ID: 935224254

View in Genome Browser
Species Human (GRCh38)
Location 2:101039326-101039348
Sequence CAGAATAATAACATGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 1, 2: 1, 3: 102, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935224252_935224254 20 Left 935224252 2:101039283-101039305 CCACTAATAAGTAAAAATATTTG 0: 1
1: 0
2: 8
3: 188
4: 1676
Right 935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG 0: 1
1: 1
2: 1
3: 102
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935224254 Original CRISPR CAGAATAATAACATGGAGTT AGG Intronic
902968430 1:20029246-20029268 CAGCAGAACTACATGGAGTTTGG - Intronic
905531646 1:38684443-38684465 GGGAATAAAAACATGGATTTTGG - Intergenic
905831161 1:41069216-41069238 AATTATAATATCATGGAGTTGGG + Intronic
905932402 1:41798542-41798564 CAGAATAATAAAATCAAGCTTGG + Intronic
905950353 1:41945654-41945676 CAGAATCAGAACATGGAGATTGG + Intronic
906507334 1:46389961-46389983 CAGAATCAGAACATGGAGATTGG - Intergenic
906824525 1:48964665-48964687 CATAATAATAAAATGGCTTTTGG - Intronic
906956187 1:50376861-50376883 AAGAATAATACAATGGACTTTGG + Intergenic
907320803 1:53601061-53601083 AAGCATAAGAAAATGGAGTTTGG - Intronic
907349686 1:53817451-53817473 AAGAATAATACAATGGACTTTGG + Intronic
907505629 1:54916092-54916114 TAGAATCAGAACATGGAGATTGG - Intergenic
907602565 1:55785624-55785646 CAGAATCAGAACATGGAGATTGG - Intergenic
908174601 1:61542107-61542129 AAGAATGATAAAATGGACTTTGG - Intergenic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
908488339 1:64617575-64617597 TAAAATAATAACAAGGAGATAGG + Intronic
910162290 1:84286604-84286626 GAAAATAATCACATGGAATTTGG + Intergenic
910441575 1:87258208-87258230 AAGAATGATATAATGGAGTTTGG - Intergenic
910478502 1:87634075-87634097 AAGTAGAATGACATGGAGTTTGG - Intergenic
910590998 1:88928014-88928036 CAGAATCAGAACATGGAGATTGG + Intergenic
910734113 1:90433428-90433450 AAGAATGATACCATGGACTTTGG + Intergenic
912941930 1:114052813-114052835 AAGAATGATAAAATGGACTTTGG - Intergenic
913159165 1:116129647-116129669 ATGAATAAGAACATCGAGTTAGG - Intronic
913278988 1:117166998-117167020 CAGAAGAATAACCTGAAGCTGGG + Intronic
913599757 1:120412000-120412022 CAGAATCCTAACAGGGAGATGGG + Intergenic
914591112 1:149106557-149106579 CAGAATCCTAACAGGGAGATGGG - Intergenic
915687820 1:157652863-157652885 AAGATTTATAACATGGAATTTGG + Intergenic
915968629 1:160335534-160335556 CAGATAAACAACATGGGGTTGGG + Intronic
918529732 1:185504923-185504945 AAGAATGATAAAATGGACTTTGG - Intergenic
918941137 1:190999519-190999541 TAGAAAAAAAACTTGGAGTTTGG - Intergenic
918944668 1:191047991-191048013 AAGAATAATATCATGGATTCTGG - Intergenic
919356344 1:196527386-196527408 CATCATACTAACATGAAGTTAGG + Intronic
920274917 1:204797514-204797536 CGGAATACTAACATGGAGGAAGG - Intergenic
920425246 1:205869838-205869860 CAGAATCAGAACATGGAGATTGG - Intergenic
921516650 1:216100657-216100679 GAGAATAAAAACAAGGAATTGGG + Intronic
922684724 1:227630313-227630335 CAGAATCAGAACATGGAGATTGG - Intronic
923252656 1:232191759-232191781 CAGTGGAACAACATGGAGTTTGG + Intergenic
924033991 1:239917368-239917390 CAGAATAAAAACTTGGGGGTTGG - Intergenic
924474417 1:244370766-244370788 CAGAATAGCGACATGGAGTTTGG + Intronic
924685485 1:246285138-246285160 AAGAATAATACAATGGACTTTGG - Intronic
1063182822 10:3621474-3621496 AAGAATAATACAATGGACTTTGG + Intergenic
1063319635 10:5040698-5040720 CACTGTAATAACATGGAGTAGGG - Intronic
1063518086 10:6715883-6715905 AAGAAAAATAAGATGGTGTTTGG + Intergenic
1063850262 10:10181578-10181600 AAGAATGATACCATGGATTTGGG + Intergenic
1064921089 10:20519139-20519161 AAGAATGATAAAATGGACTTTGG - Intergenic
1065199647 10:23300743-23300765 CAGAATCAGAACATGGAGATTGG - Intronic
1065490625 10:26278416-26278438 GAGAATAATAATATGTATTTAGG - Intronic
1066600392 10:37099660-37099682 AAGAATAATACAATGGACTTTGG - Intergenic
1068471294 10:57467197-57467219 CAGAATAATAACTTATACTTAGG + Intergenic
1069145209 10:64883593-64883615 TAGCGTAATAACATGTAGTTTGG - Intergenic
1069734792 10:70646888-70646910 AAGAATGATACCATGGACTTTGG + Intergenic
1070433537 10:76364873-76364895 AAGAATAATACAATGGACTTTGG - Intronic
1071062952 10:81595602-81595624 AAGAATGATACCATGGACTTTGG + Intergenic
1071327047 10:84528001-84528023 CAGAATTAGAACATGGAGATTGG - Intergenic
1071905288 10:90166841-90166863 TAAAATAGTAAAATGGAGTTAGG - Intergenic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1072378111 10:94838195-94838217 CAGAATCAGAACATGGAGATTGG - Intronic
1072471959 10:95721281-95721303 CAGAATCAGAACATGGAGATTGG - Intronic
1073742090 10:106419116-106419138 GAGAATAATAAAATGGACTTTGG + Intergenic
1074222100 10:111447993-111448015 AAGAATAATATAATGGACTTTGG - Intergenic
1075494280 10:122906325-122906347 AAGAATGATACAATGGAGTTTGG + Intergenic
1076376362 10:129989791-129989813 AAGAATAATACAATGGACTTTGG + Intergenic
1078592943 11:12661334-12661356 GAGAATAATACAATGGACTTTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078863895 11:15278823-15278845 CTAAAGAATAAAATGGAGTTGGG + Intergenic
1079001388 11:16759973-16759995 AAGAAAAATAACATAGAGATAGG - Intergenic
1079462779 11:20698817-20698839 AAGAATAATATAATGGACTTCGG - Intronic
1079523496 11:21356827-21356849 AAGAATAATACAATGGACTTTGG - Intronic
1079601355 11:22316003-22316025 CAGAATCAGAACATGGAGATTGG - Intergenic
1079805572 11:24925916-24925938 AAGAATAATACAATGGACTTTGG - Intronic
1079887117 11:26002814-26002836 CAAAATCAGAACATGGAGATTGG + Intergenic
1081070536 11:38604586-38604608 CAGAATCAGAACATGGAGATTGG + Intergenic
1081410229 11:42749110-42749132 CACAAAAGTAACATGGATTTAGG - Intergenic
1082921927 11:58505029-58505051 AAGAATGATAAAATGGACTTTGG + Intergenic
1082961372 11:58921527-58921549 GAGAATAATAACGTGGAGAATGG - Intronic
1083071520 11:59988762-59988784 CATAATAATCACATGGAGAATGG + Intergenic
1085584529 11:77689238-77689260 CAGAAGAATGAAATAGAGTTGGG - Intronic
1086521584 11:87674358-87674380 GAGGATATGAACATGGAGTTTGG + Intergenic
1087461957 11:98456838-98456860 CAGCAGAACAACATGAAGTTTGG - Intergenic
1087614715 11:100474663-100474685 GAGAATTATAACATAGACTTTGG - Intergenic
1087649053 11:100843286-100843308 CAGACCAATAACAAGGAGTGAGG + Intronic
1088180780 11:107107275-107107297 CAGACCAATAACATGCAGTGAGG + Intergenic
1090595626 11:128318219-128318241 AAGAATAATATAATGGACTTTGG - Intergenic
1090757829 11:129809674-129809696 CAGAATGATACCATGGACTTTGG + Intergenic
1091209971 11:133848570-133848592 AAGAATAATACAATGGACTTCGG - Intergenic
1092061282 12:5552878-5552900 CAGAATGATACGATGGACTTTGG + Intronic
1092108592 12:5943475-5943497 AAGAATGATATCATGGACTTTGG + Intronic
1092294041 12:7184039-7184061 CAGAATCAGAACATGGAGATTGG + Intergenic
1092438185 12:8470714-8470736 AAGAATAATATAATGGACTTTGG + Intronic
1092469490 12:8765301-8765323 CAGAATCAGAACATGGAGATTGG - Intronic
1092929465 12:13301717-13301739 AAGAATGATATCATGGACTTTGG + Intergenic
1093590161 12:20893333-20893355 CACAAAAATGACAGGGAGTTTGG + Intronic
1093672289 12:21891435-21891457 CAGAAAAATCAAATGGTGTTGGG + Intronic
1095138935 12:38639323-38639345 CAGAATCAGAACATGGAGATTGG + Intergenic
1095178435 12:39119610-39119632 AAGAACAATACAATGGAGTTTGG - Intergenic
1095283889 12:40387103-40387125 CAGAATCAGAACATGGAGATTGG + Intergenic
1095404571 12:41853837-41853859 AAGAATGATATAATGGAGTTTGG - Intergenic
1095665411 12:44791394-44791416 AAGAATAATACAATGGACTTTGG + Intronic
1096171650 12:49476268-49476290 CGGCAGAATGACATGGAGTTTGG + Intronic
1096344794 12:50836411-50836433 AAGAATGATAAAATGGAGTTTGG + Intergenic
1096352108 12:50909103-50909125 CAGAATCAGAACATGGAGATTGG - Intergenic
1096829022 12:54300431-54300453 CAGAGTAATGGAATGGAGTTGGG + Intronic
1097149698 12:56967577-56967599 CAGAATCAGAACATGGAGATTGG - Intergenic
1097200791 12:57276901-57276923 AAGAATGATAAAATGGACTTTGG + Intronic
1097377302 12:58856170-58856192 CAGAATCAGAACATGGAGATTGG - Intergenic
1097385376 12:58944439-58944461 AAGAATGATAAAATGGACTTTGG - Intergenic
1097440131 12:59597680-59597702 CAGAAGTAGAACCTGGAGTTAGG - Intronic
1097462011 12:59873590-59873612 AAGAATGATAAAATGGACTTTGG + Intergenic
1098276817 12:68821002-68821024 AAGGCTAAAAACATGGAGTTGGG + Intronic
1100290440 12:93208962-93208984 AAGAATGATAAAATGGACTTTGG - Intergenic
1100741736 12:97601407-97601429 CACAAGAATGAAATGGAGTTTGG - Intergenic
1102909720 12:116703636-116703658 CAGAATAAAGACATGGGGGTGGG + Intergenic
1103803012 12:123551710-123551732 CAGAATCAGAACATGGAGATTGG + Intergenic
1104167892 12:126251569-126251591 AAGAATGATAAAATGGACTTTGG + Intergenic
1104851584 12:131877814-131877836 CAGAATGAGAACATGGAGATTGG - Intergenic
1105275206 13:18916008-18916030 AAGAATAATATAATGGACTTTGG + Intergenic
1105673437 13:22644584-22644606 CAGAACAACAACGTGGAGTTTGG - Intergenic
1105847494 13:24306338-24306360 CAGCATAATTACCTGGAGTTAGG + Exonic
1106169840 13:27279683-27279705 CAGCAGAATAACACTGAGTTTGG + Intergenic
1106234462 13:27850453-27850475 AAGAATAATATAATGGACTTTGG + Intergenic
1106381957 13:29248214-29248236 AAGAATAATATAATGGACTTTGG + Intronic
1106452132 13:29892178-29892200 CAGAAGAAGAAAAGGGAGTTTGG + Intergenic
1107064895 13:36202670-36202692 CAGAAATAAAACATGAAGTTGGG - Intronic
1107338941 13:39385655-39385677 CAGAATAAGAACCTGGGGCTGGG + Intronic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1108563519 13:51670894-51670916 AAGAATAATACAAGGGAGTTTGG - Intronic
1108736049 13:53284254-53284276 CAGAAATCTAAAATGGAGTTGGG - Intergenic
1108742169 13:53349573-53349595 CAGAAAAATAACATGGAAGGAGG - Intergenic
1108876643 13:55057196-55057218 CAGAATCAGAACATGGAGATTGG + Intergenic
1109181128 13:59215237-59215259 CAGAATGATATAATGGACTTTGG - Intergenic
1109200661 13:59427151-59427173 AAGAATTATATCATGGACTTGGG - Intergenic
1109326694 13:60876554-60876576 AAAAATAATAGTATGGAGTTAGG - Intergenic
1109606762 13:64706759-64706781 CAGAATCAGAATATGGAGATTGG - Intergenic
1109743085 13:66582022-66582044 CAGAATGATATCATGAAGTATGG - Intronic
1109824669 13:67702646-67702668 AAGAATAATACAATGGACTTTGG + Intergenic
1109931715 13:69225045-69225067 CAGAATCAGAACATGGAGATTGG + Intergenic
1109945819 13:69430229-69430251 AAGAATAATACAATGGACTTTGG + Intergenic
1110143303 13:72158087-72158109 CAGAAGAATAACATCAAGTCAGG + Intergenic
1110505080 13:76276445-76276467 GAGAATGATAAAATGGACTTTGG + Intergenic
1111806148 13:93042326-93042348 CAGAGTCAGAACATGGAGATGGG + Intergenic
1112250649 13:97775843-97775865 AAGAATAATATAATGGACTTTGG - Intergenic
1114134838 14:19835312-19835334 CAGAATTAAAACATGCAGTTGGG + Intergenic
1114287520 14:21259265-21259287 CAAAATTAGAACATGGAATTTGG - Intronic
1114384277 14:22239823-22239845 CAGAATCAGAACTTGGAGATTGG + Intergenic
1114785292 14:25590286-25590308 CTGAATAATAACAGAGAATTTGG - Intergenic
1115574008 14:34693516-34693538 CAGCAGAATAACGTGGAGTTTGG + Intergenic
1115970349 14:38938705-38938727 AAGAATAATACAATGGACTTTGG + Intergenic
1116669712 14:47825286-47825308 TAGACTAATAACATGGATTTTGG - Intergenic
1116934058 14:50719352-50719374 CAGCATATTAACATGGTTTTAGG + Intergenic
1117103530 14:52375308-52375330 CAGAACAATAACAAGCAGTGAGG - Intergenic
1117328409 14:54689591-54689613 CAGAATGATAATATGGCGTGGGG - Intronic
1117513142 14:56472851-56472873 AAGAATAATGACATGGACATTGG - Intergenic
1117517971 14:56521396-56521418 CAGAGTGATAAAATGGACTTTGG - Intronic
1117625780 14:57636446-57636468 TGGAAGAATAACATGGAGTGGGG - Intronic
1118410633 14:65474109-65474131 CAGAATAGTAAAATAGACTTTGG + Intronic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1119645392 14:76344445-76344467 AAGAATGATACAATGGAGTTTGG - Intronic
1120345300 14:83281335-83281357 CAGAATAATAACATAGAGGAGGG - Intergenic
1120373837 14:83674383-83674405 TAAAATAATAACATTGAATTTGG + Intergenic
1120776274 14:88441001-88441023 AAGAATAATACAATGGACTTTGG - Intronic
1120799583 14:88673937-88673959 CAGACTAATAACAGGCAGTATGG - Intronic
1122016549 14:98801746-98801768 CAGATGAATAAGATTGAGTTTGG + Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1122338825 14:101011593-101011615 CAGAATATTAGGGTGGAGTTGGG - Intergenic
1122523225 14:102361671-102361693 CAAAATAAAAAAATGAAGTTTGG + Intronic
1123577897 15:21690892-21690914 CAGAATTAAAACATGCAGCTGGG + Intergenic
1123614522 15:22133374-22133396 CAGAATTAAAACATGCAGCTGGG + Intergenic
1124202147 15:27687488-27687510 TAGTTTAATAACACGGAGTTGGG + Intergenic
1124825272 15:33088026-33088048 CAGAATGATACAATGGACTTTGG + Intronic
1124831074 15:33150145-33150167 CAGAAGAATCACAGGGAGCTTGG - Intronic
1125228489 15:37424572-37424594 AAGAATAATACAATGGACTTTGG - Intergenic
1125483092 15:40093744-40093766 CATAATAGTAACGTGGGGTTAGG + Intronic
1126573572 15:50176336-50176358 AAGAATAATACAATGGACTTTGG + Intronic
1127694263 15:61429014-61429036 AAGAATGATATCATGGATTTTGG - Intergenic
1128362667 15:66973377-66973399 CAAAATCAGAACATGGAGATTGG - Intergenic
1129102131 15:73275217-73275239 CAGAATCACAACATTGAGTAAGG - Intronic
1129300971 15:74625275-74625297 CAAGATAAAAACATGAAGTTGGG + Intronic
1129643511 15:77408357-77408379 AAGAATGATAAAATGGACTTTGG + Intronic
1131530419 15:93186320-93186342 AAGAATAATATAATGGACTTTGG - Intergenic
1132334622 15:101038186-101038208 AAGAATAATACAATGGATTTTGG + Intronic
1202986767 15_KI270727v1_random:425138-425160 CAGAATTAAAACATGCAGCTGGG + Intergenic
1134156370 16:11846859-11846881 AAGAATAAAAACAAGAAGTTAGG + Intronic
1135224701 16:20645743-20645765 CAGAATCAGAACATGGAGATTGG + Intronic
1135907665 16:26528095-26528117 GAGGATAATAACCTGAAGTTTGG + Intergenic
1138372149 16:56535687-56535709 AAGAATGATACCATGGACTTTGG - Intergenic
1138757088 16:59500895-59500917 TAGAAAAATAAAATGCAGTTTGG - Intergenic
1141668464 16:85478758-85478780 CAGGATAATAACTTGAACTTGGG - Intergenic
1144261152 17:13522208-13522230 CAGATAAATAACATGGATTATGG + Intronic
1148055992 17:44796026-44796048 AAGCAGAATGACATGGAGTTTGG - Intergenic
1148827112 17:50401916-50401938 CAGAATCACAACATAGAGATTGG - Intergenic
1149274126 17:55015279-55015301 CAGAATCAGAACATGGAGATTGG - Intronic
1151093795 17:71472784-71472806 GAGAATAAAAACATATAGTTAGG - Intergenic
1151408633 17:73906029-73906051 TAGAATAATAAAATAGTGTTCGG - Intergenic
1153401506 18:4688157-4688179 CAGAATCAGAACATGGAGATTGG + Intergenic
1154966159 18:21358662-21358684 AAGAATAATATAATGGACTTTGG + Intronic
1155628938 18:27868607-27868629 AAGAATGATAAAATGGACTTTGG + Intergenic
1155708257 18:28843227-28843249 AAGAATAATACAATGGACTTTGG - Intergenic
1156681093 18:39589773-39589795 CAGGATATCAACAGGGAGTTTGG + Intergenic
1157078900 18:44499698-44499720 CACAACAATAAAATGGAGCTTGG - Intergenic
1158008082 18:52695983-52696005 CAGAATAAAAACTTTGAGTATGG - Intronic
1158285802 18:55881123-55881145 CAGATAAATAAAAAGGAGTTTGG + Intergenic
1159220482 18:65457469-65457491 AAGAATAATACAATGGACTTTGG + Intergenic
1159409307 18:68050716-68050738 AAGAATAATAAAATGGATTTTGG - Intergenic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1160248067 18:77176279-77176301 CAGAATGATACAATGGACTTTGG - Intergenic
1161985832 19:7653304-7653326 CAGAATAATATCATGCTGGTAGG + Intergenic
1164057317 19:21632666-21632688 TAGAATCAGAACATGGAGATTGG + Intergenic
1164185663 19:22865602-22865624 AAGCATAATAACATTGATTTGGG - Intergenic
1164238167 19:23356552-23356574 AAGAATAATACAATGGACTTTGG + Intronic
1164287734 19:23836170-23836192 AAGAATAATACAATGGACTTTGG - Intergenic
1164323180 19:24168796-24168818 CAGGATCAGAACATGGAGATTGG - Intergenic
1164545795 19:29161630-29161652 AAGAATAATATAATGGACTTTGG + Intergenic
1165424071 19:35736358-35736380 CAGAATAATGACAGGTAGATGGG + Intronic
1165530368 19:36394791-36394813 GAGAATAGCAACATGGATTTAGG - Intronic
1167283691 19:48586621-48586643 CAGAAAAATGAAATGGGGTTGGG + Intronic
1168362125 19:55750549-55750571 AAGAATGATAAAATGGACTTTGG - Intergenic
1168520743 19:57048678-57048700 AAGAATGATATCATGGACTTTGG + Intergenic
924960359 2:29261-29283 AAGGATAGAAACATGGAGTTGGG + Intergenic
924974179 2:157834-157856 CAGAATCAGAACATGGAAATTGG - Intergenic
924976270 2:178738-178760 AAGAATGATAAAATGGACTTTGG + Intergenic
926377817 2:12251269-12251291 CAAAAGAAGAACATGGAGTATGG - Intergenic
926515765 2:13843545-13843567 CAGAATAATACAATGGACTGTGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927372209 2:22369378-22369400 AAGAATAATATAATGGACTTTGG + Intergenic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928677013 2:33660283-33660305 CAGAATCAGAACATGGAGATTGG + Intergenic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
929197568 2:39201801-39201823 AAGAATAATACAATGGACTTTGG + Intronic
929450160 2:42031479-42031501 CAGAATAATAGCATGTGCTTTGG - Intergenic
929583054 2:43096169-43096191 CAGTACAGTAACATGGAGTATGG + Intergenic
930447402 2:51491172-51491194 CAGAATGATAATGTAGAGTTTGG + Intergenic
930499714 2:52198134-52198156 CAGAATAAAGGCATGGAATTGGG + Intergenic
930631510 2:53759205-53759227 CAAAATCAGAACATGGAGATTGG + Intronic
932039030 2:68278904-68278926 CAGAAAAATAAAATTGAATTTGG + Intergenic
932056608 2:68449364-68449386 AAGAATAATATAATGGACTTTGG - Intergenic
932917633 2:75875184-75875206 CAGAATCAGAACATGGAGATTGG + Intergenic
933175296 2:79167028-79167050 CAGAATCAGAACATGGAGAATGG - Intergenic
933562483 2:83905826-83905848 GTCAATAATAACAGGGAGTTTGG + Intergenic
934672103 2:96220816-96220838 CAGAATCAGAATATGGAGATTGG - Intergenic
934853229 2:97714065-97714087 CAGAATATTAACTGGGAGTCAGG + Intronic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
935508012 2:103931652-103931674 GAGATAAATAACATAGAGTTTGG - Intergenic
935836275 2:107058048-107058070 AAGAATAATACAATGGACTTTGG - Intergenic
936387341 2:112042010-112042032 CAGAATCAGAACATGGAGATTGG - Intergenic
937712550 2:124995071-124995093 AAGAATTTAAACATGGAGTTTGG + Intergenic
938691470 2:133793717-133793739 CAAAATTATAACATAGTGTTGGG - Intergenic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939434078 2:142150875-142150897 AATAATAATAATATTGAGTTTGG - Intergenic
939635574 2:144578421-144578443 CAGGATGATAACAAGGTGTTAGG + Intergenic
939873689 2:147552767-147552789 CATTATCATTACATGGAGTTAGG + Intergenic
939919588 2:148092632-148092654 AAGAATAATATAATGGACTTTGG + Intronic
940593605 2:155762503-155762525 CATGATAAAAACATGTAGTTTGG - Intergenic
941159044 2:162014882-162014904 CAGAATTCTAAAATAGAGTTGGG - Intronic
942240296 2:173957513-173957535 CTAAATAATAATATGCAGTTTGG + Intronic
942376426 2:175342783-175342805 CAAAATAATAACATTGAGCCAGG - Intergenic
942580457 2:177411439-177411461 CAGAATCAGAACATGGAGATTGG - Intronic
942816456 2:180059141-180059163 CAAAATCAGAACATGGAGATTGG + Intergenic
942830766 2:180235777-180235799 CAGAATCAGAACATGGAGATTGG + Intergenic
942996329 2:182265073-182265095 CTGAATAATATAATGGACTTTGG + Intronic
943051473 2:182918651-182918673 CAGAGTGATATCATGGACTTTGG + Intronic
943094281 2:183410003-183410025 CAGAACATTAACAGGGAGGTTGG - Intergenic
943277550 2:185886929-185886951 TGTAATAATAACATAGAGTTAGG + Intergenic
943890816 2:193284636-193284658 AAGAATAATACAATGGACTTTGG - Intergenic
944039378 2:195336848-195336870 CAGAATCAGAACATGGATATTGG - Intergenic
944667155 2:201967837-201967859 CAGACTGATAACCTGGTGTTGGG - Intergenic
944897759 2:204182762-204182784 AAGAATGATATAATGGAGTTTGG + Intergenic
945345755 2:208713479-208713501 CAGAATAATTGAATTGAGTTTGG - Intronic
945826300 2:214724193-214724215 AAGAATAATACAATGGACTTTGG + Intergenic
946631414 2:221673048-221673070 CTTAAAAATAACATGGAGTAGGG - Intergenic
947106307 2:226671399-226671421 CAGAATATTAACAAGCAGGTGGG + Intergenic
947677495 2:231996159-231996181 CAGAGTAATCCCATGGAATTGGG + Intronic
947879143 2:233489959-233489981 CAGAATTAGAACAAGCAGTTTGG - Intronic
1168897790 20:1335857-1335879 AAGAATAATATAATGGACTTTGG + Intronic
1169310316 20:4532683-4532705 CAGTATAAAAACATGAAATTTGG + Intergenic
1169584614 20:7067274-7067296 AAGAATGATACCATGGACTTTGG + Intergenic
1169680752 20:8210388-8210410 CAGATTAATAAAATGGCTTTTGG - Intronic
1170270990 20:14527118-14527140 CAGCAGAACGACATGGAGTTTGG - Intronic
1170350437 20:15434988-15435010 AAGAATGATATCATGGACTTTGG + Intronic
1171378386 20:24711888-24711910 AAGAATAATACAATGGACTTTGG - Intergenic
1173309648 20:41886051-41886073 AAGAATAATATAATGGACTTTGG + Intergenic
1173531844 20:43775695-43775717 CAGAAACAGTACATGGAGTTTGG + Intergenic
1174590060 20:51637880-51637902 AAGAATAATACAATGGACTTTGG - Intronic
1174816668 20:53693041-53693063 AAGAATGATATCATGGACTTTGG + Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175474317 20:59259569-59259591 TAGACTAATAACATTGTGTTGGG - Intergenic
1176004742 20:62854659-62854681 CAGAATATTAACAGAGTGTTGGG - Intronic
1177039170 21:16085029-16085051 AAGGAAAATAACATGGAATTTGG - Intergenic
1177205670 21:18007880-18007902 TAGAATCTTAATATGGAGTTTGG + Intronic
1177523592 21:22263993-22264015 CAAACAAAAAACATGGAGTTTGG + Intergenic
1177896223 21:26858188-26858210 CAGAATCAGAACATGGACATTGG + Intergenic
1178080619 21:29060274-29060296 TATAATACTAACATGGAATTTGG - Intronic
1179128691 21:38614835-38614857 CAGAATAATACCTTGGCCTTGGG - Intronic
1179259164 21:39743144-39743166 CAGAATCAGAACATGGAGATTGG - Intergenic
1179388327 21:40963380-40963402 AAGAATGATATCATGGACTTTGG + Intergenic
1180251226 21:46591210-46591232 AAGAATAATATAATGGACTTTGG + Intergenic
1180904517 22:19399555-19399577 CAGAGTAATAATCTGGAGTATGG - Intronic
1181050445 22:20235838-20235860 CAGCAGAATGACCTGGAGTTTGG + Intergenic
1181761759 22:25063526-25063548 AAGAATGATATCATGGAATTTGG + Intronic
1182928464 22:34150314-34150336 AAGAATGATATCATGGATTTGGG - Intergenic
1185295480 22:50051214-50051236 AAGAATGATAAGATAGAGTTTGG - Intronic
949727321 3:7064258-7064280 AAGAATAATACAATGGACTTTGG - Intronic
950192618 3:10988258-10988280 CAGAATAACAAAATGAACTTAGG + Intergenic
951147857 3:19251047-19251069 CAAAATTACAAAATGGAGTTGGG + Intronic
951198790 3:19854980-19855002 AAGAATTATATAATGGAGTTGGG + Intergenic
951200717 3:19873296-19873318 CAGAATCAGAACATGGAGATTGG - Intergenic
951350315 3:21599549-21599571 CATAGTATAAACATGGAGTTTGG + Intronic
951468274 3:23026520-23026542 AAGAATGATAAAATGGACTTTGG + Intergenic
951837837 3:27002407-27002429 CAGAATCGGAACATGGAGATTGG + Intergenic
952239888 3:31520648-31520670 CAGAGTAATATAATGGACTTTGG + Intergenic
952329018 3:32346794-32346816 AAGAATTATAACATGGAGAAAGG - Intronic
952698108 3:36294261-36294283 CAAAATAATAACAAGAAGATAGG + Intergenic
952922260 3:38293728-38293750 CAGAATCAGAACATGGAAATTGG - Intronic
953192903 3:40705264-40705286 AAGAATAATACAATGGACTTTGG + Intergenic
955490637 3:59478575-59478597 AAGAATAATACAATGGACTTTGG - Intergenic
955526175 3:59821973-59821995 AAGAATAATACAATGGACTTTGG - Intronic
955853672 3:63249516-63249538 AAGAATAATACAATGGACTTTGG + Intronic
955859584 3:63313387-63313409 AAGAATAATACAATGGATTTTGG - Intronic
956428801 3:69164132-69164154 CAAAACAATAAAAAGGAGTTGGG - Intergenic
956778598 3:72587070-72587092 CAGCACAACAACATGGAGTTTGG + Intergenic
956899192 3:73696529-73696551 CAAAATAATAGCATGGTATTTGG - Intergenic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957516295 3:81256889-81256911 CATAATAATAACATGCATTTAGG + Intergenic
957772562 3:84713368-84713390 CAGAATGATACAATGGACTTTGG + Intergenic
957885342 3:86281070-86281092 AAGAATAATATAATGGACTTTGG + Intergenic
958016294 3:87943103-87943125 CAGAATCAGAACATGGAGATTGG - Intergenic
958419545 3:93914848-93914870 AAGAATAATACAATGGACTTTGG - Intronic
958629834 3:96671147-96671169 CAGAATCAGAACATGGAGATAGG - Intergenic
960857085 3:122113026-122113048 AAGAATAATATAATGGACTTTGG - Intronic
961095943 3:124156774-124156796 TAAAACAATGACATGGAGTTAGG + Intronic
961348676 3:126283590-126283612 CAGTATAGTAACATGCAGTATGG - Intergenic
961350422 3:126297621-126297643 AAGAATAATACGATGGACTTTGG - Intergenic
962115028 3:132496023-132496045 CAGTTTAAGAGCATGGAGTTAGG + Intronic
962381626 3:134902980-134903002 CAGATAATGAACATGGAGTTAGG + Intronic
963187915 3:142439377-142439399 CAGAATCAGAACATGGAGATTGG + Intronic
963505131 3:146175381-146175403 AATAATAACAACTTGGAGTTAGG - Intergenic
963915735 3:150857456-150857478 CAAAATCAGAACATGGAGATTGG + Intergenic
963996219 3:151712218-151712240 GAGAATAATACAATGGACTTTGG + Intergenic
964115113 3:153128319-153128341 AAGAATGATAAAATGGACTTTGG - Intergenic
964461854 3:156940647-156940669 AACATTACTAACATGGAGTTAGG - Intronic
964953397 3:162324478-162324500 CAGATTCAGAACATGGAGATTGG + Intergenic
965052269 3:163665909-163665931 AAGAATAATACAATGGACTTTGG - Intergenic
965054827 3:163698800-163698822 CAGAATCAGAACATGGAGATTGG - Intergenic
965119540 3:164535255-164535277 CACAATAATCACATGGTCTTTGG - Intergenic
965291347 3:166885840-166885862 CAGAGTAATATAATGGATTTTGG + Intergenic
965372600 3:167882343-167882365 GTAAATAATAACATGGAGGTGGG + Intergenic
965671149 3:171149321-171149343 CTGAAAAAAAACCTGGAGTTAGG - Intronic
965825124 3:172722319-172722341 CAGAATCAGAACACGGAGATTGG + Intergenic
965874993 3:173305804-173305826 AATAATAATAACCTGGAGGTTGG - Intergenic
966353466 3:179055946-179055968 CAGAATCAGAACATGGAGATTGG + Intronic
966467070 3:180241639-180241661 AAGAATGATACCATGGACTTTGG - Intergenic
966578322 3:181528995-181529017 AAGAATGATAAGATGGACTTTGG + Intergenic
967357883 3:188593617-188593639 AAGAATGATACAATGGAGTTTGG - Intronic
967491815 3:190100682-190100704 GAGAATAATAGCATGAAATTGGG - Intronic
967505459 3:190247981-190248003 CAGAATAATACAATGGACTGTGG - Intergenic
967623531 3:191661709-191661731 CAGAATCAGAACATGGAGATTGG + Intergenic
968391209 4:194416-194438 CAGAATCAGAACATGGAGATTGG - Intergenic
969196981 4:5570961-5570983 AAGAATGATAAAATGGACTTTGG + Intronic
970215454 4:13754563-13754585 AAGAATAATACGATGGACTTTGG - Intergenic
971080597 4:23206069-23206091 AAGAATAATATAATGGACTTTGG - Intergenic
971296602 4:25399304-25399326 CAGTATGATAAGATGCAGTTCGG + Intronic
971330806 4:25679969-25679991 CAAAATAATAACATGTTGGTTGG + Intergenic
971459552 4:26879977-26879999 AAGAATGATAACAAGAAGTTAGG - Intronic
971509220 4:27403433-27403455 AAGAATAATACAATGGACTTTGG + Intergenic
971513188 4:27453340-27453362 AAGAATAATACAATGGACTTTGG - Intergenic
971926859 4:33022538-33022560 CAGGAGAATCACTTGGAGTTAGG - Intergenic
972243351 4:37218086-37218108 GAGAATATTAACAAGGAGTCTGG - Intergenic
972370385 4:38418258-38418280 CAGAATATTTACATGTAGTAAGG - Intergenic
972781378 4:42289656-42289678 CAGAATCAGAACATGGAGATTGG - Intergenic
972840684 4:42927020-42927042 CAGAATAATAATAATGATTTGGG - Intronic
973695057 4:53482669-53482691 CAGAGTAATATAATGGACTTTGG + Intronic
973752861 4:54040907-54040929 CAGAATAAAAACAAGGTCTTGGG + Intronic
974520435 4:62975129-62975151 CAGAATCAGAACATGGAGATTGG + Intergenic
975099856 4:70500655-70500677 AAGACTAATATCATGGACTTTGG + Intergenic
975313849 4:72930413-72930435 CAGAATCAGAACATGGAGATTGG - Intergenic
975494631 4:75024294-75024316 CTGATTAATGACATGGAGTAAGG + Intronic
975591852 4:76008948-76008970 AAGAATGATACAATGGAGTTTGG + Intergenic
975616152 4:76249715-76249737 AAGAATGATAAAATGGACTTTGG - Intronic
975901374 4:79157276-79157298 CAGAATGATACAATGGACTTTGG - Intergenic
975915599 4:79321969-79321991 CTGAATGATACCATGGAGTAGGG + Intronic
976189810 4:82477136-82477158 CAGAATCAGAACATGGAGATTGG + Intergenic
976445281 4:85123911-85123933 AAGAATAATACAATGGACTTTGG - Intergenic
976464745 4:85354489-85354511 CAGAATCAGAACATGGAGATTGG - Intergenic
976738312 4:88333157-88333179 GAGAATAATACAATGGACTTTGG + Intergenic
977068118 4:92345060-92345082 AAGAATAATATAATGGACTTTGG - Intronic
977521436 4:98089227-98089249 AAGAATAATATAATGGACTTTGG - Intronic
977552344 4:98455867-98455889 AAGAATAATACAATGGACTTTGG + Intergenic
978058502 4:104305802-104305824 AAGAATAATACAATGGACTTTGG - Intergenic
978199404 4:106007680-106007702 AAGAATAATACTATGGACTTTGG - Intergenic
978381851 4:108137231-108137253 AAGAATAATACAATGGACTTTGG + Intronic
978382762 4:108147203-108147225 AAAAATACTGACATGGAGTTAGG - Intronic
978538045 4:109784001-109784023 AAGAATAATAAAATGAACTTTGG + Intronic
978586835 4:110283074-110283096 CAGAATCAGAACATGGAGATTGG - Intergenic
978759430 4:112339999-112340021 CAGAATGGTAACTTGGATTTCGG + Intronic
979420930 4:120504078-120504100 CAAATTTATAAAATGGAGTTTGG + Intergenic
979871256 4:125825232-125825254 CAAAATAAGACCATGAAGTTTGG - Intergenic
981030809 4:140123788-140123810 CTGAATAATAAAATGAAGTTGGG + Intronic
981614353 4:146631497-146631519 GAGAATAAAAACATGCAGGTGGG + Intergenic
982298347 4:153853252-153853274 AAGAATAATACAATGGACTTTGG - Intergenic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
983729328 4:170973794-170973816 AAGAATAATACAATGGACTTTGG - Intergenic
984488238 4:180400053-180400075 TATAATAATAACCTGTAGTTTGG + Intergenic
984640016 4:182153528-182153550 CAGAATGAGAAAATGGACTTCGG - Intronic
984723719 4:183000511-183000533 CAGAATCAGAACATGGTGATTGG + Intergenic
986191350 5:5498880-5498902 CAGAATAACAAAATGCAGTGCGG - Intergenic
986490261 5:8282094-8282116 AAGAATGATAAGATGGACTTTGG + Intergenic
986519946 5:8604651-8604673 CAGAATAATGACATAGCATTTGG + Intergenic
986537719 5:8808893-8808915 AAGAATAATACAATGGACTTTGG - Intergenic
988017837 5:25582386-25582408 CAGAATTATATAATGGACTTTGG - Intergenic
988173961 5:27696393-27696415 CAGAATGATACAATGGACTTTGG + Intergenic
988355330 5:30166427-30166449 AAGAATAATACGATGGACTTTGG - Intergenic
988457125 5:31396274-31396296 TAGAATCAGAACATGGAGATTGG - Intergenic
988957206 5:36331736-36331758 CAGGATCAGAACATGGAGATTGG - Intergenic
989351673 5:40493830-40493852 AAGAATAATACAATGGACTTTGG - Intergenic
989666714 5:43862871-43862893 GAGAAAAATAAAATGGATTTTGG + Intergenic
989689771 5:44127302-44127324 AAGAATAATACCATGGACTTTGG + Intergenic
990892216 5:60661838-60661860 CAGAATCAGAACATGGAGATTGG + Intronic
991547671 5:67801388-67801410 GAGAATAGTAACATGGGCTTTGG + Intergenic
992523803 5:77585790-77585812 AAGAATGATACCATGGACTTTGG + Intronic
993110264 5:83648454-83648476 CAGAATAAATATATGTAGTTTGG + Intronic
994065788 5:95540282-95540304 AAGAATAATACAATGGACTTCGG + Intronic
994213363 5:97109766-97109788 AAGAATAATATAATGGACTTTGG - Intronic
994330210 5:98496221-98496243 AAGAATGATAAAATGGACTTTGG + Intergenic
994478857 5:100307349-100307371 TAGAATAATATTATTGAGTTTGG + Intergenic
994644595 5:102452349-102452371 AAGAATAAAAACATAAAGTTTGG - Intronic
994686127 5:102954325-102954347 AAGAATGATAAAATGGACTTTGG - Intronic
994823689 5:104685013-104685035 AAGAATGATAAAATGGACTTTGG + Intergenic
995134471 5:108665998-108666020 AAGAATGATACCATGGACTTTGG - Intergenic
995465612 5:112447170-112447192 CAGAATCAGAACATGGAGATTGG + Intergenic
995853493 5:116571572-116571594 CAAAATAATAACAGGGAGTAAGG + Intronic
995987422 5:118195500-118195522 CAGATTATTAAAATAGAGTTGGG + Intergenic
996110616 5:119562321-119562343 AAGAATAATATAATGGACTTTGG + Intronic
996111804 5:119574329-119574351 CAGAGTAATATAATGGACTTTGG - Intronic
997761391 5:136451614-136451636 AAGAATAACAAAATGGACTTTGG + Intergenic
998145210 5:139723879-139723901 AAGAATATCAACATGGAGTCTGG - Intergenic
998804986 5:145909627-145909649 CAGAATATAAGCATGGACTTTGG + Intergenic
998908366 5:146931274-146931296 CAGAAGAATAACAAGCAGATTGG - Intronic
999819278 5:155209287-155209309 AAGAATAATACAATGGACTTTGG + Intergenic
1000104306 5:158044388-158044410 AAGAATAATACAATGGACTTTGG + Intergenic
1000765143 5:165279390-165279412 CTGAATTATAACTTGAAGTTTGG - Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1003001251 6:2335918-2335940 AAGAATAATACAATGGACTTAGG + Intergenic
1003131208 6:3396718-3396740 CAGCAGAATGACATGGAATTTGG + Intronic
1003172150 6:3728293-3728315 AAGAATGATATCATGGACTTTGG - Intronic
1003556132 6:7141628-7141650 CAGAATAAAAACATGTAGCAGGG + Intronic
1003655591 6:8004245-8004267 AAGAATGATATCATGGATTTTGG - Intronic
1003759073 6:9154377-9154399 CACAAAAATAACATAGAGTAAGG + Intergenic
1004236789 6:13881488-13881510 CAGAATCAGAACATGGAGATTGG + Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1004995117 6:21183788-21183810 CAGATTAATAACCTGGCTTTTGG - Intronic
1005323696 6:24679585-24679607 CAGAATCAGAACATGGAAATTGG - Intronic
1006231588 6:32592239-32592261 GAGAGTAATAGAATGGAGTTAGG - Intergenic
1006298888 6:33182849-33182871 CAAAATAAGAACATGGAGAATGG + Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007197072 6:40071563-40071585 AAGAATGATACCATGGACTTTGG - Intergenic
1007405741 6:41635247-41635269 TAGAATAATAAAATGGTGTTGGG + Intergenic
1008136241 6:47780444-47780466 CAGAATCATAAGATGAAGGTTGG - Intergenic
1008582402 6:52918852-52918874 CAGATTCAGAACATGGAGATTGG - Intergenic
1009322537 6:62310062-62310084 AAGAATAATACAATGGATTTTGG + Intergenic
1009522908 6:64707311-64707333 AAGAATAATACAATGGACTTTGG + Intronic
1009544749 6:65008090-65008112 CAGACTCAGAACATGGAGATTGG + Intronic
1009709980 6:67305561-67305583 CAGATAAATAGAATGGAGTTGGG + Intergenic
1010893470 6:81340488-81340510 CAGAATCAGAACGTGGAGATTGG + Intergenic
1011076745 6:83446530-83446552 CAGAATCAGAACATGTAGATTGG + Intergenic
1011189809 6:84717115-84717137 CAGAATCAGAACATGGAGATTGG - Intronic
1011539893 6:88418043-88418065 CAGAATCAGAACATGGAGATTGG - Intergenic
1012027790 6:94019928-94019950 AAGAATAACAAAATGGACTTTGG - Intergenic
1012293179 6:97484295-97484317 AAGAATGATATCATGGACTTTGG - Intergenic
1012367294 6:98457696-98457718 CAGTATGATAACAGGGAGCTTGG + Intergenic
1012391504 6:98746312-98746334 AAGAATAATATGATGGACTTCGG + Intergenic
1012579435 6:100848469-100848491 CAGAAAAAGAACATGGCGATAGG - Exonic
1013022209 6:106231461-106231483 CAGAATCAGAACATGGAGATTGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1014506084 6:122258799-122258821 CAGAATAATAGAATGGAAATAGG - Intergenic
1014792268 6:125686777-125686799 AAGAATGATATCATGGACTTTGG - Intergenic
1016109567 6:140205989-140206011 CAGCAGAACAACGTGGAGTTTGG + Intergenic
1016180603 6:141142988-141143010 CAGAATGATAGAATGGACTTTGG - Intergenic
1016343284 6:143084837-143084859 CAGAATCAGAACATGGAGATTGG - Intronic
1016351264 6:143171214-143171236 AAGAATGATAAAATGGACTTTGG - Intronic
1016408628 6:143758367-143758389 CAGTATAATACCATGAAGTATGG - Intronic
1016444749 6:144120200-144120222 CAGAATCAGAACATGGAGATTGG - Intergenic
1016822040 6:148356048-148356070 CAGAATGATACAATGGACTTTGG - Intronic
1018248320 6:161843183-161843205 CAGGATAATAATATAGAGTTTGG - Intronic
1018687485 6:166315270-166315292 CAGAATCAGAACATGGAGATTGG + Intergenic
1018761015 6:166894392-166894414 CAGAATCAGAACATGGAGATTGG + Intronic
1020508080 7:9018775-9018797 CAGAAGCAGAACATGGAGATTGG + Intergenic
1020991912 7:15208529-15208551 CAGAAAAATAACAAGGCATTTGG + Intronic
1021466496 7:20949968-20949990 CAGAATGATATAATGGACTTTGG + Intergenic
1021682515 7:23148621-23148643 CAGAAAAATAACACACAGTTTGG - Intronic
1022425481 7:30264898-30264920 AAGAATGATAAAATGGACTTTGG - Intergenic
1022513758 7:30962322-30962344 CAAAATAAAAACTAGGAGTTAGG - Intronic
1022759588 7:33333235-33333257 AAGAATGATGACATGGACTTTGG - Intronic
1023439326 7:40170102-40170124 CAGAATCAGAACATGGAGATTGG - Intronic
1023973271 7:45007672-45007694 CATAATAGGAACATGGAATTTGG + Intronic
1024160167 7:46665967-46665989 AAGAATGATAAAATGGACTTTGG - Intergenic
1024181460 7:46899611-46899633 GAGAATAAAAACAGGGAATTCGG - Intergenic
1024267670 7:47619230-47619252 CAGCAGAACAACAGGGAGTTTGG + Intergenic
1024776685 7:52795862-52795884 CAGAATGATATAATGGACTTTGG + Intergenic
1024894077 7:54237002-54237024 CAGAATGATAAAATGGACTTTGG + Intergenic
1025254694 7:57376026-57376048 AGGATTAATGACATGGAGTTGGG + Intergenic
1026272520 7:68849145-68849167 CAGAACAAGAACTTGGACTTAGG - Intergenic
1027521461 7:79214191-79214213 AAGAACAATAAAATGCAGTTTGG - Intronic
1027699705 7:81454734-81454756 AAGAATGATAAAATGGACTTTGG + Intergenic
1028529178 7:91819166-91819188 AAGAATAATATAATGGACTTTGG - Intronic
1028588616 7:92474510-92474532 CAGAATCAGAACATGGAGATTGG - Intronic
1030337263 7:108340610-108340632 CAGAATCAAAACACGGAGATTGG + Intronic
1030493882 7:110272962-110272984 TAGAATAACAACATTGAGGTTGG - Intergenic
1030843522 7:114382958-114382980 CAGAATCAGAACATGGAGATTGG - Intronic
1031043326 7:116861721-116861743 AAGAATGATAAAATGGACTTTGG - Intronic
1031232019 7:119119849-119119871 AAGAATGATAAAATGGAATTTGG - Intergenic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1031357988 7:120811867-120811889 AAGAATAATACAATGGACTTTGG + Intronic
1031471494 7:122173788-122173810 CAGAATCAGAACATGGAGATTGG + Intergenic
1031644841 7:124211722-124211744 TAGAATCATACCATGGACTTTGG + Intergenic
1032426121 7:131823486-131823508 CAGAATCAGAACATGGAGATTGG - Intergenic
1032511669 7:132477449-132477471 CAGATAAATAACATGGAGCAGGG + Intronic
1032677187 7:134141920-134141942 CAGAAAAATAACATAGAAATTGG + Intronic
1032806281 7:135357966-135357988 GAGAAGAATAGCATGGAGTTGGG - Intergenic
1032876424 7:136043450-136043472 AAGGATGATAACATGGATTTTGG - Intergenic
1032905772 7:136363132-136363154 CAAAATGATAAAATGGACTTTGG - Intergenic
1033778763 7:144644687-144644709 CAGAAAATTAACATGGTGGTAGG + Intronic
1033784426 7:144713667-144713689 CAGAATGATAACACTGAATTGGG + Intronic
1033948336 7:146751056-146751078 TATAATAATAAAATGGTGTTTGG + Intronic
1034189541 7:149203281-149203303 CAGAATAATGAAATGGTTTTGGG + Intronic
1034249162 7:149674542-149674564 CAGAATCAGAACACGGAGATTGG + Intergenic
1034584630 7:152078292-152078314 CAGAAGAATCACTTGGATTTGGG - Intronic
1037337961 8:17810040-17810062 CAGAACAATAACAAGTAGTGAGG + Intergenic
1037570967 8:20157435-20157457 CAGAATCACAACATGGAGATTGG + Intronic
1037713287 8:21373120-21373142 CAGAATGATACAATGGACTTCGG - Intergenic
1038764254 8:30412903-30412925 CAGTATAATGACATCGATTTAGG + Intronic
1039555904 8:38474721-38474743 CAGAATAATAAAATTCAGTTAGG - Intergenic
1040960744 8:53029764-53029786 CAGAATGATATAATGGAATTTGG - Intergenic
1041663899 8:60424155-60424177 CAGAATCAGAACATGGAGATTGG - Intergenic
1041956893 8:63566149-63566171 CAGAAAACTAACAGGAAGTTGGG - Intergenic
1042056080 8:64766140-64766162 CAGAATCAGAACATGGAGATTGG + Intronic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1043332198 8:79131272-79131294 CACAGCAAGAACATGGAGTTTGG - Intergenic
1043612409 8:82081208-82081230 CATAATAATAACTTTGAGGTAGG + Intergenic
1043638591 8:82419142-82419164 AAGAATAATATAATGGACTTTGG + Intergenic
1043979483 8:86621660-86621682 AAGAATAATATAATGGACTTTGG - Intronic
1046476212 8:114747477-114747499 CATAGTAATAACATAGAATTTGG + Intergenic
1046716715 8:117576026-117576048 AAGAATAATATAATGGACTTTGG + Intergenic
1046755858 8:117972193-117972215 CAGAAAAATGAAATGGAATTGGG + Intronic
1046789832 8:118309166-118309188 AAGAATAATACAATGGACTTTGG - Intronic
1047298352 8:123590795-123590817 AAGAAAAAAAACATGGGGTTTGG - Intergenic
1047443909 8:124902808-124902830 CAGAATCAGAACCTGGAGATTGG - Intergenic
1047913187 8:129553607-129553629 AAGAATAATACAATGGACTTTGG + Intergenic
1048040121 8:130719426-130719448 AAGAATGATACAATGGAGTTTGG + Intergenic
1048075861 8:131070373-131070395 CAGAATAATGACAAGGAGAATGG + Intergenic
1048262629 8:132957962-132957984 AAGAATAATACAATGGACTTTGG - Intronic
1048287826 8:133155459-133155481 CAGAATAAGAATATGGGCTTTGG + Intergenic
1050288535 9:4129744-4129766 CAGACTAATACCAAGGAGTGGGG + Intronic
1050823053 9:9907154-9907176 CAAAACAAAAACCTGGAGTTTGG - Intronic
1051363173 9:16300396-16300418 CAGAATGATACAATGGACTTTGG + Intergenic
1051700702 9:19820252-19820274 AAGAATGATACAATGGAGTTTGG + Intergenic
1052344360 9:27393845-27393867 TAGCAAAATGACATGGAGTTTGG - Intronic
1052529022 9:29657454-29657476 CAGAATCAGAACACGGAGATTGG - Intergenic
1052538546 9:29777888-29777910 CAGAATCAGAATATGGAGATTGG - Intergenic
1052690418 9:31809371-31809393 CAGTGGAATTACATGGAGTTTGG - Intergenic
1052732814 9:32309654-32309676 CAGAATGATATAATGGACTTTGG + Intergenic
1055942526 9:81663987-81664009 GAGAATATTAAAGTGGAGTTTGG - Intronic
1055969505 9:81897942-81897964 CAGAATGATATAATGGACTTTGG + Intergenic
1056673821 9:88655933-88655955 CAGAATAATATAATGGACTTTGG + Intergenic
1056698548 9:88881358-88881380 AAGAATGATACCATGGACTTTGG - Intergenic
1056704726 9:88942211-88942233 CAGAATCAGAACACGGAGATTGG - Intergenic
1056725338 9:89109386-89109408 CAGAATACATACATAGAGTTGGG + Intronic
1058631037 9:106986789-106986811 AAGAATAATACAATGGACTTTGG - Intronic
1059612317 9:115911849-115911871 CAGAATATCAAAATGGAGCTTGG - Intergenic
1059808537 9:117830562-117830584 CAGAAGAATAGCATTCAGTTAGG + Intergenic
1060066882 9:120510079-120510101 CAGAATCAAAACATGGCATTTGG - Intronic
1060302999 9:122386793-122386815 CAGAAGAAGAACCTGGAATTTGG - Intronic
1185713409 X:2322145-2322167 AAGAATGATAAAATGGAATTTGG - Intronic
1186364577 X:8877870-8877892 GAGAATAATATAATGGACTTTGG - Intergenic
1186448000 X:9648312-9648334 TGGACAAATAACATGGAGTTTGG - Intronic
1187264078 X:17715200-17715222 CAGAGTGATATAATGGAGTTTGG - Intronic
1187432201 X:19235329-19235351 AAGAATGATATCATGGACTTTGG - Intergenic
1187710948 X:22053804-22053826 CAGAACAATAAGATGAAGTAGGG + Intronic
1188630805 X:32357582-32357604 CTGAATAATGACATGAAGTTCGG - Intronic
1188699652 X:33242283-33242305 AAGAATAATACAATGGACTTTGG - Intronic
1188794483 X:34444934-34444956 AAGAATAATAAAATGGACTTTGG + Intergenic
1188799269 X:34506970-34506992 AAGAATGATACCATGGACTTTGG - Intergenic
1189544751 X:42029820-42029842 AAGAATGATACCATGGACTTTGG - Intergenic
1189905480 X:45754871-45754893 CAGAATGATACAATGGACTTTGG + Intergenic
1190926733 X:54915783-54915805 AAGAATAATACAATGGACTTTGG + Intergenic
1191167119 X:57402781-57402803 CAGAATCAGAACATGGAGATTGG - Intronic
1191819292 X:65285293-65285315 GAGAATGATACCATGGACTTTGG - Intergenic
1192021224 X:67393708-67393730 GAGAAAAATAAAATGGACTTTGG - Intergenic
1192309118 X:69995123-69995145 CAGAATATTAGCAGGGATTTTGG - Intronic
1192852771 X:74975327-74975349 AAGAATGATAAAATGGACTTTGG - Intergenic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1192944602 X:75951604-75951626 AAGAATAATACCATGGGCTTTGG - Intergenic
1193007010 X:76631196-76631218 AAGAATGATAAAATGGACTTTGG - Intergenic
1193066402 X:77264991-77265013 CAGAAGGAAAATATGGAGTTGGG + Intergenic
1193088004 X:77464871-77464893 AAGAATAATACCATGGACTTTGG + Intergenic
1193171998 X:78347607-78347629 CAGAATCAGAACATGGAGATTGG - Intergenic
1193303484 X:79921207-79921229 AAGAATAATATAATGGATTTTGG - Intergenic
1193306681 X:79959240-79959262 CAGAATCAGAACATGGAGATTGG + Intergenic
1193416397 X:81229619-81229641 CAGCAGAACGACATGGAGTTTGG - Intronic
1193503108 X:82304651-82304673 AAGAATGATAAGATGGATTTTGG + Intergenic
1193607676 X:83588563-83588585 CAGCAGAATGAGATGGAGTTTGG - Intergenic
1193638231 X:83979610-83979632 AAGAATAATATAATGGATTTTGG + Intergenic
1193680758 X:84516307-84516329 AAGAATAACAAAATGGACTTCGG - Intergenic
1193694986 X:84697375-84697397 AAGAATAATATAATGGACTTTGG - Intergenic
1193913045 X:87328351-87328373 CAGAAAAATCAGGTGGAGTTGGG - Intergenic
1194411896 X:93567780-93567802 AAGAATAATGAAATGGAATTTGG - Intergenic
1194416165 X:93615050-93615072 CAGAGGAATAACAGGGAGTCTGG + Intergenic
1194482965 X:94449688-94449710 TAGAATGATATCATGGACTTTGG + Intergenic
1194499570 X:94663755-94663777 AAGAATAATACAATGGACTTTGG - Intergenic
1194544934 X:95221567-95221589 AAGAATAATACCTTGGACTTTGG + Intergenic
1194917979 X:99728103-99728125 AAGAATGATAAAATGGACTTTGG + Intergenic
1194967821 X:100309349-100309371 AAGAATAATACAATGGACTTTGG + Intronic
1195492978 X:105494934-105494956 CAAAGTAGTAACTTGGAGTTTGG + Intronic
1195984711 X:110616165-110616187 AAGAATAATACAATGGACTTTGG - Intergenic
1196155770 X:112427946-112427968 GAGAATAATATAATGGACTTCGG - Intergenic
1196196465 X:112842063-112842085 TAGCAAAATAACATGGAATTTGG + Intergenic
1196413187 X:115442013-115442035 AAGAATAATACAATGGACTTTGG - Intergenic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1197047160 X:122011317-122011339 AAGAATAATATGATGGACTTTGG + Intergenic
1197343406 X:125301706-125301728 TAGAATAAAGACATGGAGGTAGG - Intergenic
1197496968 X:127196188-127196210 AAGAATAATATAATGGACTTTGG + Intergenic
1197589368 X:128389876-128389898 AAGAATGATACCATGGACTTTGG + Intergenic
1197759495 X:130017593-130017615 CTGAAGAAGAACATGGACTTTGG - Intronic
1198836354 X:140808838-140808860 AAGAATAATATAATGGACTTTGG - Intergenic
1198894562 X:141438354-141438376 AAGAATAATACAATGGACTTTGG - Intergenic
1199915944 X:152341048-152341070 CAGAGTGATAAAATGGACTTTGG - Intronic
1199965458 X:152816780-152816802 CAGAATGATACAATGGACTTTGG - Intergenic
1200171315 X:154077606-154077628 CAGAATGATACAATGGACTTTGG + Intronic
1200317614 X:155150008-155150030 CAGAATGATACAATGGACTTTGG - Intergenic
1201461383 Y:14229117-14229139 AAGAATGATAAAATGGACTTTGG - Intergenic
1201481940 Y:14449171-14449193 CAGAAGAATAACATTGCTTTTGG + Intergenic
1201907443 Y:19100222-19100244 AAGAATGAAAACATGGAGGTAGG - Intergenic
1202274499 Y:23101682-23101704 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202291528 Y:23319004-23319026 AAGAAAAATAAAATGGAGTTGGG - Intergenic
1202427492 Y:24735417-24735439 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202443299 Y:24934677-24934699 AAGAAAAATAAAATGGAGTTGGG - Intergenic