTGAACCCCAGGGGG + Intronic
1030182732 7:106727165-106727187 AGAATGGCGTGAACCCCGGAGGG + Intergenic
1030349646 7:108469462-108469484 AGAATCGCTTGGAACCTGGGAGG - Intergenic
1030941108 7:115650788-115650810 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1031151202 7:118056236-118056258 AGAATGACGTGAACCCCGGGGGG + Intergenic
1031350065 7:120720361-120720383 ATAATGTTTTGGAACCAGGGTGG + Intronic
1031435397 7:121726830-121726852 AGAATGGCATGAACCCCGGGGGG - Intergenic
1031439333 7:121773914-121773936 AGAATTGCCTGGAACCCGGGAGG - Intergenic
1031456062 7:121981051-121981073 AGAATGGCGTGAACCCTGGGGGG + Intronic
1031468268 7:122140394-122140416 AGAATGGCGTGGAACCCGGGAGG + Intronic
1031523833 7:122799512-122799534 AGAATGGCGTGAACCCCGGGAGG + Intronic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1032254317 7:130284853-130284875 AGAATGGCGTGAACCCCGGGGGG + Intronic
1032424520 7:131811324-131811346 AGAATGGCGTGAACCCCGGCGGG + Intergenic
1032672677 7:134099617-134099639 AGAATGGCATGAACCCCGGGGGG - Intergenic
1032966209 7:137101664-137101686 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1033051763 7:138010890-138010912 AGAATGGTGTGAACCCTGGGGGG + Intronic
1033246134 7:139717832-139717854 AGAATGGCTTGAAACCTGGGAGG - Intronic
1033333629 7:140434825-140434847 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1033341946 7:140498997-140499019 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1033398632 7:141000289-141000311 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1033473588 7:141669897-141669919 AGAATGGCGTGAACCCCAGGGGG - Intronic
1033920118 7:146380885-146380907 AGAATGGCGTGAACCCCAGGGGG - Intronic
1034153937 7:148938888-148938910 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1034317243 7:150143882-150143904 AGAGTGGGCTGGAACCTGGGAGG + Intergenic
1034628485 7:152512424-152512446 AGAATGGCGTGAAACCCGGGAGG + Intergenic
1034775509 7:153823335-153823357 AGAGTGGGCTGGAACCTGGGAGG - Intergenic
1034896495 7:154879499-154879521 AGAATGGCGTGAACCCCAGGGGG + Intronic
1035214498 7:157355247-157355269 AGAACGGCGTGAACCCCGGGAGG - Intronic
1035450121 7:158972614-158972636 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1036140708 8:6205551-6205573 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1036169814 8:6472553-6472575 AGAATGGCTTGAAACCCAGGAGG - Intronic
1036197246 8:6730417-6730439 AGAATGGCGTGAACCCCAGGGGG - Intronic
1036451729 8:8873667-8873689 ACAACGGTGTGGAACTCGAGAGG + Intronic
1036601997 8:10269738-10269760 GGAATGGCGTGAACCCCGGGAGG - Intronic
1036850871 8:12200513-12200535 AGAATCGCGTGAACCCCGGGGGG - Intergenic
1036872235 8:12442791-12442813 AGAATCGCGTGAACCCCGGGGGG - Intergenic
1036973551 8:13382416-13382438 AGAATGGCGTGAACCCCAGGGGG + Intronic
1037579239 8:20234940-20234962 AGAAGGGGGTGGGGCCCGGGTGG - Intergenic
1038326949 8:26578848-26578870 GGAATGGTGTGGAAACGGGAAGG + Intronic
1038548477 8:28444564-28444586 AGAATGGCGTGAACCCAGGGCGG - Intronic
1038605904 8:29004207-29004229 AGAATGGTCTGGTACCCTGGAGG + Intronic
1038617067 8:29104831-29104853 AGAATGGCGTGAACCACGGGGGG - Intronic
1038617406 8:29107647-29107669 AGAATGGTGTGAACCCCGGGGGG - Intronic
1038675904 8:29622863-29622885 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1038803522 8:30770391-30770413 AGAATGGCATGAACCCCGGGAGG + Intergenic
1039214325 8:35252109-35252131 AGAATGGCGTGAACCCCGTGGGG - Intronic
1039254576 8:35705051-35705073 AGAATGGCTTGAAACCCAGGGGG - Intronic
1039699036 8:39943646-39943668 AGAATGGCGTGAACCCCGGGGGG + Intronic
1039746263 8:40430898-40430920 AGTATGGCGTGAACCCCGGGGGG - Intergenic
1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG + Intergenic
1040003795 8:42600875-42600897 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1040354885 8:46608008-46608030 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1040486536 8:47878192-47878214 ATAATGGCGTGAAACCTGGGAGG - Intronic
1040532223 8:48275260-48275282 AGAAAGGTGTGGAGACAGGGAGG + Intergenic
1041311804 8:56524904-56524926 AGAATTGTGGGGGATCCGGGGGG - Intergenic
1041486573 8:58384125-58384147 AGAATGGCGTGAACCCCGGCGGG - Intergenic
1042069867 8:64920187-64920209 AGAATGGCATGAACCCCGGGGGG - Intergenic
1042460168 8:69056487-69056509 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1042503751 8:69538048-69538070 GGAATGGCGTGAACCCCGGGGGG - Intronic
1042543625 8:69931282-69931304 AGAATGGCATGAACCCCGGGAGG + Intergenic
1042673784 8:71294368-71294390 AGAATGGCGTGAACCCCGGGGGG + Intronic
1042865160 8:73350499-73350521 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1042891978 8:73622213-73622235 AGAATGGCGTGAACCCCAGGGGG - Intronic
1042908773 8:73802932-73802954 AGAATGGTGTGAACCCTGGGAGG + Intronic
1043136988 8:76540191-76540213 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1043317305 8:78938547-78938569 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1043461477 8:80464560-80464582 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1044678398 8:94752495-94752517 AGAATGGTGTGAACCCAGGAGGG + Intronic
1045127025 8:99103586-99103608 AGAATGGTGTGAACCCGGGGAGG - Intronic
1045138102 8:99246091-99246113 AGAATGGAGTGGAACCATGTTGG - Intronic
1045148253 8:99372160-99372182 AGAATGGCGTGAACCCCAGGGGG + Intronic
1045222261 8:100210915-100210937 AGAATCATTTGGACCCCGGGAGG - Intronic
1045765151 8:105658497-105658519 AGAATGGCGTGAACCCCAGGGGG + Intronic
1045792924 8:106007069-106007091 AGAATGGCGTGAAGCCCGAGGGG - Intergenic
1045861119 8:106815940-106815962 AGAATGGCGTGAGCCCCGGGAGG - Intergenic
1046119310 8:109825493-109825515 AGAATGGACTTGAACCCGGGAGG - Intergenic
1046466931 8:114617198-114617220 AGAATGGCGTGAACCCTGGGCGG - Intergenic
1046835974 8:118801545-118801567 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1047001534 8:120578120-120578142 AGAATGGCGTGAACCCCAGGAGG - Intronic
1047166126 8:122440378-122440400 AGAATGGTGTGAACCCAGGGGGG + Intergenic
1047217527 8:122888569-122888591 AGAATCGTTTTGAACCCGGGAGG - Intronic
1047294142 8:123556423-123556445 AGAATGGCTTGAACCCCGGGAGG - Intergenic
1047376302 8:124300713-124300735 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1047684118 8:127286828-127286850 AGAATGGGCCTGAACCCGGGAGG - Intergenic
1047704809 8:127487496-127487518 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1047869270 8:129064570-129064592 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1048112680 8:131485831-131485853 AGTATGGCGTGAAACCGGGGAGG - Intergenic
1048208765 8:132437188-132437210 AGAATGGCGTGAACCCCAGGGGG + Intronic
1048340527 8:133535062-133535084 AGGATGGAGTGGAAAGCGGGAGG + Intronic
1048386774 8:133919368-133919390 AGAATTGCTTGAAACCCGGGAGG + Intergenic
1048560402 8:135529960-135529982 AGAATGGTGTGAAACCCGGGAGG + Intronic
1049023964 8:139975978-139976000 AGAATGGCGTGAACCCCGGGGGG - Intronic
1049233999 8:141499968-141499990 AGAATGGCGTGAAACCCAGGGGG + Intergenic
1049626714 8:143626581-143626603 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1049705085 8:144038036-144038058 AGAATGGCGTGAACCCCGGGGGG + Intronic
1050363329 9:4851968-4851990 AGAATGGCGTTGAACCCGGGAGG - Intronic
1050363929 9:4856618-4856640 AGAATGCTATGGAAACCTGGAGG + Intronic
1050516646 9:6451564-6451586 AGAATGGTGTGAACCCCGGGGGG - Intronic
1050760098 9:9058536-9058558 AGAATGGCGTGAACCCCAGGGGG - Intronic
1050826288 9:9950633-9950655 AGAATGGCGTGAACCCCAGGGGG + Intronic
1051203471 9:14658558-14658580 AGAATGGCGTGAACCCCAGGGGG - Intronic
1051233967 9:14979332-14979354 AGAATTGCCTAGAACCCGGGAGG - Intergenic
1051236065 9:15000481-15000503 ATAATGGTCTGGAACTCAGGAGG - Intergenic
1051720727 9:20034553-20034575 AGAATGGAGTGAACCCGGGGTGG - Intergenic
1051979783 9:22999695-22999717 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1052018542 9:23498532-23498554 AGAATGGGTGTGAACCCGGGAGG - Intergenic
1052085706 9:24263263-24263285 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1052309747 9:27052950-27052972 AGAATGGCGTGAACCCCTGGGGG - Intronic
1052762164 9:32603635-32603657 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1052785970 9:32828651-32828673 AGAATGGCGTGAACCCCTGGGGG + Intergenic
1052851106 9:33378936-33378958 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1052911906 9:33890476-33890498 AGAATCGGCTTGAACCCGGGAGG + Intronic
1053522822 9:38798140-38798162 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1053571243 9:39310219-39310241 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1053592594 9:39529113-39529135 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1053613125 9:39735179-39735201 AGAATGGTGTGAACCCCGGGAGG + Intergenic
1053673023 9:40388943-40388965 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1053871168 9:42493123-42493145 AGAATGGTGTGAACCCCGGGAGG + Intergenic
1053922833 9:43015311-43015333 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1054092809 9:60868911-60868933 AGAATTGCGTGAACCCCGGGGGG - Intergenic
1054114281 9:61144823-61144845 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1054125902 9:61308793-61308815 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1054195046 9:62022560-62022582 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1054240391 9:62607223-62607245 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1054554524 9:66641745-66641767 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1054573708 9:66836167-66836189 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1054593472 9:67037699-67037721 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1054627383 9:67412136-67412158 AGAATGGGCATGAACCCGGGAGG - Intergenic
1054643362 9:67566130-67566152 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1055060894 9:72067541-72067563 AGAATGGCGTGAAACTCAGGAGG + Intronic
1055093547 9:72387201-72387223 AGAATGGCGTAAAACCCGGGAGG + Intergenic
1055299004 9:74863669-74863691 AGAATGGCGTAAAACCCGGGAGG - Intronic
1055536679 9:77254030-77254052 AGAATGGTGTGAACCCTGGGGGG - Intronic
1056107714 9:83363641-83363663 AGAATGGCGTGAACCCCGGGGGG - Intronic
1056140911 9:83678804-83678826 AGAATGGGTGTGAACCCGGGAGG - Intronic
1056144993 9:83720511-83720533 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1056275754 9:84992540-84992562 GGCACAGTGTGGAACCCGGGAGG - Intronic
1056330929 9:85520443-85520465 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1056387199 9:86106863-86106885 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1056498411 9:87184276-87184298 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1056741070 9:89255676-89255698 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1056745251 9:89295993-89296015 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1056867152 9:90238080-90238102 AGAATGGCGTTGAACGTGGGAGG + Intergenic
1056960787 9:91121186-91121208 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1056998333 9:91484572-91484594 AGCATGGTGGGGAACACGGGAGG - Intergenic
1057203006 9:93153357-93153379 AGAATGGTGTGAACCTGGGGAGG - Intergenic
1057401255 9:94725790-94725812 AGAATGGCGGGAACCCCGGGGGG - Intergenic
1057501692 9:95601478-95601500 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1057603365 9:96479597-96479619 AGAATCGCTTTGAACCCGGGAGG - Intronic
1057618023 9:96610285-96610307 AGAATGGCGTGAACCCCTGGGGG - Intronic
1057874024 9:98739842-98739864 AGAATGGCGTGAACCCCAGGGGG - Intronic
1058030059 9:100186237-100186259 AGAATTGTTTAAAACCCGGGAGG - Intronic
1058328078 9:103723605-103723627 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1058579500 9:106439672-106439694 AGAATGGCGTTGAACCCGGGAGG + Intergenic
1058704562 9:107627822-107627844 AGAAGTTTGTGGAACCTGGGTGG + Intergenic
1058782592 9:108353079-108353101 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1058843153 9:108930599-108930621 AGAATGGTGTGAACCCGGGGAGG + Intronic
1059036704 9:110761662-110761684 AGAATGGCGTGAACCCCCGGGGG - Intronic
1059125723 9:111682997-111683019 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1060040250 9:120294267-120294289 AGAATGGTGAGAAACCCCGTGGG + Intergenic
1060079962 9:120634542-120634564 AGAATGGCGTGAACCCCAGGGGG - Intronic
1060084529 9:120684921-120684943 AGAATGGCGTGAACCCTGGGAGG - Intronic
1060366268 9:123018081-123018103 AGAATGGCATGAACCCCGGGGGG - Intronic
1060559820 9:124533737-124533759 AGAATGGCGTGAACCCAGGGAGG - Intronic
1061131222 9:128709194-128709216 AGAATGGCGGGAACCCCGGGGGG + Intronic
1061199101 9:129126057-129126079 AGAATCCTTTGAAACCCGGGAGG + Intronic
1061315292 9:129791997-129792019 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1061351933 9:130072306-130072328 AGAATGGCGTGAACCCCAGGGGG - Intronic
1061511594 9:131064572-131064594 AGAATGGCGTGAACCCCGGGGGG + Intronic
1062223478 9:135434228-135434250 AGAATTGCTTAGAACCCGGGAGG - Intergenic
1062244348 9:135556811-135556833 AGAATGGCGTGAACCCCGGAAGG - Intergenic
1062376296 9:136263321-136263343 AGAATGGCATGAACCCCGGGGGG - Intergenic
1062420784 9:136481222-136481244 AGAATGGCGTGAACCCCGGGGGG - Intronic
1062505628 9:136874063-136874085 AGAATGGTGTGAACCCTGGGGGG + Intronic
1185454637 X:302660-302682 AGAATTTGCTGGAACCCGGGAGG - Exonic
1185558078 X:1037079-1037101 AGAATGGTGTGAACCCGGTGGGG - Intergenic
1185645669 X:1614035-1614057 AGAATGGGTGTGAACCCGGGAGG - Intergenic
1185703498 X:2249279-2249301 AGAATGGTGTGAACCCAGGAGGG - Intronic
1186094300 X:6083045-6083067 AGAATGGCGTGAACCCCAGGGGG - Intronic
1186416187 X:9384809-9384831 AGAATGGGGGTGAACCCGGGAGG + Intergenic
1186560051 X:10601984-10602006 AGAATGGGCGTGAACCCGGGAGG - Intronic
1186845075 X:13522574-13522596 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1187008618 X:15256686-15256708 AGAATGGCGTGAACCCCAGGGGG + Intronic
1187137543 X:16562638-16562660 AGAATGGCATGAACCCCGGGGGG - Intergenic
1187258679 X:17665414-17665436 AGAATGGCGTGAACCCCAGGGGG - Intronic
1187860877 X:23681141-23681163 AGAATGGCGTGAACCCTGGGGGG + Intronic
1188314522 X:28656935-28656957 AGAATGGCATGAACCCCGGGAGG + Intronic
1188499519 X:30810255-30810277 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1188917102 X:35925283-35925305 AGAATGGCGTGAACCCCAGGGGG + Intronic
1188948452 X:36337956-36337978 AGAATGGCGTGAACCCCAGGAGG - Intronic
1189457749 X:41208794-41208816 AGAATGGTGTGAACCCAGGAAGG - Intronic
1190229312 X:48569557-48569579 AGAATCACTTGGAACCCGGGAGG + Intergenic
1190504095 X:51108810-51108832 AGAATGATGTGAACCCCGGGAGG + Intergenic
1190534997 X:51417190-51417212 AGAGTGTTGTGGGACTCGGGAGG + Intergenic
1190575778 X:51836657-51836679 AGAATGGCGTAAAACCCGGGAGG - Intronic
1190618493 X:52262453-52262475 TGAATGGTGAGGAACGCGGTTGG - Intergenic
1190724630 X:53180815-53180837 AGAATGGGGTGAACCCCCGGGGG - Intergenic
1190788009 X:53671702-53671724 AGAATGGCGTGAACCCCGGGGGG + Intronic
1191104471 X:56764094-56764116 AGAGAGCTGTGGAACCAGGGAGG - Intergenic
1192300695 X:69898491-69898513 AGAATCGCTTGAAACCCGGGAGG + Intronic
1192558080 X:72106118-72106140 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1192581506 X:72286537-72286559 AGAATGGCGTGAACCCCGGGGGG - Intronic
1192636139 X:72820605-72820627 AGAATGGCGTGAACCCCAGGGGG - Intronic
1192645575 X:72900209-72900231 AGAATGGCGTGAACCCCAGGGGG + Intronic
1193517456 X:82486017-82486039 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1193519099 X:82507286-82507308 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1193597222 X:83461457-83461479 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1193683186 X:84546822-84546844 AGAATAGTGTGAACCCTGGGGGG + Intergenic
1194042578 X:88960919-88960941 AGAATGGTGTGAACCCCGGAGGG - Intergenic
1194351866 X:92830766-92830788 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1196352387 X:114746894-114746916 AGAATGGTGTGAACCCGGGAGGG + Intronic
1196911956 X:120492868-120492890 AGAATGGCATGAACCCCGGGGGG - Intergenic
1196926638 X:120640042-120640064 AGAATGGCATGAACCCCGGGGGG + Intergenic
1197902444 X:131388903-131388925 AGAATGGCGTGAACCCTGGGGGG - Intronic
1198538642 X:137612559-137612581 AGAATGGCGTAAAACCTGGGAGG - Intergenic
1198692851 X:139302941-139302963 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1199050987 X:143236513-143236535 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG + Intergenic
1199779156 X:151042401-151042423 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1200168566 X:154054533-154054555 AGAATTGTTTTGAACCTGGGAGG + Intronic
1200266469 X:154648779-154648801 AGAATGGCATGAACCCCGGGGGG + Intergenic
1200274678 X:154720535-154720557 AGAATGGCGTGAACCCCGGGGGG + Intronic
1200301658 X:154982356-154982378 AGAATGGCGTGAACCCCGGGGGG + Intronic
1200887640 Y:8285669-8285691 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1200909816 Y:8521621-8521643 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1201197335 Y:11507199-11507221 AGAATGGAATGGAAACCGGATGG + Intergenic
1201614568 Y:15882882-15882904 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1201615800 Y:15896893-15896915 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1202053854 Y:20808307-20808329 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1202097119 Y:21263366-21263388 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1202134275 Y:21645603-21645625 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1202584264 Y:26407756-26407778 AGAATGGCGTGAACCCCAGGGGG + Intergenic