ID: 935224573

View in Genome Browser
Species Human (GRCh38)
Location 2:101042173-101042195
Sequence ATGTTGATGAGGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 605}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935224570_935224573 27 Left 935224570 2:101042123-101042145 CCAGGTCGGGTGCAGTGGCTCAT 0: 11
1: 176
2: 1326
3: 4272
4: 8947
Right 935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 56
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935224573 Original CRISPR ATGTTGATGAGGAGGAAAGA AGG Intronic
900545166 1:3224681-3224703 ATGATGAGGTGGAGGAATGAGGG + Intronic
902275024 1:15333315-15333337 AGGAAGATGAGGAGGAAGGATGG + Intronic
902550332 1:17215372-17215394 ATGATGATGATGATGAAAGAAGG - Intronic
902690073 1:18105626-18105648 ATGCTAGTGAGGAGGAAAGCAGG - Intergenic
903287338 1:22285395-22285417 ATGCTGATGAAGAGGAAGGTAGG + Intergenic
903501760 1:23804284-23804306 AAGGTGCTGAGGAGTAAAGAGGG - Intronic
904763836 1:32826338-32826360 ATGTTGAGAAGGGAGAAAGAGGG + Exonic
905114996 1:35630922-35630944 ATGTGGGTGAGGAGGAATGTGGG + Intronic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905345313 1:37307252-37307274 AAATTGGGGAGGAGGAAAGAAGG + Intergenic
905677417 1:39837384-39837406 AAGATGGTGGGGAGGAAAGATGG - Intergenic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907027211 1:51132186-51132208 ATGGTCATTTGGAGGAAAGAAGG - Intronic
907124131 1:52034127-52034149 AGGTTTAAGAGGAGGAATGAAGG - Intronic
907968611 1:59358388-59358410 TTGGTGATGGGGAGGAAAGGAGG + Intronic
909344644 1:74571549-74571571 ATGTTGCTGAGGAAGAAACCTGG - Exonic
909593766 1:77381255-77381277 ATGTTTATGAACTGGAAAGAGGG + Intronic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910160283 1:84265024-84265046 GTGGAGATGAGGAGGAAGGATGG + Intergenic
910395664 1:86791316-86791338 CTGTTGATGAGGAGGTAAATTGG + Intergenic
910560501 1:88584848-88584870 TTATTGATAAGAAGGAAAGAAGG - Intergenic
911134626 1:94426514-94426536 AAGGTGAGGAGGGGGAAAGAAGG - Intronic
911210985 1:95137685-95137707 AAGAAGAGGAGGAGGAAAGAAGG - Intronic
911429352 1:97764090-97764112 AAGTTGATAAAGAGGAAACAAGG + Intronic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
916276423 1:162998979-162999001 AGGTAGATGAGAAGGGAAGAAGG + Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
917972181 1:180215879-180215901 ATGTTCACGAGGAGGCCAGATGG + Intergenic
918189940 1:182164195-182164217 AAGTTTATGAGGGGAAAAGAAGG - Intergenic
918681103 1:187354715-187354737 GAGTTTATGAGGAGAAAAGAGGG + Intergenic
920216678 1:204366041-204366063 ATGATGGTGGGAAGGAAAGATGG + Intronic
921327321 1:213998809-213998831 AGGTTGAGGAGGAAGAAAAATGG + Intronic
921667689 1:217892364-217892386 ATGTTGATTAAGAAAAAAGAAGG + Intergenic
921988312 1:221336251-221336273 CTGTTTATGAGGAGGAAAAGAGG - Intergenic
922009764 1:221571193-221571215 GTGTTAAAGATGAGGAAAGAGGG - Intergenic
923554628 1:234990996-234991018 ATGGTGAGGAGGTGGCAAGAAGG - Intergenic
923568350 1:235093251-235093273 GAATTGATGAGGAGGAAACAAGG - Intergenic
924654964 1:245966108-245966130 ATTATGATGAAGAAGAAAGAAGG - Intronic
924693975 1:246381084-246381106 ATTTTGAGGAAGAGGAAAAATGG + Intronic
1062782425 10:226448-226470 ATATTAAAGAGGAGGAAATAGGG - Intronic
1062822781 10:547489-547511 ATGTTACAGAGGAGGAAAGCAGG + Intronic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063874286 10:10456294-10456316 ATTTTGATGAGAAGGTAAGCCGG - Intergenic
1064526262 10:16260001-16260023 AGGTGGAGGAGGAAGAAAGAGGG - Intergenic
1064647255 10:17472315-17472337 ATATTGAAGAGGTGAAAAGAGGG - Intergenic
1064786128 10:18897553-18897575 TTGTTGATTAGGTGGAAAAATGG - Intergenic
1065311108 10:24416727-24416749 AGGATGAAGAGGAGGGAAGATGG - Intronic
1065938845 10:30545762-30545784 ATGTGGCTGATGAGGAATGAGGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066449249 10:35512900-35512922 ATGATGAGGAGGAGGAAGCAGGG - Intronic
1067037907 10:42933059-42933081 ATGGTGACCAGGAGCAAAGACGG - Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067730005 10:48803727-48803749 ATGTAAAAGAGAAGGAAAGAAGG + Intronic
1068058090 10:52035531-52035553 AGGGTGAGGAAGAGGAAAGAAGG + Intronic
1068771507 10:60826532-60826554 ATCATGAGGAGGAGGAAAGGAGG - Intergenic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1069681170 10:70286480-70286502 ATGTGGCTGCTGAGGAAAGAAGG - Intergenic
1069850405 10:71400402-71400424 AAGGTGATGAGGAGGAACTATGG + Intronic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1070656239 10:78273503-78273525 GAGTTGATGAGGAGGAGGGAGGG - Intergenic
1070737874 10:78876883-78876905 ATGGGAATGAGGAGGAAGGAAGG - Intergenic
1071394158 10:85205244-85205266 ATGATAATGAGGAGGAGAAAGGG + Intergenic
1072743215 10:97922663-97922685 AACTGGATGGGGAGGAAAGACGG - Intronic
1073293856 10:102426551-102426573 ATGCAGATAAGAAGGAAAGAAGG - Intronic
1074270192 10:111945764-111945786 ATGTTCATTTGGAGGAGAGAGGG - Intergenic
1074499253 10:114008011-114008033 ATCCTCATGTGGAGGAAAGAGGG + Intergenic
1074649180 10:115500046-115500068 ATGTTTATGAAGAGAAAATAGGG + Intronic
1075492648 10:122885959-122885981 ATGAGGTTGAGGAGGCAAGAAGG - Intergenic
1075578179 10:123596200-123596222 ATGTTGAGGAAGAGGACAAAGGG + Intergenic
1076010919 10:126987505-126987527 ATGTTGCCTGGGAGGAAAGAAGG - Exonic
1076316271 10:129544182-129544204 GTTTTCATGAGGAGGAAACATGG + Intronic
1078769469 11:14334929-14334951 ATGTTGATGGAGGAGAAAGAAGG - Intronic
1079193899 11:18306980-18307002 AAGTTTCTGAGGAGGAATGATGG - Intronic
1079444333 11:20545816-20545838 AAGCAGAGGAGGAGGAAAGAGGG - Intergenic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1079878600 11:25893771-25893793 ATTTTGAGGTGGAGGGAAGAAGG + Intergenic
1080096453 11:28414087-28414109 AAGTTGGTGAGGATCAAAGAGGG + Intergenic
1080302317 11:30798282-30798304 ATTTTGAAGAGGATGAGAGAGGG + Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080593180 11:33741962-33741984 AAGATGATGAAGAGGAGAGACGG - Exonic
1080814906 11:35745913-35745935 ATGTTGATGAGGAAAAATAAAGG - Intronic
1080907171 11:36557619-36557641 AAGTTGAGGAGGAGCCAAGATGG - Intronic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1081532964 11:43976732-43976754 ATGGAGATGAGCAGGAATGAAGG - Intergenic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1081821732 11:46003657-46003679 ATGTAGAAGAGAAGTAAAGATGG + Intronic
1081884168 11:46480542-46480564 ATGTTGATCTAGAGCAAAGAAGG - Intronic
1082084205 11:48035849-48035871 ATCTTGAAGAGGAAGACAGAGGG - Intronic
1083058284 11:59844090-59844112 ATGTTTTTGAGAAGGAATGAGGG - Intronic
1083590676 11:63892138-63892160 AGGTTGATGAGGAAGAGAGAAGG + Intronic
1083967208 11:66050166-66050188 TGGTTGAGGAGGAGGAAATAGGG + Intergenic
1085103024 11:73817481-73817503 ATGTTGATGAGTATGTAAAAAGG - Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085536797 11:77226199-77226221 ATGGAGATGAGGAGGAAACATGG - Intronic
1086421166 11:86638883-86638905 ATTTTGATGAGGAGGCAAGTCGG - Intronic
1086669978 11:89534442-89534464 ATATTGAAGAGGAGGAGAGGTGG - Intergenic
1087762247 11:102112679-102112701 GGGTTAAGGAGGAGGAAAGAAGG + Intronic
1087786242 11:102357322-102357344 AGGAGGAGGAGGAGGAAAGAAGG - Intronic
1087820169 11:102702769-102702791 ATTTTGATGAGGATGAAAACTGG - Exonic
1087828797 11:102796680-102796702 ATTTTGATGAAGATGAAAGGTGG - Exonic
1087896612 11:103593369-103593391 AGGATGATGGAGAGGAAAGAGGG + Intergenic
1088059165 11:105624709-105624731 ATGTTTTTGGGGAGGAAAAAAGG - Intronic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1089640659 11:119845317-119845339 ATATTGAAGACCAGGAAAGAAGG + Intergenic
1089704029 11:120264494-120264516 AGGTAGAAGAGGAGGAGAGAAGG + Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1089778086 11:120853137-120853159 ATGTAGATGAGGTGTAAAGGGGG + Intronic
1090420425 11:126571570-126571592 GTTTTGATGAGGAATAAAGAAGG - Intronic
1090579934 11:128148649-128148671 ATGTTGATGGGAAGGAAGGAGGG - Intergenic
1091126267 11:133101568-133101590 ATGTTGATGAGGATGTGATATGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091315199 11:134609707-134609729 ATGCCGGGGAGGAGGAAAGAAGG + Intergenic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1091670677 12:2449990-2450012 AGGTGGATGAGAAGGAAACAGGG + Intronic
1092775801 12:11944236-11944258 ATGTTTATGAGGAGGCGATAAGG - Intergenic
1092929653 12:13303869-13303891 ATTTTGGTGAGGAAGAAAGGAGG + Intergenic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1095177513 12:39110310-39110332 ATGTTGGGGAGGAGGCAGGAGGG - Intergenic
1095754968 12:45754669-45754691 ATATAAATGAGGAGGAAAGTGGG - Intronic
1095891264 12:47236374-47236396 ATGTTCATAAAGAGGAAATAAGG - Exonic
1096096948 12:48941724-48941746 ATTTTGGTGTGGAAGAAAGATGG - Intronic
1096256791 12:50067259-50067281 ATGGTGATGATGGGGGAAGAAGG - Intronic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1097925680 12:65123210-65123232 ATTTTACTGACGAGGAAAGAGGG + Intergenic
1098188819 12:67926373-67926395 ATGTTGATGTGAGGGAAAGAGGG + Intergenic
1098569995 12:71977632-71977654 ATGTTGATGAGGGGAAAAATTGG - Intronic
1099154049 12:79152273-79152295 AATTTGATCAGGAGGAGAGAGGG + Intronic
1099354311 12:81614582-81614604 ATCTTGATGAGTAAGAAATAAGG - Intronic
1099649833 12:85411700-85411722 AAGTGGATGGGGAAGAAAGACGG + Intergenic
1100454193 12:94736259-94736281 ATGCTAATGAGGAAGAAAGGAGG - Intergenic
1100693818 12:97068192-97068214 ATGATGATGGGGAAAAAAGAGGG - Intergenic
1101441630 12:104708495-104708517 ATCCTGGTGAGGAGGAAACAAGG + Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1102047673 12:109840007-109840029 ATGATGGGGAGGAGGGAAGAGGG - Intergenic
1102092729 12:110206385-110206407 ATTGTGATGAGGAGCAAAGAAGG - Intronic
1102590618 12:113954138-113954160 ACCATGATGAGGAGGAAAAAGGG + Intronic
1103163356 12:118749600-118749622 AAGGTGATGAGGAGGAGAGGAGG - Intergenic
1103301397 12:119930260-119930282 ATGTTAATCAGGAGGGCAGATGG - Intergenic
1103479071 12:121239285-121239307 AAGTTGAGGGGGAGGAAAGCTGG - Exonic
1103566335 12:121817665-121817687 AGGTTGAGGAGGAGGAGAGCTGG - Intronic
1104351757 12:128050088-128050110 GTGTTGAAGAAGAGGAAACATGG - Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104616419 12:130273584-130273606 AGGAGGAGGAGGAGGAAAGAAGG - Intergenic
1105320562 13:19316886-19316908 AAATAGATGAGGAAGAAAGAAGG - Intergenic
1105565125 13:21538013-21538035 TTGTTGATGAGAAGGAGAGGTGG - Intronic
1105743126 13:23349760-23349782 ATGTTACTGATGAGGAAACAGGG + Intronic
1106320267 13:28631012-28631034 CTGTTCATGGGGAGGAAAGGGGG + Intergenic
1106360432 13:29026050-29026072 ATGTCATTGAGGAGGAAAGGCGG + Exonic
1107640408 13:42437309-42437331 ATGTTGCAGATGAAGAAAGAAGG + Intergenic
1107763628 13:43709597-43709619 AAGAAGATGAGGAGGAGAGAAGG + Intronic
1108292066 13:48971921-48971943 TTGGTGATGAAGAGGAGAGATGG - Intergenic
1108489707 13:50969255-50969277 ATGTGGATGAGAAGGAAGCAAGG - Intronic
1108501321 13:51072300-51072322 ATCTTGAGGAGAAGGAAGGAAGG - Intergenic
1108630363 13:52275642-52275664 ATGATGAGGAGGAGCCAAGATGG - Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109004387 13:56852631-56852653 ATGTTGAGGAGAAGGGAAGGAGG + Intergenic
1109786438 13:67181863-67181885 ATGTTGCTGAGGAGGCACGAGGG - Intronic
1109944836 13:69420168-69420190 TTGTGGATGATGAGGAGAGAAGG - Intergenic
1110351868 13:74518190-74518212 ATGATGGTGATGAAGAAAGAAGG - Intergenic
1110545488 13:76750692-76750714 ATGTCCTTGAGGAGGCAAGAAGG - Intergenic
1110650200 13:77934890-77934912 AGGTTGAGGAACAGGAAAGAAGG + Intergenic
1110744148 13:79033010-79033032 AAGTTGGTGAGTAGGACAGAAGG + Intergenic
1111331450 13:86764656-86764678 TTGTTGGGGAGGAGGAAAGCGGG + Intergenic
1111987680 13:95081261-95081283 ATGTGGATGTGGAGAAAAGGGGG - Intronic
1113560037 13:111271352-111271374 AGGTGGATGCTGAGGAAAGAAGG + Intronic
1114258965 14:21024331-21024353 GTGCTGATGTGGAGGTAAGAGGG + Exonic
1114690398 14:24575100-24575122 GTGTAAATGAGGAGGAAAGGAGG - Intronic
1115307072 14:31944403-31944425 ATGAGGAGGAGGAGGAGAGATGG - Intergenic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115909906 14:38244137-38244159 ATGTTGATGAGGAGATTAGTGGG + Intergenic
1115945805 14:38658928-38658950 ATGGTGAAGGGGAGGAAAAAAGG - Intergenic
1116442766 14:44972908-44972930 ATGTTGATGAGGAAAAAAATTGG + Intronic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117091850 14:52259124-52259146 GTGTTGATAAGGAAGAAAGGGGG - Intergenic
1117243403 14:53859050-53859072 ATGTAGAGGAAGAGGAAAAAAGG - Intergenic
1117270272 14:54136419-54136441 GTGTTTATGAAGAGGAGAGAAGG + Intergenic
1117299630 14:54412011-54412033 ATGGTGATGAGGGGAAAGGAGGG - Intronic
1118338008 14:64870979-64871001 ATGATGATGGGGAGGGATGATGG + Intronic
1118444152 14:65836808-65836830 ATTTGGTGGAGGAGGAAAGACGG + Intergenic
1119112873 14:71991337-71991359 ATGTGGAAGATGAGGAGAGAGGG - Intronic
1120145887 14:80978065-80978087 ATGTTGTTGAGGAGGAGGCAAGG - Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122255004 14:100470152-100470174 TGGTTGATGAGGAGGAAAGTAGG + Intronic
1122426253 14:101607775-101607797 AAGTGGAGGAGGAGGAGAGATGG - Intergenic
1122426271 14:101607846-101607868 AGGTGGAGGAGGAGGAAAGGTGG - Intergenic
1123894273 15:24812934-24812956 ATGTGTATGAACAGGAAAGATGG - Intergenic
1124080848 15:26494289-26494311 ATGTTGAGAAAGAGGAGAGATGG + Intergenic
1124096449 15:26652893-26652915 ATTTTAAAGAGGAGGAAAGCAGG - Intronic
1124217774 15:27823308-27823330 ATGCTAATGAAGAAGAAAGAGGG + Intronic
1124345197 15:28917591-28917613 ATGTTAATAATGAGGAAACAGGG - Intronic
1125593899 15:40872511-40872533 ATGACGAGGAGGAGGAGAGAGGG - Exonic
1125673704 15:41491366-41491388 ATGTGAATGAGGAGGATAGATGG + Intergenic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1127386942 15:58474595-58474617 ATTTTGTAGAGGAGGAAACAAGG + Intronic
1128185791 15:65642460-65642482 ATGAGGATGAGAAGGAAAGGGGG + Intronic
1128844486 15:70878376-70878398 ATGTTTAAAAGGAGGAAATAAGG - Intronic
1128932671 15:71719500-71719522 ATTTTGGTCAGAAGGAAAGAAGG + Intronic
1129164962 15:73771694-73771716 TTGTTTCTGAGGAGGAAACAAGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129534361 15:76299885-76299907 ATGTTGATGAGAAGGAACCAGGG - Intronic
1129879167 15:78995895-78995917 ATGGGGATGACGAGGACAGAGGG - Intronic
1130198699 15:81805425-81805447 ATGGTGATAAAGAGGAAAGATGG + Intergenic
1130816897 15:87445953-87445975 ATACTGATGAGGAGGCATGAAGG - Intergenic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1133460653 16:5983858-5983880 AGGAGGAGGAGGAGGAAAGAAGG - Intergenic
1133646188 16:7766869-7766891 GTGTTGAGGAGGGGGTAAGATGG - Intergenic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1134229443 16:12417565-12417587 ATGAGAAGGAGGAGGAAAGAGGG - Intronic
1135692767 16:24556708-24556730 ATGTGAATGAGGAAGAAAGCAGG - Intronic
1135777375 16:25268693-25268715 AAGTTGAAGAGGAGGAACAATGG + Intergenic
1136073718 16:27804435-27804457 GTGGTGATGGGGAGGAAACAGGG - Intronic
1136599706 16:31276878-31276900 GGGTTGATGAGGAAGGAAGAAGG - Intronic
1137556983 16:49477077-49477099 AGGAAGACGAGGAGGAAAGAAGG + Intergenic
1137841215 16:51642582-51642604 AGGTTGAAGGGGTGGAAAGAGGG - Intergenic
1138569458 16:57859915-57859937 AGGAGGCTGAGGAGGAAAGATGG + Intronic
1138756479 16:59492706-59492728 AAGTAGATGAGGAGGAAATTAGG + Intergenic
1138805206 16:60082772-60082794 AGGTTGAGGAACAGGAAAGAAGG - Intergenic
1138832892 16:60396910-60396932 ATGATGAAAAGAAGGAAAGAAGG + Intergenic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1138912009 16:61412337-61412359 ATTTTGATGATGAGTATAGATGG + Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139191009 16:64862980-64863002 TTGGTGATGAGGAGGAGAAAAGG - Intergenic
1139486963 16:67263253-67263275 AGGTAGATGAGGAGGGCAGATGG + Intronic
1139837879 16:69854299-69854321 ATGTGGATGGCGAGGAAAGAGGG + Intronic
1140249213 16:73280608-73280630 TTGGTGATGATGTGGAAAGAAGG + Intergenic
1141046974 16:80724048-80724070 AAGATGAAGAGGAAGAAAGAAGG + Intronic
1141058542 16:80841910-80841932 GGGGTGATGAGGAGAAAAGAGGG + Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1143137427 17:4719696-4719718 ATGTGGGTGAGCAGGAAAGGAGG + Intronic
1143171091 17:4930857-4930879 TTGGTGATGGGGATGAAAGACGG + Intergenic
1143370854 17:6438283-6438305 ATGTTGATGAGAAAAAAAGGTGG + Intergenic
1143818487 17:9540073-9540095 ATGGGGATTAGGAGTAAAGAAGG + Intronic
1144266383 17:13573638-13573660 ATGTTGATTGTGAGGATAGAGGG - Intronic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1144614499 17:16756966-16756988 ATGGTGATGGGGAGGACAGCAGG + Intronic
1144898207 17:18558708-18558730 ATGTTGATGGGGAGGACAGCAGG - Intergenic
1145134163 17:20387007-20387029 ATGGTGATGGGGAGGACAGCAGG + Intergenic
1145193774 17:20869203-20869225 AGGATAATGAGGAGGAAAGAGGG + Intronic
1145351997 17:22091431-22091453 AGGATAATGAGGAGGAAAGAGGG + Intergenic
1145722700 17:27088542-27088564 GTGATGAGGAGGAGGAAAGAGGG - Intergenic
1145737787 17:27245189-27245211 ATGGAGAAGAGGAGGAAAGGAGG + Intergenic
1146142144 17:30377623-30377645 AACTTGAGGAGGAGGAAAGGAGG - Intergenic
1146424047 17:32719053-32719075 ATGTGGAACAGGAGTAAAGATGG - Intronic
1146821519 17:35986603-35986625 ATGGTGATGAGGAGGAAGAAGGG + Exonic
1148291665 17:46456884-46456906 ATGCTGAAGAGGAGCAAAGGAGG + Intergenic
1148313855 17:46674591-46674613 ATGCTGAAGAGGAGCAAAGGAGG + Exonic
1148561494 17:48609345-48609367 ATGCTGATGAGCAGAAAAAATGG + Intronic
1148860796 17:50603397-50603419 ATGTTGAAGAGGAGGAAAGCAGG - Intronic
1149232602 17:54553190-54553212 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1149817817 17:59743928-59743950 ATGTTGAAGAGGAGTCATGAAGG + Intronic
1150483616 17:65529281-65529303 ATGTTGATGATGACGCAACATGG + Exonic
1150821186 17:68435742-68435764 ATGCTGCGGAGGAGGGAAGATGG + Intronic
1151160304 17:72159352-72159374 ATGTTGTTGAGGAGGTCAGCAGG - Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1151889712 17:76944862-76944884 ACGCTGATGAGGAAGAAAGGAGG + Intronic
1152686128 17:81694640-81694662 ATCTGGAAGAGGAGAAAAGATGG + Intronic
1153479810 18:5535856-5535878 CTGTTGTTGAGGACGAAGGAAGG + Intronic
1154031218 18:10755964-10755986 TAGGGGATGAGGAGGAAAGATGG + Intronic
1154031253 18:10756102-10756124 TAGGGGATGAGGAGGAAAGATGG + Intronic
1155472490 18:26205449-26205471 AAGAGGAGGAGGAGGAAAGAAGG + Intergenic
1155777597 18:29787357-29787379 AGGAGGAAGAGGAGGAAAGAAGG - Intergenic
1155844913 18:30694468-30694490 ATGGTCATCTGGAGGAAAGAAGG + Intergenic
1156037554 18:32782558-32782580 ATATTGCTGAGAAAGAAAGAAGG - Intergenic
1156159585 18:34343368-34343390 ATGCTGAAGAGAAGGAAATAAGG - Intergenic
1156522202 18:37731456-37731478 AAGTAGATGAGAAGGAAAGTTGG + Intergenic
1157656337 18:49393062-49393084 AGGAGGAGGAGGAGGAAAGAAGG + Intronic
1159121065 18:64171567-64171589 ATGTTGCAGAGGATGAAAAATGG - Intergenic
1159164743 18:64685572-64685594 AGGGTGAGGAAGAGGAAAGAAGG - Intergenic
1159996260 18:74968354-74968376 ATGTCCATGAGGAGGACAGTGGG + Intronic
1160381825 18:78463512-78463534 ATGTTGGTGAGGAGGTGAAATGG - Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1161389255 19:4012720-4012742 AGTTTGATGAGGAGGAGGGAGGG + Intronic
1161837807 19:6659823-6659845 ATGGGGATGAGGAGGAAAAGGGG + Intergenic
1161873310 19:6887330-6887352 ATGTTGATGGGAAAGAAAAAGGG + Intergenic
1161989037 19:7673503-7673525 AGGATGAGGAGGAGGAAGGAGGG - Intergenic
1162764181 19:12908218-12908240 GCCTTGATGGGGAGGAAAGAGGG - Intronic
1164230659 19:23284870-23284892 ATGTCAGTGTGGAGGAAAGAAGG + Intergenic
1164462190 19:28458477-28458499 ATGTTGAGGAGGGTGTAAGAAGG - Intergenic
1164472218 19:28545850-28545872 ATCTTGATGAGGTGAAAACAAGG + Intergenic
1164591893 19:29511977-29511999 AGGAGGATGAGGAGGAAGGAGGG + Intergenic
1164591965 19:29512274-29512296 ATGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592304 19:29513526-29513548 AGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592439 19:29513983-29514005 GGGGTGATGAGGAGGAAGGAAGG + Intergenic
1164739401 19:30565324-30565346 ATGTTGCAGAGGAGGAAAGATGG + Intronic
1166660672 19:44644620-44644642 ATGTTGGGGAGGAGGACAGTGGG + Intronic
1167529192 19:50004378-50004400 ATCATGATGAGAAGGAATGAGGG - Intronic
1168204398 19:54838875-54838897 ATGATGATGATGAAGATAGATGG + Intronic
924994647 2:347928-347950 AAGATGAGGAGGAAGAAAGAAGG - Intergenic
925826033 2:7849526-7849548 AGGAGGAGGAGGAGGAAAGATGG - Intergenic
925997844 2:9306581-9306603 AGGTTGATGAGAAGGAAAATGGG + Intronic
926011218 2:9409638-9409660 ATGTTGATGAGAAAAAAAAATGG - Intronic
926771938 2:16386050-16386072 AGTTTGATGAGGAAGAAATATGG + Intergenic
926796776 2:16625973-16625995 ATGATGATCAGGAGGAAACCCGG - Intronic
927866208 2:26589275-26589297 AGGAGGAGGAGGAGGAAAGAAGG - Intronic
928400573 2:30975277-30975299 ATGTCGATGATGAAGCAAGAGGG + Intronic
928678911 2:33679308-33679330 GCATTGATGAGGAGGAAAGCAGG - Intergenic
928920397 2:36520787-36520809 ATATTCATGAGGTGGATAGAAGG + Intronic
929139367 2:38653742-38653764 ATATTGATGTGCTGGAAAGATGG + Intergenic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
930306372 2:49679742-49679764 ATATAGATGAGAAGGAAAGGAGG - Intergenic
930775355 2:55165350-55165372 ATGAAGAAGACGAGGAAAGAGGG + Intergenic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
930894707 2:56431953-56431975 TTGTAGATGAGGAGAAAAGGTGG + Intergenic
932263814 2:70349020-70349042 CTCTTGATGAGGGGGAAAGGTGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934902424 2:98171396-98171418 AAGTTAATGAGGTGAAAAGATGG + Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935687773 2:105699139-105699161 ATGCTGATGGGCAGGACAGATGG - Intergenic
936089747 2:109493894-109493916 AAGTGGAGGAGGAGGAGAGAAGG - Intronic
936637160 2:114271988-114272010 ATTTTGATGAAAAGGAAAAAGGG - Intergenic
936863144 2:117046100-117046122 ATGTTGTTGAGGGGGAACAATGG + Intergenic
937397981 2:121555499-121555521 ATTTTGAGGAGGAGGATGGAGGG + Intronic
937649397 2:124303128-124303150 ATGTTCATGAGAAGGAGTGAGGG - Intronic
939664619 2:144935725-144935747 ATTATGATGAGGAGGAATTAGGG + Intergenic
940198926 2:151128562-151128584 ATATTGCAGAGGAGGAAAAATGG - Intergenic
940627331 2:156191730-156191752 AGGCTGATGATGTGGAAAGACGG + Intergenic
941071000 2:160954366-160954388 ATGTGGAAAAGGAGTAAAGAAGG - Intergenic
941212842 2:162664074-162664096 ATGAAGATCAGGGGGAAAGATGG - Intronic
941302847 2:163826114-163826136 ATATTGCTGAAGAGGAAAAAAGG - Intergenic
941439107 2:165511409-165511431 ATGATGATGTGGAAGACAGAGGG + Intronic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
941889029 2:170558869-170558891 ATTTTGGAGATGAGGAAAGAGGG - Intronic
943313900 2:186361577-186361599 ATGTTATTGAAGAGGAGAGACGG + Intergenic
943445875 2:187987348-187987370 CTGTTAAGGAGGAGAAAAGAGGG + Intergenic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
944108240 2:196102603-196102625 ATAGAGATGAGGAGGCAAGAAGG + Intergenic
944885600 2:204059415-204059437 AAGATGCTGAGGAGGAAAGTGGG - Intergenic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
945751918 2:213797955-213797977 ATGTTGATGAGAATGAGAGAAGG - Intronic
946265073 2:218533480-218533502 AATTTGATGTGGAGGAGAGAAGG - Intronic
946467150 2:219922007-219922029 AAGTTGATGAGAAGGAAACAGGG - Intergenic
947450646 2:230205312-230205334 TTGGTGATGATGAAGAAAGAAGG - Intronic
947944923 2:234093191-234093213 ATGCTGAGGCAGAGGAAAGAAGG + Intergenic
1168789169 20:564376-564398 ATGCTGCTGTGGAGGAAGGAGGG + Intergenic
1169977457 20:11346171-11346193 ATGGTGGTGGGGAGGAAATAAGG - Intergenic
1170621609 20:18001122-18001144 GTGTTAGTGAGGAGAAAAGATGG - Intronic
1170947893 20:20908456-20908478 ATGTTGCTCAGGATGAAAAAGGG - Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172399638 20:34638699-34638721 ATGATCAAGAGGAGGAAAGCTGG + Intronic
1172567255 20:35940379-35940401 AGGTTCATGAGGATGAAATAGGG - Intronic
1173259193 20:41418380-41418402 ATGAAGATGAGGAGGCAACAGGG + Intronic
1173507533 20:43599776-43599798 ATGTAGTTGAGGTGGAAATAAGG - Intronic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1175158332 20:56989338-56989360 AGGTTGATGAGGAGGACAGCAGG + Intergenic
1175711807 20:61227282-61227304 ATGTTGATGTGGGGGAAGGAGGG - Intergenic
1175858789 20:62138086-62138108 AGGTAGATGAGCAGGAAGGAAGG - Intronic
1177045246 21:16160834-16160856 AGGAGGAGGAGGAGGAAAGAAGG - Intergenic
1177492095 21:21839649-21839671 ATATTGATGAGGATAAAAGTTGG + Intergenic
1177633086 21:23751779-23751801 AAGTAGAAGAGGAGGAAAGCAGG + Intergenic
1178266316 21:31145858-31145880 ATGTTGATGAGGAAAAAAATTGG - Intronic
1178728175 21:35073863-35073885 ATGTTAATGAGGAGCCAAGAAGG - Intronic
1179513469 21:41890710-41890732 ATGTTGAGGAGGTTGAAGGAGGG + Intronic
1181441857 22:22940800-22940822 AGGAGGAGGAGGAGGAAAGAAGG + Intergenic
1181965398 22:26653021-26653043 ACATTGATGGGGAGGAGAGAAGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182825635 22:33262513-33262535 CAGTTCATGAGGAGGCAAGATGG - Intronic
1183119025 22:35715248-35715270 ATTTTGGGGAGGAGGCAAGAAGG - Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184433456 22:44455293-44455315 ATGTTAATGAGGAGGCATGCAGG + Intergenic
949160424 3:875460-875482 ATATTGAGGAGGAGCCAAGATGG - Intergenic
949796983 3:7862286-7862308 AGGTTCAGGAGGAGGAAAAATGG - Intergenic
949939553 3:9144334-9144356 ATGTTGAAGGGGAAGAGAGAAGG - Intronic
950136633 3:10585618-10585640 ATGTTGGTGAGACAGAAAGAAGG - Intronic
950317039 3:12011608-12011630 ATGCTGCTGAAAAGGAAAGAAGG - Intronic
950841930 3:15976152-15976174 GTATTGATGAGGAAGAATGAGGG + Intergenic
952010206 3:28892084-28892106 AGAATGATGAGGAGGAAAAAAGG - Intergenic
952220749 3:31321736-31321758 ATGTTGAGAAAGAGGAAAAAAGG - Intergenic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
954049358 3:47960384-47960406 CTGTTGATGAGGAAGACAGAGGG - Intronic
954544317 3:51419859-51419881 ACATTGGTGAGGAGTAAAGAGGG + Exonic
955042629 3:55332366-55332388 ATCTTGAGGAGGAGGAAGAAGGG + Intergenic
955110549 3:55944857-55944879 ATGTTGACGAGTAGGACTGAGGG - Intronic
955531268 3:59875365-59875387 ATGATGATGAAGAGGTAAGCTGG - Intronic
955675985 3:61449455-61449477 ATGTGGAGGAAGAGGAAAGGAGG + Intergenic
956008589 3:64806439-64806461 ATGATGATGATGATGAAACATGG - Intergenic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
956349737 3:68321426-68321448 ATGTTGGAGAGAAAGAAAGAGGG + Intronic
956620909 3:71220790-71220812 AAGATTATGAGGAGAAAAGAAGG + Intronic
956856849 3:73283476-73283498 ATGTTGATGAGGAAAAAAATTGG + Intergenic
956999277 3:74866370-74866392 ATGTTGATGAGATAAAAAGATGG - Intergenic
957405076 3:79766269-79766291 ATGTTGATGAGGCTGCAAGAGGG - Intronic
957803164 3:85112205-85112227 ATGCTGATGAGAAGGATATATGG - Intronic
957875922 3:86146704-86146726 GTGGTTATGGGGAGGAAAGAAGG - Intergenic
959032643 3:101318532-101318554 ACTTTGATGAGAAGGGAAGAAGG + Intronic
959971542 3:112415525-112415547 ATGTTGTTGAAGAGGTAAGTAGG - Intergenic
960118268 3:113920049-113920071 TTGTTGATGAGGAAGACTGAAGG + Intronic
960574140 3:119213105-119213127 ATGTAGATGAGGATGAATGAAGG + Intronic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961428636 3:126864642-126864664 AGGTGGAGGAGGAGGAAAAAAGG - Intronic
962369351 3:134807953-134807975 ATGTTTAAGAGGAGGAGAAAGGG - Intronic
963278942 3:143362312-143362334 ATGGTGATGTGGAAGATAGAGGG - Intronic
963987785 3:151617192-151617214 AGGAGGAGGAGGAGGAAAGAAGG - Intergenic
964207307 3:154188799-154188821 ATGAAGATGTGGAGGAAAAAGGG - Intronic
964401398 3:156303050-156303072 GTGTTGTGGAGGAGAAAAGAAGG + Intronic
964491571 3:157241853-157241875 ATGTTGTTGATGGGGAAAAAGGG + Intergenic
964564339 3:158033193-158033215 AGGAGGATGAGGAGAAAAGAAGG + Intergenic
965356171 3:167675630-167675652 ATGTTGATAATGGGAAAAGAAGG - Intergenic
965680188 3:171242310-171242332 ATGAGGAAGAGGAGGAAGGAAGG - Intronic
966246993 3:177819655-177819677 ATGACTATGAGAAGGAAAGATGG + Intergenic
966522967 3:180893426-180893448 AAGGTGAGGAGGAGTAAAGAGGG + Intronic
966702012 3:182863881-182863903 ATGTAGATCAGGAAGAATGAGGG - Intronic
968993635 4:3931314-3931336 AGGTTGAGGAACAGGAAAGAAGG - Intergenic
969085748 4:4655195-4655217 CTGATGAGGAGGAGGCAAGAAGG + Intergenic
969375619 4:6761530-6761552 ATGTTGATGAGGAAGACACCTGG - Intergenic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
969907677 4:10412263-10412285 ATGTCCAGGAGGAGGAGAGAGGG - Intergenic
969998956 4:11344515-11344537 ATTGTGAAGTGGAGGAAAGAAGG - Intergenic
970043907 4:11828146-11828168 ATGTTGTTGGGAAGGAAGGAAGG - Intergenic
970101311 4:12525231-12525253 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
970126273 4:12815671-12815693 ATGTTGGAGAGGAGAAATGAAGG + Intergenic
970133347 4:12894978-12895000 ATGATGATGAAGGGGAATGAGGG - Intergenic
970303023 4:14701810-14701832 ATGTTGAGGAGGAAGAAAGGAGG + Intergenic
970396642 4:15674587-15674609 GAGTTGATAAGGAGAAAAGAAGG - Intronic
971785735 4:31099965-31099987 ATGCTGAACAGAAGGAAAGAAGG + Intronic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972547100 4:40090595-40090617 ATGTTGATGAGGAAAAAAATTGG + Intronic
972910617 4:43812114-43812136 ATGTTCAAGAGGAAGAAAGCAGG + Intergenic
972929556 4:44054937-44054959 ATGGTGGGGAGGGGGAAAGATGG - Intergenic
973969451 4:56197507-56197529 TTGGTGATGTGGGGGAAAGAGGG - Intronic
974482013 4:62457241-62457263 ATGGTGAGGAAGATGAAAGAAGG + Intergenic
974681136 4:65163330-65163352 ATATTAATGAAAAGGAAAGATGG + Intergenic
974886845 4:67829866-67829888 ATGTTGATGTGGAGGGAAATGGG + Intronic
974943166 4:68492914-68492936 ATGATGATTAGGACAAAAGAAGG - Intronic
975187426 4:71419830-71419852 ATGATGGTGAGGAGCCAAGATGG - Intronic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975814274 4:78201739-78201761 ATGTCGCTGATGAGGAAAAAAGG + Intronic
976258921 4:83127375-83127397 ATGATGATGATGAAGATAGATGG - Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
976882811 4:89949540-89949562 ATGTTAATGAGCAGCAAAAAAGG + Intronic
977498834 4:97812704-97812726 ATATTGATTAGGAGGAAAACGGG - Intronic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
977908837 4:102508320-102508342 ATGATGATGATGTGGAATGATGG + Intronic
978889447 4:113805706-113805728 ACCTTGACGAGGAGGAAAGGGGG + Intergenic
979116480 4:116830347-116830369 GTGGTCATGTGGAGGAAAGAGGG - Intergenic
979760838 4:124402180-124402202 ACTTTGAACAGGAGGAAAGAAGG + Intergenic
980018912 4:127684604-127684626 AGGAAGAGGAGGAGGAAAGAGGG - Intronic
980379208 4:131989798-131989820 ATGCTGATAAGAAGGGAAGAGGG + Intergenic
980575378 4:134679681-134679703 AGGGTGAGGAGCAGGAAAGAAGG + Intergenic
980642247 4:135596012-135596034 ATGGTCATGAGCAGGAAAGAAGG - Intergenic
980829613 4:138113945-138113967 ACCTTGATGAGGAGTCAAGATGG + Intergenic
981793691 4:148570099-148570121 ATGAGGAGGAGGAGGAAAAAGGG - Intergenic
981815932 4:148830352-148830374 ATTTTAAAGATGAGGAAAGAGGG + Intergenic
982259160 4:153479322-153479344 ATGGGGATGAAGAGGAAAGAGGG - Intronic
982660627 4:158202068-158202090 CTGTGGTTGAGGTGGAAAGAAGG - Intronic
982675512 4:158371024-158371046 ATGTTGTTGAGAAAGAAAGTGGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
984063382 4:175019736-175019758 TTGTTGAGGAGGAGCCAAGATGG + Intergenic
984585151 4:181555172-181555194 ATGGTTATGAGGATGAAATATGG - Intergenic
984779748 4:183514389-183514411 AAGTAGATGGGGAGGAGAGAGGG + Intergenic
985611409 5:891649-891671 ATCTGGACGATGAGGAAAGAAGG - Exonic
986193779 5:5519482-5519504 AGGGTGAGGAAGAGGAAAGAAGG - Intergenic
986360617 5:6974836-6974858 AGTTTGATGAGGCTGAAAGAAGG - Intergenic
986419447 5:7564118-7564140 ATGTTCAAGGGGAGAAAAGAAGG - Intronic
986674272 5:10169352-10169374 ATGTGGAAAATGAGGAAAGAGGG - Intergenic
986963892 5:13246969-13246991 TTTTTGAGGGGGAGGAAAGATGG + Intergenic
987098794 5:14574369-14574391 ACGGTGAGGAGGAGGAAAGTGGG + Intergenic
988847842 5:35147014-35147036 ATGATGTTGAGGAGGAGAGTAGG + Intronic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
989437214 5:41428743-41428765 ATGTTAATGAGGTGGAAATAGGG - Intronic
989763429 5:45049095-45049117 ATGTTCACGAGTAGGAAAAAGGG - Intergenic
990036682 5:51330044-51330066 AATTTGAGAAGGAGGAAAGATGG + Intergenic
990283895 5:54280222-54280244 ATGTCTATGAAGTGGAAAGAGGG - Intronic
991155110 5:63424993-63425015 ATGCTGATAAGGAGGAAAAGAGG - Intergenic
991219290 5:64193951-64193973 ATATTGATGAGAGGAAAAGAGGG + Intronic
992507444 5:77401114-77401136 TTGTTAATGAGGATTAAAGAAGG + Intronic
992944719 5:81798751-81798773 ATGTTGCTGGGGAGGAAGGAGGG + Intergenic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
993659711 5:90617960-90617982 ATTTTTATAAGGAGGAAACACGG - Intronic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
994198302 5:96943690-96943712 ATGTAAATGAGGAGGAAACCAGG + Intronic
994259251 5:97637511-97637533 ATGTTATGGAGGAGGAAACAGGG + Intergenic
995301786 5:110593681-110593703 AGGGTGATGAGGAGGAAATAGGG + Intronic
995391939 5:111649494-111649516 AAGTGGATGGGGAGGAAAAATGG + Intergenic
997167738 5:131679313-131679335 GTGTTGTTGACAAGGAAAGAAGG - Intronic
997415948 5:133728791-133728813 ATGTATATCAGAAGGAAAGAAGG + Intergenic
997420953 5:133766290-133766312 AAGAAGAAGAGGAGGAAAGAGGG + Intergenic
997729233 5:136153828-136153850 AAGGTGATGAGGAGGAGAAATGG + Exonic
997770374 5:136548098-136548120 AGGGTGAGGAAGAGGAAAGAAGG + Intergenic
997772398 5:136567115-136567137 AGGGTGAGGAAGAGGAAAGAAGG + Intergenic
997943849 5:138182122-138182144 TTGTTGATTTGGTGGAAAGATGG + Intronic
999361078 5:150987277-150987299 GTGTGGAGGAGGAGGAAATAGGG + Intergenic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001599266 5:172918653-172918675 ACGCTGATGATGAGGAGAGAAGG + Intronic
1001852524 5:174981811-174981833 ATGTGGATGGGGACGAAAGGAGG + Intergenic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1003822172 6:9910902-9910924 GTGATGATGGGGAGGAGAGATGG - Intronic
1004060846 6:12196627-12196649 ATGATGATGGGAAGGAAGGAAGG - Intergenic
1004575477 6:16889887-16889909 ATGGTGAGGAACAGGAAAGAAGG - Intergenic
1004855260 6:19743389-19743411 ATAATGATGAGTAGGAAACAAGG - Intergenic
1005309980 6:24549818-24549840 ATGGTAATGACGAGGAAAGAGGG + Intronic
1005363047 6:25050500-25050522 GGCTTAATGAGGAGGAAAGAAGG - Intergenic
1006575641 6:35043366-35043388 ACCTTGATGAGGAAGAAAGAAGG + Intronic
1006885401 6:37377633-37377655 TTGTTGTTGAGGAGAAAACAGGG + Intronic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1007977291 6:46114450-46114472 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1008039269 6:46778730-46778752 ATGATGTTGAGGAGGAGAGGAGG + Intergenic
1008054388 6:46931191-46931213 ATGTTGCTGAGGAAGTAAGAGGG - Intronic
1008301892 6:49851188-49851210 ATGATGAAGAGGATGAAACAAGG - Intronic
1009789529 6:68384489-68384511 AGTTTTATGAGGAGGATAGAAGG - Intergenic
1010533290 6:76992505-76992527 AGGTGGATGGGGAGGCAAGAAGG - Intergenic
1010567259 6:77431384-77431406 AAGTTGCAGAAGAGGAAAGATGG - Intergenic
1010918668 6:81652912-81652934 ATGTTTGTGTGGAGGAAAGTGGG + Intronic
1012271657 6:97219858-97219880 ATGTTGATGAGAGGTAGAGATGG - Intronic
1012621304 6:101347636-101347658 ATGGTAAAGAGAAGGAAAGATGG + Intergenic
1013784235 6:113761790-113761812 ATCTTGATGATGAGAAAGGATGG + Intergenic
1013837023 6:114344597-114344619 ATATTGAGCAGGAGGAAAGATGG + Intergenic
1014158847 6:118143383-118143405 ATCTTGGAGAGTAGGAAAGAGGG - Intronic
1014561921 6:122901225-122901247 AGGAGGAGGAGGAGGAAAGAAGG - Intergenic
1015566613 6:134579201-134579223 TTGTAGAAGAGGGGGAAAGAGGG + Intergenic
1016089884 6:139963761-139963783 ATGTGGAAGATGAGGAAAAAGGG - Intergenic
1017688900 6:156943857-156943879 ATTTTTGTGAGGAGGAAAAAAGG - Intronic
1018070759 6:160162303-160162325 ATGCTGCTGAGCAGGACAGAGGG + Intergenic
1018123562 6:160660219-160660241 ATGCTGATAGGGAGGGAAGAGGG - Intronic
1018136353 6:160781640-160781662 ATGCTGATAGGGAGGGAAGAGGG + Intergenic
1018980479 6:168598316-168598338 ATGTTGAGAATGAGGAGAGAGGG + Intronic
1019862604 7:3674305-3674327 ATGGTAATGAGAAGGAAGGAGGG + Intronic
1020360429 7:7321620-7321642 AAGTCTAAGAGGAGGAAAGACGG + Intergenic
1020434462 7:8147833-8147855 ATGTTGATGAGAAAAAAAAATGG + Intronic
1021425757 7:20497047-20497069 ATGGTCATTTGGAGGAAAGAAGG - Intergenic
1022121522 7:27312986-27313008 ATGGTGGAGAGGAGGAATGAAGG + Intergenic
1022315563 7:29241735-29241757 TTGTCCAGGAGGAGGAAAGACGG + Intronic
1022542215 7:31147841-31147863 ATGTTGAATAGGATGAGAGAGGG - Intergenic
1022737500 7:33089767-33089789 ATGTTTGTGAGGGGGATAGATGG + Intergenic
1022801285 7:33779793-33779815 AAGTGGATGGGGAGGAGAGAAGG - Intergenic
1023369899 7:39502725-39502747 GTGCTGTTGAGGTGGAAAGAAGG - Intergenic
1024182144 7:46907416-46907438 ATATTGGTGAGGGGGAAAGGTGG + Intergenic
1024677252 7:51647775-51647797 ATGAGGAGGAGGAGGAAGGAGGG - Intergenic
1024740185 7:52345028-52345050 TTGATTATGAGGAGGAAAGCTGG - Intergenic
1025945394 7:66100451-66100473 AGAATGAGGAGGAGGAAAGAGGG + Intronic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027557058 7:79678096-79678118 ATGTAAGTGAGGAGGAAAAACGG - Intergenic
1027782808 7:82540856-82540878 AAGTTGCTGAGGTGGTAAGAGGG - Intergenic
1028076042 7:86516596-86516618 GTGTTGCTGATGAGAAAAGAGGG - Intergenic
1028840841 7:95428747-95428769 ATGATGCTGAGAAGGAATGAAGG + Intronic
1029477041 7:100791360-100791382 AAGAGGAGGAGGAGGAAAGAAGG - Intronic
1029823730 7:103169360-103169382 TTGTTGATGAGGGGGATGGAAGG - Intergenic
1030571812 7:111235779-111235801 TTGCTGAAGAGGAGGAAAGTGGG - Intronic
1030921136 7:115389602-115389624 ATATTTAAGAGTAGGAAAGAAGG - Intergenic
1031188438 7:118513579-118513601 ATATTGATGGAGAGGAAACAAGG - Intergenic
1032817380 7:135490586-135490608 GTGTTAGTGAGGAGAAAAGAGGG + Intronic
1033013751 7:137650627-137650649 ATTCTCATGTGGAGGAAAGAGGG - Intronic
1033722546 7:144076857-144076879 ATGTTGATGAGGAAAATACATGG + Intergenic
1033840236 7:145364397-145364419 ATGGTGGTGAGGAGTAAAGAGGG + Intergenic
1034336213 7:150325148-150325170 AAGTGGAAGAGGAGGAATGATGG - Intronic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037633432 8:20678614-20678636 ATGATGAAGAGGAGAAAAGCTGG - Intergenic
1037856570 8:22375432-22375454 ATTTTGATGTCGAGGTAAGATGG - Intronic
1038395129 8:27241015-27241037 ATGCTGAGAGGGAGGAAAGAAGG + Intronic
1038770596 8:30475725-30475747 GTGTTGGGGAGGAGGAAGGAGGG + Intronic
1038947827 8:32380671-32380693 ATGGTGATGAGGAAGTAAAAAGG - Intronic
1038985084 8:32800448-32800470 AAAATGATGAGGAGCAAAGATGG + Intergenic
1039291190 8:36095821-36095843 AGGAGGAGGAGGAGGAAAGAAGG + Intergenic
1040406976 8:47114634-47114656 AAATAGATGAGGATGAAAGAAGG - Intergenic
1040480710 8:47823714-47823736 ATGTTGATGAGGAAGAAAATTGG - Intronic
1041853909 8:62426907-62426929 ATGTGGATAAGGTGGAAACATGG + Intronic
1041883835 8:62785422-62785444 GTGGTGAGGAGGAGGAGAGATGG + Intronic
1042509663 8:69597965-69597987 AGGTTGAGGAGGAGGAGAGAGGG - Intronic
1042959071 8:74283531-74283553 AAGGTGAGAAGGAGGAAAGATGG + Intronic
1043605372 8:81992158-81992180 ATACTGTTGAGGAGGAAAGTAGG - Intergenic
1044075388 8:87815505-87815527 AATTAGTTGAGGAGGAAAGATGG + Intergenic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044913893 8:97091419-97091441 TTGTTCATGAGGAGAACAGATGG + Intronic
1044948591 8:97414328-97414350 ATGTGGCTGGGTAGGAAAGATGG + Intergenic
1045642494 8:104267092-104267114 ATGTTGGTGAGGAAGAAGTAAGG + Intergenic
1045900315 8:107271060-107271082 GTGTGGAGGAGGAGGAAAAAAGG - Intronic
1046030439 8:108776750-108776772 ATGATGATGATGATGAAGGAAGG + Intronic
1046345321 8:112917325-112917347 ATTTTGAAGATGAGGAAATAAGG + Intronic
1046562429 8:115854890-115854912 ATGTGGATGTGGAGGCAAAAGGG - Intergenic
1046632026 8:116630834-116630856 ATGTTTATGAAAAGGAAACATGG - Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1047523260 8:125611956-125611978 ATTTAGATGATGAGGAAAAATGG + Intergenic
1047697953 8:127421847-127421869 ATGCTTATGAGGTGGAAAAAAGG - Intergenic
1048183097 8:132214359-132214381 AAGTTGAGAAGAAGGAAAGAAGG - Intronic
1048210532 8:132450791-132450813 ACGGTGATGATGAGGAAAGGAGG - Intronic
1049021612 8:139961109-139961131 ATGCTGAAGAGGAGGACAGCAGG + Intronic
1049084698 8:140469736-140469758 ATGGTGATGTGGATGAAAGGAGG - Intergenic
1050717119 9:8542469-8542491 ATTTTGAAGATGAGGAATGAAGG + Intronic
1051048593 9:12905083-12905105 ATGTTCAAGAGTAGGAAAGGTGG - Intergenic
1051234868 9:14989359-14989381 ATGTTAAAAAGGGGGAAAGAGGG + Intergenic
1051522045 9:18000339-18000361 ATGTTGGGGGGAAGGAAAGAAGG - Intergenic
1051541797 9:18228316-18228338 ACATTGAGGAGGAGGAAAGGTGG + Intergenic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1051944170 9:22546233-22546255 TTATTGATGAGGAAGCAAGATGG + Intergenic
1052466726 9:28839154-28839176 AGGGTGATGAAAAGGAAAGAAGG - Intergenic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1053418768 9:37963614-37963636 GTGTTGGTGAGGGGGAAAGGTGG + Intronic
1054880836 9:70142952-70142974 ATGTTGTTTAGGAGGAATAAAGG + Intronic
1055154428 9:73042823-73042845 ATGGAGATGAGGAAGAAATATGG + Intronic
1055351016 9:75388489-75388511 ATGGTGATGAGGAAGAAAGGAGG - Intergenic
1055685024 9:78763588-78763610 AGGCTGATGAGAAGGGAAGATGG + Intergenic
1056202762 9:84292366-84292388 ATGTTTATGAAGAGGATGGAAGG - Intronic
1056256343 9:84803264-84803286 AGGATTATGAGGAAGAAAGAAGG - Intronic
1056527647 9:87458083-87458105 ATGGAGATGAGAAGTAAAGAAGG + Intergenic
1056587847 9:87939953-87939975 GTGACGAGGAGGAGGAAAGAGGG + Intergenic
1056609020 9:88112992-88113014 GTGACGAGGAGGAGGAAAGAGGG - Intergenic
1056774999 9:89505371-89505393 ATGTTATGGAGGAGGAAACAGGG + Intergenic
1056912330 9:90713696-90713718 AGGGTGGTGAGGAGGAATGAGGG + Intergenic
1057612592 9:96559628-96559650 ATGTTGATAGGCAGGAAAGCAGG - Intronic
1058640726 9:107081694-107081716 AACTAGATGTGGAGGAAAGAAGG - Intergenic
1059747469 9:117217120-117217142 AAGGGGAGGAGGAGGAAAGATGG + Intronic
1059999665 9:119946919-119946941 ATGTTTGTGAGCAAGAAAGAAGG - Intergenic
1060125642 9:121041982-121042004 ATGTTGATGATGAGAATAGTGGG - Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1062527270 9:136983044-136983066 TTGGAGATGAGGAGGAAACAGGG - Exonic
1185689290 X:2139870-2139892 ATGTTGAATAGAAGGAAGGATGG - Intergenic
1185878337 X:3717976-3717998 ATGTTGAGCATGAGAAAAGACGG - Intergenic
1185967106 X:4619083-4619105 ATGCAGCTGAGGAGAAAAGAAGG + Intergenic
1186287874 X:8065243-8065265 ATGTGGAGGAGAAAGAAAGAGGG + Intergenic
1186365331 X:8886603-8886625 ATGTTAATGAGGAGAAAATGTGG + Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1186623454 X:11266111-11266133 GAGTTGGGGAGGAGGAAAGAGGG + Intronic
1186888319 X:13937326-13937348 ATTTTGGTGAGGAGTAAAGGGGG - Intronic
1187866437 X:23727292-23727314 AAGTTAATGAGCAAGAAAGAGGG + Intronic
1188797058 X:34480568-34480590 ATGGTCATTAGGAAGAAAGAAGG + Intergenic
1189092213 X:38096258-38096280 ATAATGAAGAGGAGGAAATAAGG + Intronic
1189352302 X:40284946-40284968 ATGATGTTGAGGAGAAAGGAGGG - Intergenic
1189564754 X:42230136-42230158 AAGATGATGAGGAGGAAACTGGG + Intergenic
1189715265 X:43858401-43858423 ATGTGGAGCAGAAGGAAAGAAGG - Intronic
1189923647 X:45930208-45930230 ATGATGAGGATGAGGAGAGATGG - Intergenic
1190595544 X:52050042-52050064 ATGTAGAAAAGGAGGAAACAAGG + Intergenic
1190613280 X:52204031-52204053 ATGTAGAAAAGGAGGAAACAAGG - Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1191075096 X:56444587-56444609 ATGTTCATTTGGAGGTAAGAAGG + Intergenic
1191734061 X:64370203-64370225 ATGTTTCTGAAAAGGAAAGATGG - Intronic
1191792985 X:64990839-64990861 AAGTTGGGGAGGAGGAGAGAAGG - Intronic
1192387537 X:70687139-70687161 GTGTGAATGAGGTGGAAAGATGG - Intronic
1192782168 X:74305235-74305257 ATGTGTATGTGGGGGAAAGAGGG + Intergenic
1192873162 X:75204287-75204309 ATGTGGAGGAGGAGGAAATAGGG + Intergenic
1192979973 X:76328801-76328823 ATGATGAGGAGGAGCCAAGATGG - Intergenic
1193823670 X:86196030-86196052 ATGGTCATTTGGAGGAAAGAAGG - Intronic
1194068600 X:89292625-89292647 ATGTTGAGGAGGAGCCAAGATGG + Intergenic
1194307351 X:92264658-92264680 ATGTTGAAGAAGAGGAATGTTGG + Intronic
1194344751 X:92750220-92750242 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195097389 X:101516327-101516349 ATGTTAGTGGGGAGAAAAGAGGG - Intronic
1195487087 X:105421599-105421621 ATGTTTATGAAGAGAAAATAGGG + Intronic
1195548536 X:106139720-106139742 GTGGTCATGTGGAGGAAAGAAGG - Intergenic
1197231628 X:124010704-124010726 ATGTTGATGAGGAAAAAAATTGG + Intronic
1197286910 X:124606519-124606541 ATGGTGAAAAGTAGGAAAGAAGG + Intronic
1197457034 X:126689732-126689754 ATGTTGCTGAGAAGGCAATATGG - Intergenic
1197619525 X:128732733-128732755 ATGTTGGGGAGGAGCCAAGATGG + Intergenic
1198867177 X:141136307-141136329 ATTTTGCTGGGGAGGAAATATGG - Intergenic
1199112362 X:143949807-143949829 ATTTAGATGAGGAGTAAATAAGG + Intergenic
1200040742 X:153365421-153365443 ATATTGGTCAGGAGAAAAGAAGG - Intergenic
1200352213 X:155509975-155509997 AAGTTGGAGAGGAGGAATGATGG - Intronic
1200653096 Y:5866860-5866882 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1200722746 Y:6626780-6626802 ATGTTGAGGAGGAGCCAAGATGG + Intergenic
1201928413 Y:19315105-19315127 ATGATGATGAGGAGGAAAGGAGG - Intergenic