ID: 935225426

View in Genome Browser
Species Human (GRCh38)
Location 2:101048094-101048116
Sequence CCCTGTGTGTGTGGGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935225426_935225435 0 Left 935225426 2:101048094-101048116 CCATGTGCCCCACACACACAGGG 0: 1
1: 0
2: 6
3: 43
4: 372
Right 935225435 2:101048117-101048139 AGAGGGGGAGAAGCTTCAAATGG 0: 1
1: 0
2: 1
3: 17
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935225426 Original CRISPR CCCTGTGTGTGTGGGGCACA TGG (reversed) Intronic
900150133 1:1174785-1174807 CGCTGTGTGTGTGGTGAACCCGG - Intronic
900237205 1:1598540-1598562 CCCTGTGGGAATGGGGCAGATGG - Exonic
900468055 1:2835397-2835419 AGCTGTGTGGCTGGGGCACAAGG + Intergenic
900541721 1:3206245-3206267 CCCTCTGTGGGTGGTTCACAGGG - Intronic
900787689 1:4658976-4658998 CCATTTGTGTGTGGGTCAGAGGG - Intronic
900813934 1:4828834-4828856 CCCATTGTGTGTGGGTCAAAAGG - Intergenic
902196580 1:14802912-14802934 CCCTCTGTGGGTTGGGGACAGGG - Intronic
902397327 1:16139421-16139443 CATTGTGTGTGTGGTGAACACGG - Intronic
902447452 1:16476180-16476202 CCTTGGGTGTGTGGGACACTGGG + Intergenic
902467304 1:16626130-16626152 CCTTGGGTGTGTGGGACACTGGG + Intergenic
903368154 1:22817553-22817575 CCCGGTGTGCTTTGGGCACAGGG + Intronic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
904906565 1:33901531-33901553 CCCAGTGTGGGTGGGGCTGAGGG + Intronic
905790052 1:40784781-40784803 CTCTTTGTGTCTGGGACACAGGG - Intronic
906001708 1:42431959-42431981 CCCTTTTTGTGTGGGTGACATGG - Intronic
906125859 1:43426581-43426603 CCCTGTGAGGGTGGGGGAAAAGG - Intronic
906255734 1:44348498-44348520 ACCTGTAGCTGTGGGGCACAAGG + Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
908341191 1:63181056-63181078 CCCTGTGACTTTGGGGTACAGGG + Intergenic
909371172 1:74885064-74885086 CCCTGTGTGTGTGCAGCCTAGGG + Intergenic
911092785 1:94030946-94030968 CTCTGTGGGTTTGGGGCACCTGG - Intronic
912273183 1:108230505-108230527 CTTTGTGTGTGTGTGACACAGGG + Intronic
912295037 1:108463817-108463839 CTTTGTGTGTGTGTGACACAGGG - Intronic
912480833 1:109981119-109981141 CCCCATGTGGGTGGGGCACAGGG - Intergenic
915234903 1:154473466-154473488 CGCTGTGTGTTGGGGGGACAGGG + Intronic
916378396 1:164181609-164181631 CCCTCTTTGTGTCTGGCACATGG + Intergenic
916720892 1:167484140-167484162 CTCTGCCTGTGTGGGGCACGAGG - Intronic
917436389 1:175025282-175025304 CCCTTAGTGTGTGGGCCACTTGG + Intergenic
917747012 1:178019824-178019846 CTGTGTGTGTGTGGGGCTCTGGG - Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
920115415 1:203617370-203617392 CCCTGAGTGTCTGGGGCAGCAGG - Intergenic
920972291 1:210753210-210753232 CCCCAAGTGTGTGGGGGACATGG + Intronic
922612538 1:226940811-226940833 CACTGTGTGTCTGGGGCTCTAGG + Intronic
1064119463 10:12606247-12606269 TGCTGTGTGTGAGGGGCCCATGG - Intronic
1064564311 10:16624512-16624534 CCCTGGGAGTCTGGGGCACAAGG - Intronic
1065126946 10:22583346-22583368 CCCATTGTGTGTGGGGTACAGGG - Intronic
1066337442 10:34493323-34493345 ACCTGTCTGCGTGTGGCACAGGG + Intronic
1069656013 10:70089195-70089217 CTCTCAGTCTGTGGGGCACAGGG - Intronic
1070562102 10:77575853-77575875 CCCTCTGGGGGTGGGGCCCAGGG - Intronic
1071158814 10:82722610-82722632 TCCTGTGTGTGTTGAGCTCAGGG - Intronic
1071231934 10:83598054-83598076 GGCTGTGTGTGTGTGGCACTGGG + Intergenic
1071498970 10:86190168-86190190 CACTATGTGAGTGGGACACATGG + Intronic
1072195784 10:93116266-93116288 CACTGTCTTTGAGGGGCACAAGG - Intergenic
1073332397 10:102679004-102679026 CCCTGAGTGTGGGAAGCACAGGG + Intronic
1073447767 10:103591483-103591505 GCCTTTGTGTGTGGGGTACCTGG + Exonic
1075610500 10:123851195-123851217 CCCTGTGGTGGTGGGGAACATGG - Intronic
1076207701 10:128616266-128616288 GCCTGTGTGGAAGGGGCACAAGG - Intergenic
1076573934 10:131451621-131451643 ACCTGGGTGTTTGGGGCTCAGGG + Intergenic
1077036852 11:499497-499519 CTCAGTGTGTGTGGGGGACCCGG - Intronic
1077159252 11:1105204-1105226 TCCTCCGTGTGTGGGGCACTGGG + Intergenic
1077176412 11:1193181-1193203 CACTGGGTGTGTGGGGCCGAAGG + Intronic
1077241732 11:1514084-1514106 CCCGGTGTGGGAGGGGCAGAAGG + Intergenic
1077283532 11:1756108-1756130 CCATGTGGGGGAGGGGCACACGG - Intronic
1077438316 11:2555578-2555600 TCCTGTGTGTGCGGGGCCCTGGG + Intronic
1077453540 11:2664720-2664742 CCTGGTGTGTGTGAGGGACAGGG + Intronic
1077477181 11:2795961-2795983 CCCTGTGTGAGTGGGGCAGGGGG - Intronic
1077734875 11:4780438-4780460 TCCTGTGTGTATTGGACACATGG + Intronic
1078511415 11:11987083-11987105 CCCTGTGTCTGTGCTGGACATGG - Intronic
1079161557 11:17999652-17999674 GTCTGTGTGTGAGGGGGACAGGG - Intronic
1081911888 11:46705110-46705132 CCCTGTGTGTGGGCGGCCCCTGG + Exonic
1082944823 11:58747104-58747126 ACCTTTGTCTGTGGGGCAAATGG - Intergenic
1083372525 11:62193252-62193274 CCCAGTGTGTGTGGGAAACCAGG - Intronic
1083742991 11:64721010-64721032 CCGTGTGTGTGTTGTGTACATGG + Intronic
1084001242 11:66296338-66296360 CCCTGCGTGTGTGTGGCTGATGG - Exonic
1084264931 11:68000020-68000042 CACTGTGTCTGTAGGGCCCAGGG + Intronic
1084506119 11:69569638-69569660 GCCTGTGTGTGTGGCGCTCAGGG - Intergenic
1084715091 11:70868671-70868693 CCCTGTGTGGGTGGGGCCCTGGG - Intronic
1085278325 11:75314157-75314179 CCCTGTGTTAGTGGGGCCCCAGG - Intronic
1085508504 11:77073613-77073635 CCATGTGTGTATGGGGAACAGGG - Intronic
1085510788 11:77087079-77087101 AGCTGTGTGAGTGGGGCCCAAGG + Intronic
1088014691 11:105044653-105044675 CCTTGTCTGTTTGGAGCACAAGG + Exonic
1088019359 11:105100774-105100796 CCTTGTCTGTTTGGAGCACAAGG + Exonic
1089306660 11:117530574-117530596 CCTCGTGTGTGTTAGGCACAGGG + Intronic
1089366699 11:117924957-117924979 CCCTGGGGGTGGGGGGCACGGGG + Intronic
1089609476 11:119661421-119661443 CCCTGTGGGTGTGGGGACCTGGG + Exonic
1089812452 11:121143188-121143210 CCATGTGTGTATGGGATACAAGG + Intronic
1090736337 11:129614785-129614807 GCCTCTCTGTGTGGGCCACAGGG - Intergenic
1091617364 12:2059597-2059619 CCCTGTGTGTATAGGGGGCAAGG + Intronic
1094216921 12:27952292-27952314 CCCTGTGTGGGCAGTGCACAGGG + Intergenic
1094301300 12:28967601-28967623 CACTGTGTATGTTGTGCACAAGG - Intergenic
1094856721 12:34406159-34406181 GCATGTGTGTGTGGGGCCCATGG + Intergenic
1094870739 12:34597932-34597954 CACAGAGTGTGTGGGGCCCATGG + Intergenic
1094871633 12:34602189-34602211 CCCGGCATGTGTGGGGCCCAGGG + Intergenic
1096198508 12:49664525-49664547 CCCTGTGTGTGAGGGCAAGAAGG - Intronic
1096952040 12:55483851-55483873 ACCTGTGTGTGTGTGGCAGGGGG - Intergenic
1101743987 12:107523902-107523924 GACAGTGTGTGTGGGCCACATGG - Intronic
1101800826 12:108020652-108020674 CCCAGTGTGTGTGGTTCAGATGG + Intergenic
1102164595 12:110796260-110796282 CCTGGTGTGTATGGGGAACAGGG + Intergenic
1103155385 12:118680319-118680341 TCTTGTGTGTGTGGGACCCACGG + Intergenic
1104440689 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG + Intergenic
1104656002 12:130574529-130574551 CCCAGTGTGTGTGAGAGACATGG + Intronic
1106259551 13:28053857-28053879 CCGTGTGTGTGTGTGAGACAGGG + Intronic
1106585677 13:31054412-31054434 GTCTGTGTGTGTTGTGCACAGGG - Intergenic
1106791412 13:33158605-33158627 CTCTGTGTCTTTGGTGCACAAGG + Intronic
1108684199 13:52804698-52804720 CCCTGTGGGTGTGGAGGAGAGGG - Intergenic
1109074378 13:57815619-57815641 CCTTGTGTGTTTGAGGAACAGGG + Intergenic
1110320943 13:74159209-74159231 CCCTGTGTGTTTGCCACACAGGG - Intergenic
1111546123 13:89738790-89738812 CCTTATGTGTATGGTGCACATGG + Intergenic
1112036989 13:95506162-95506184 GCCTGTGTGTGTGTGTCACATGG + Intronic
1113682014 13:112251137-112251159 CCCAGTGTGTGCCAGGCACATGG - Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1117340864 14:54790013-54790035 ACCTGTGTGTGTGTGGAGCAAGG - Exonic
1117548926 14:56814657-56814679 CCCTGAGAGTGTGGGGACCAAGG + Intergenic
1118720679 14:68591615-68591637 CCCTGTGTGTGTGTGGCCGGTGG + Intronic
1119939550 14:78625795-78625817 CCATGTGTGTGTGAGGCTCAAGG + Intronic
1121467306 14:94124317-94124339 CCCTGTGTGTTTGGGGCTTAGGG + Intergenic
1122033476 14:98930848-98930870 ACCTCTGTGTGTGGAGCTCACGG - Intergenic
1122089797 14:99330711-99330733 CCCAGTGTGTGTGGGGAGCTGGG - Intergenic
1122994267 14:105254130-105254152 CCCTGTGTCTCTGGGACACAAGG - Intronic
1123143398 14:106105273-106105295 CCCTGTGGGTGTGGGGGACAGGG + Intergenic
1123191486 14:106576270-106576292 CCCTGTGGGTGTGGGGGACAGGG + Intergenic
1125370813 15:38974610-38974632 CTGTGTGTGTGTGTGACACATGG - Intergenic
1125460170 15:39898848-39898870 CACTGTGTGGGTGGGGGAGAAGG + Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125919441 15:43516990-43517012 GCCTGTTGGGGTGGGGCACAGGG - Intronic
1127735029 15:61831847-61831869 CCCTGTCTGTGTGACCCACAAGG + Intergenic
1128337470 15:66796503-66796525 CCCTGTGAGTAGGGGGCACTAGG - Intergenic
1128754153 15:70170107-70170129 ACCTGTGTGTGTGAGGAAGATGG + Intergenic
1128861447 15:71077603-71077625 TCCCATGTGTGTGGGACACAGGG - Intergenic
1129743080 15:77999601-77999623 CTCCGTGTGAATGGGGCACAGGG + Intronic
1129910170 15:79220390-79220412 CCCTGTGGGGGTGGGAAACAGGG - Intergenic
1130254072 15:82317747-82317769 CTATGTGAGTGTGGGGCCCAGGG + Intergenic
1130600900 15:85272224-85272246 CTATGTGAGTGTGGGGCCCAGGG - Intergenic
1130821768 15:87503340-87503362 CCCTGGGTGAGTGGGGAGCAGGG + Intergenic
1132009695 15:98265438-98265460 CCCTGCCTGGATGGGGCACAGGG - Intergenic
1132013709 15:98298028-98298050 CCCTGGGTGAGTGGGGCTCTGGG + Intergenic
1132110459 15:99098940-99098962 AACTCTGTGTGTGGGGCCCAGGG + Intronic
1132294705 15:100726607-100726629 CCCAGTGTGTGTTGGACTCAGGG - Intergenic
1132497291 16:269880-269902 CCCTCACTCTGTGGGGCACACGG - Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1133143670 16:3767521-3767543 CCCTGTGCCTGTGGGGCTCATGG - Intronic
1133297859 16:4763943-4763965 CCTTGCGTGGATGGGGCACATGG - Intronic
1133944913 16:10340037-10340059 GCCTGTATGTGTGGGTCACAGGG + Intronic
1134453231 16:14376158-14376180 CCAGCTGTGTGAGGGGCACAGGG + Intergenic
1135289594 16:21223891-21223913 CCCTGTGGGCGTGGGGCAGGAGG + Intergenic
1136284155 16:29231454-29231476 CCCAGTGTGTGTGGGCGAGAGGG + Intergenic
1137264531 16:46858010-46858032 CCCAGTGTGTGTGGGGGCCAAGG + Intergenic
1137483902 16:48875952-48875974 CCCTGTGTGAGTCAGGCAGAGGG - Intergenic
1137677642 16:50311604-50311626 CCCTGGGTGTGCGTGGCACCTGG + Intronic
1137710864 16:50565990-50566012 CAGTGTGTGTCGGGGGCACAGGG - Intronic
1138029291 16:53547099-53547121 CCCTGTGTGTCTGGGGCCCATGG - Intergenic
1138413120 16:56855181-56855203 CGTTGTGTGTGAGGGGCTCAGGG + Intergenic
1139003146 16:62538818-62538840 TCCTGTGTTTGTGAGACACACGG - Intergenic
1139670475 16:68489878-68489900 CCCTCTTTGTCTGGGGCCCAGGG - Intergenic
1139842764 16:69894837-69894859 CTCTGTGTGTGTGGGACCGAGGG - Intronic
1140440665 16:74985086-74985108 CTCTGGCTGTGTGGGGCGCACGG - Exonic
1140468907 16:75204066-75204088 GCCTGTGTCTGTGTGGCCCAGGG - Intergenic
1141390840 16:83662025-83662047 CCCTGGGTGGGTGGGTCACATGG + Intronic
1142043005 16:87907330-87907352 GCCTGTGTCTGTGGGGGAAAGGG + Intronic
1142221703 16:88858075-88858097 CCCTGTGTGTGTTCAGCACTGGG - Intronic
1142289578 16:89187408-89187430 ACCTGGGGATGTGGGGCACAGGG - Exonic
1142482309 17:226611-226633 CCGTGTTTGTGTTGGGCCCAGGG - Intronic
1143256662 17:5562553-5562575 TTCTGTGTGTGTTGGGGACAGGG - Intronic
1143439426 17:6957572-6957594 ACCTGTGTGTGTGGGGTAGGAGG - Intronic
1144198149 17:12915674-12915696 CATTGTGTGCCTGGGGCACAAGG - Intronic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144742569 17:17592087-17592109 CCCTGGGCGTGTGGGGCCCTGGG - Intergenic
1147189110 17:38728770-38728792 CCCTGTGTGTGTGTGACACACGG + Exonic
1148133214 17:45274668-45274690 GCCTCTGTGTGTGGAGCACTAGG - Intronic
1148675101 17:49440328-49440350 CCCAGTGTGGGTGGGGCTCCAGG - Intronic
1148770343 17:50062706-50062728 ACCTGTGAGTGTGGGCTACAGGG - Intronic
1152226605 17:79095657-79095679 CCCTGTGCGGGTGGGGCCCTGGG + Intronic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1153957798 18:10112962-10112984 CCCTCTGTAGGTGAGGCACAGGG - Intergenic
1156803874 18:41152656-41152678 CACTGAGGGTGTTGGGCACATGG - Intergenic
1157404397 18:47410877-47410899 TCCTGTCTGTGTGGGGCCCGGGG - Intergenic
1157406292 18:47424875-47424897 CCCTTGGTGTGTGGGGCAGAAGG + Intergenic
1157492822 18:48136242-48136264 CCCGGTGTGGGTGGCGCAAAAGG - Intronic
1158395687 18:57077160-57077182 GCCTGAGTCTGTGGGGCAGAGGG + Intergenic
1158420931 18:57293328-57293350 GGCTGTGCGTGTGTGGCACAGGG - Intergenic
1160349544 18:78164555-78164577 GTCTGTGTATGTGGGTCACATGG + Intergenic
1160528310 18:79549765-79549787 ACCCGTGTGTGTGGAGCAGAAGG + Intergenic
1161062048 19:2220071-2220093 CCCTGTGTGTCAGGGGCAGCAGG - Intronic
1161322043 19:3645832-3645854 CCCGGTCTGAGGGGGGCACAGGG + Intronic
1162545583 19:11327191-11327213 CCCTCTCTGTGTCGGGCACTGGG - Intronic
1162555201 19:11382205-11382227 CCTTGTGTGTGTGTGTGACAAGG + Intronic
1162804272 19:13128926-13128948 CCCTGAGGGTGTGGGGGACAAGG - Intronic
1163314518 19:16532851-16532873 CCATGAGCGTGGGGGGCACAGGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163630024 19:18413578-18413600 CACTGAGAATGTGGGGCACATGG + Intergenic
1164815135 19:31193052-31193074 CCCAGTGCCTGTGTGGCACAGGG + Intergenic
1165351905 19:35280168-35280190 CCCTGGGGGTGAGGGGCTCAAGG - Intergenic
1165790522 19:38488962-38488984 GGCTGTGTGGGTGGGACACAGGG + Intronic
1166751497 19:45165866-45165888 GCCTGTGTGTGTGGAGGGCATGG + Intronic
1167486030 19:49763371-49763393 CCCAGTGAGTGGGGGGCACAGGG + Intergenic
1167740061 19:51319139-51319161 TCCTGTGTGTCTGGGGGATAGGG + Intronic
1168188264 19:54716102-54716124 CCCTGTGTGTGTGGACCCTAGGG + Intergenic
926113401 2:10196597-10196619 CCCTCTGTGTGTGGATCCCATGG + Intronic
926434879 2:12827604-12827626 CCCAGTGGGTGTGGGTTACAGGG + Intergenic
927095711 2:19746383-19746405 GCCTGCATGTGTGGGGCACATGG + Intergenic
927340768 2:21981305-21981327 CCCTGTGTGGATGAGTCACAAGG + Intergenic
929557719 2:42936082-42936104 CCCAGTGTGAGGGGGGCACTGGG - Intergenic
931869276 2:66441498-66441520 CCCTGTGTGTTTGGGGGTAAGGG - Intronic
933262448 2:80145825-80145847 ACCAGTGTGTGTGCGGCAAATGG - Intronic
934615298 2:95766999-95767021 GCCTGTACGTGTGGGTCACAGGG + Intergenic
934645608 2:96057560-96057582 GCCTGTACGTGTGGGTCACAGGG - Intergenic
934654537 2:96110312-96110334 CCCTGTGTGTGGGGGGCCACTGG - Intergenic
934839012 2:97613649-97613671 GCCTGTACGTGTGGGTCACAGGG - Intergenic
935225426 2:101048094-101048116 CCCTGTGTGTGTGGGGCACATGG - Intronic
935681095 2:105637883-105637905 CCATGTGTGTGGGGGGTAAAAGG - Intergenic
936239304 2:110773398-110773420 CCCTGAGTGTGTTGTGCAAAAGG + Intronic
938247931 2:129793269-129793291 CCCTGTGTCTGGGTAGCACAAGG - Intergenic
938308338 2:130269078-130269100 CCCTGTCTCTGGGGGGCCCATGG - Intergenic
938446991 2:131387758-131387780 CCCTGTCTCTGGGGGGCCCATGG + Intergenic
939001835 2:136745620-136745642 CCCAGTGTGTCTGGGGAGCAGGG - Intergenic
939638758 2:144614049-144614071 CTCTGAGTGTTTGGGGCAGAAGG - Intergenic
939841915 2:147199422-147199444 GCTTGTGTGGGTGGGACACATGG + Intergenic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
945784203 2:214213169-214213191 CCCTGTGTGTGTGAGAAACTGGG - Intronic
946044428 2:216809932-216809954 CTCTGTGTGACGGGGGCACAGGG - Intergenic
946182995 2:217960132-217960154 CCCAGTGAGTGGGGGGCAGAAGG + Intronic
947217102 2:227759514-227759536 GCCTGTACGTGTGGGTCACAGGG - Intergenic
948744640 2:240079652-240079674 CACTGTGTGTGTGGGCCTCTTGG - Intergenic
948940528 2:241193429-241193451 CTCTGTGTGTGTGAGGCTTAAGG + Intronic
1168958570 20:1852158-1852180 CCCTGTGTGAGAGGGGCACCAGG + Intergenic
1169192983 20:3669529-3669551 CCCTGGGTGAGTGAGGCACCAGG - Exonic
1170355659 20:15489519-15489541 CAGAGTGTGTGTGGGGCCCAAGG - Intronic
1171118396 20:22547144-22547166 GCATGTGGGTCTGGGGCACATGG + Intergenic
1171823563 20:29876019-29876041 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1171896527 20:30814326-30814348 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1172605675 20:36212022-36212044 CCATGAGGGTGTGTGGCACAGGG + Intronic
1172739939 20:37158427-37158449 CCCTGTGGTTGGGAGGCACATGG - Intronic
1172774002 20:37396866-37396888 CCGTGTGTCTGTGGCACACATGG + Intronic
1173644536 20:44625459-44625481 CCATGGGGCTGTGGGGCACAGGG + Intronic
1174130689 20:48341633-48341655 CCCTGTGTGGCTGTGGCCCAAGG - Intergenic
1174271135 20:49369532-49369554 CCCCGTGTGATTGGGACACATGG + Exonic
1174783980 20:53415484-53415506 GGCTGTGTGTGTGGGGTGCATGG - Intronic
1175140791 20:56859226-56859248 TTCCGTGTGTGGGGGGCACATGG - Intergenic
1175287460 20:57846509-57846531 CACTTTATGTGTGGGGCACAGGG - Intergenic
1175646518 20:60677800-60677822 CCCTCTGTGTGTTGTTCACATGG + Intergenic
1176063081 20:63180631-63180653 CCCAGTAGGTATGGGGCACACGG + Intergenic
1176218466 20:63959084-63959106 CCCTGGGGGTGTGGGGCCCCTGG - Exonic
1176299955 21:5094855-5094877 CCCTGAGCGTGAGGGGCACTGGG + Intergenic
1176878777 21:14166768-14166790 CCCAGTGTGAGTGGTGCAGAAGG + Intronic
1177093617 21:16802129-16802151 CTCACTGGGTGTGGGGCACACGG - Intergenic
1177792789 21:25738227-25738249 CCATGTGTGTGTTGGGGGCAGGG - Intronic
1178024245 21:28447224-28447246 CACTGTATGTGTGGTCCACAGGG - Intergenic
1178365594 21:31986635-31986657 CGCTGTGTGTGTGGGCCATGTGG - Intronic
1178519864 21:33280251-33280273 TGCGGTGTGTGTGGGACACAGGG - Intronic
1179017587 21:37606454-37606476 CCCTGTGTGTCTGTCGCACTTGG - Intergenic
1179308438 21:40175916-40175938 CCTTGTGTGTGTCTGGCATAAGG - Intronic
1179522662 21:41955123-41955145 GCGTGTGTGTGTGGTGCACAGGG + Intergenic
1179556813 21:42184198-42184220 GCCTGTGTGTGTGGTGTGCATGG + Intergenic
1179857067 21:44167056-44167078 CCCTGAGCGTGAGGGGCACTGGG - Intergenic
1180241613 21:46511024-46511046 TCCTGTGTGAGTGGGCCACCAGG + Intronic
1180338301 22:11598945-11598967 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1180816490 22:18792758-18792780 CCCTGTGTGTGGGGAGGGCACGG - Intergenic
1181202677 22:21227090-21227112 CCCTGTGTGTGGGGAGGGCACGG - Intronic
1181464105 22:23101615-23101637 ACCTGTGTGTGTCGGGAAAAGGG - Intronic
1181551320 22:23640425-23640447 TGCTGGGTGTGAGGGGCACAGGG + Intergenic
1181796942 22:25318236-25318258 TGCTGGGTGTGAGGGGCACAGGG - Intergenic
1181921135 22:26321318-26321340 CCCTGTGTGTCTGGAGTTCAAGG + Intronic
1182028038 22:27135784-27135806 CTGTGTGTGTGTGTGTCACAGGG - Intergenic
1182103078 22:27671047-27671069 CGCAGTGTGTATGGGGCCCAGGG - Intergenic
1183423645 22:37726042-37726064 CCCTGTGTGCATTGGGCACCGGG + Exonic
1183501487 22:38182036-38182058 CCATGTTTGTGCGGGGCAGAAGG + Intronic
1183570574 22:38650319-38650341 CCCTGTGTAGCTGGGGAACATGG - Intronic
1184481752 22:44752428-44752450 ACCTGTGTGTCGGGGGGACAGGG - Intronic
1184635979 22:45831911-45831933 CACTGAGTGTGTTGTGCACATGG + Intronic
1184643362 22:45883649-45883671 CTATGTGTGTCTGGGGCTCAGGG - Intergenic
1184784194 22:46663899-46663921 CTCAGTGTGGGTGGGGCCCATGG + Intronic
1185289756 22:50017438-50017460 CCCTGGGTGCCTGGGGGACAAGG - Intronic
1203224236 22_KI270731v1_random:68323-68345 CCCTGTGTGTGGGGAGGGCACGG + Intergenic
1203266590 22_KI270734v1_random:18469-18491 CCCTGTGTGTGGGGAGGGCACGG - Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
949953900 3:9251845-9251867 CCAGCTGTGTGTGGGGCTCATGG + Intronic
950240580 3:11366371-11366393 CCTTGTGTGTGGGGGACAGAGGG - Intronic
951355630 3:21663470-21663492 CCCTGGGTGTCTGGGACACAAGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
953730947 3:45447535-45447557 CTCTGTGTGTGTGTGTCATACGG + Intronic
953883665 3:46704151-46704173 CCCTGGGTGTCTAGGGGACACGG - Intronic
953883697 3:46704257-46704279 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883750 3:46704447-46704469 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883801 3:46704612-46704634 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883810 3:46704639-46704661 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883833 3:46704721-46704743 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883842 3:46704749-46704771 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883867 3:46704831-46704853 CCCTGGGTGTCTAGGGGACATGG - Intronic
953883876 3:46704858-46704880 CCCTGGGTGTCTAGGGGACATGG - Intronic
954181087 3:48881805-48881827 GCATGTGTCTGTGGGACACAAGG + Intronic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
955066570 3:55538338-55538360 AACTCTGTGTGTGGGTCACAGGG + Intronic
956909659 3:73804387-73804409 CACTCTGTGTGTGAGGAACATGG + Intergenic
957132038 3:76235281-76235303 CCCTGTGTGTGTTGGGCGGTGGG - Intronic
959018680 3:101164933-101164955 CCCAGTGTGTGAGGGGCAGTCGG + Intergenic
960997831 3:123351401-123351423 GCCTTTGAGTGTGGGGGACACGG - Intronic
961163130 3:124746285-124746307 CTCTGATGGTGTGGGGCACAAGG - Intergenic
961354766 3:126330205-126330227 TCCTGTGTCTGTGGGGAACGAGG - Intergenic
961384633 3:126516630-126516652 CCTTGTGGGAGTGGGGCACTGGG - Intronic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
962275922 3:134013441-134013463 CCCTGTTGGTGGGGGGCAAAGGG - Intronic
962446014 3:135466187-135466209 CCATGTGTTTGTGGGCCACCTGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964492061 3:157247541-157247563 CGCTGTCTGTTTGGGCCACATGG + Intergenic
964985372 3:162732060-162732082 GCCTGTACGTGTGGGTCACAGGG - Intergenic
965640939 3:170828410-170828432 CCATGTGAGTCTGGGTCACATGG - Intronic
966463470 3:180203302-180203324 ACCTGGGTTTGGGGGGCACATGG + Intergenic
967100319 3:186210616-186210638 CCCTGTGAGTGAGGAGCACAGGG + Intronic
967936583 3:194732941-194732963 CCATGTGTGGCTGGAGCACAGGG + Intergenic
968232586 3:197012402-197012424 CCCTCACTGTGTGGGGCATACGG + Intronic
968651318 4:1761373-1761395 CACGGGGTGGGTGGGGCACACGG - Intergenic
969158319 4:5232801-5232823 ACCTATTGGTGTGGGGCACAGGG - Intronic
969405875 4:6991423-6991445 CCGTGTGTGTTTGGTGCACAGGG + Intronic
972343688 4:38175185-38175207 CCCAGTGTTTCTGGGGCAGATGG - Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
973605453 4:52582895-52582917 CAGTGTGTGTTGGGGGCACAGGG + Intergenic
975699077 4:77044546-77044568 GCCTGTGTGTGTGAGAGACAGGG - Intergenic
981088480 4:140708525-140708547 CAGTCTGTGTGTTGGGCACAAGG - Intronic
982633635 4:157864823-157864845 CTCTGTGTGTGTGTGGCAGTTGG + Intergenic
983462471 4:168045546-168045568 GTGTGTGTGTGTGAGGCACAAGG - Intergenic
985186887 4:187327166-187327188 ACGTGTGTGTTTGTGGCACAGGG + Intergenic
985309499 4:188581697-188581719 CCCTATGTGCGTGGGGCAGAGGG + Intergenic
985445035 4:190017207-190017229 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
985720735 5:1487267-1487289 CCCAGTGTGGTGGGGGCACACGG + Intronic
985768341 5:1793588-1793610 CTCTGTGTGTGGGAGACACATGG + Intergenic
985844631 5:2335068-2335090 CCCTGTGTGCGAGTGGCTCAGGG + Intergenic
986740809 5:10703765-10703787 GCCTGGGTGTGGGGGGCACAGGG + Intronic
987067614 5:14304741-14304763 CCCTGTGTGTGTGGGGAGTGGGG + Intronic
988975187 5:36508385-36508407 CTCTGTGGGTGTGGGACCCATGG - Intergenic
990121293 5:52456380-52456402 CTCTGACTGTGTGGGGAACAAGG + Intergenic
994330738 5:98502835-98502857 ACCTTTGTGTGTGGGGGGCAGGG + Intergenic
995439141 5:112170806-112170828 CACTGTGTGTGGCAGGCACATGG - Intronic
995506668 5:112868023-112868045 CCTTTTGTGGGTGGGGGACAGGG + Exonic
995768158 5:115640836-115640858 CCCTGTTGGTATGGGGCAAATGG + Intergenic
996301245 5:121988736-121988758 CTCTGAGTCTGTGGGCCACAAGG - Intronic
996569054 5:124912752-124912774 CCCGCTGTGTGAGGGGGACAAGG - Intergenic
997819948 5:137056257-137056279 CCATGTGGGGGTGGGGGACAGGG + Intronic
999176075 5:149632530-149632552 GCCTGTGGGCGTGGGTCACACGG + Exonic
1001470713 5:172010567-172010589 CCCTTTGTGTGTGGGGAGGAAGG - Intergenic
1002092356 5:176812844-176812866 CCCAGTGCCTGTGGGGCACAGGG - Intronic
1003880676 6:10477075-10477097 CTCTGCTTCTGTGGGGCACATGG + Intergenic
1006185157 6:32177399-32177421 CCCTTTGTGAGTGGTGCAAAAGG - Intronic
1006295758 6:33169364-33169386 CCCTGTGAGTTTGGGGCAGTGGG - Exonic
1006364446 6:33607192-33607214 CCTTTTGTGTGTGGGACAAAGGG + Intergenic
1006865323 6:37205166-37205188 CCCTGTGTGTCTGGGAGTCAGGG + Intergenic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1009933709 6:70207167-70207189 CCCTGTGGGCCTGGGGCACCTGG - Exonic
1010545705 6:77152529-77152551 ATCTGTGTGAGTGGGGCAGAAGG - Intergenic
1017332404 6:153215156-153215178 CCCTGAGTGGGTGGGTCGCAAGG + Intergenic
1018915560 6:168130492-168130514 GGCTGAGTGTGGGGGGCACACGG + Intergenic
1018960377 6:168443197-168443219 CCCTGTGTGTGTGGGGGGTGGGG + Intronic
1019011906 6:168849605-168849627 CCCTGTGTGTCAGGGGCTCAGGG - Intergenic
1019601375 7:1885481-1885503 GCGGGTGTGTGTGGGCCACAGGG + Intronic
1020097590 7:5377352-5377374 TACGGTGAGTGTGGGGCACAGGG - Exonic
1023714110 7:43025904-43025926 CCTTGTGTGTAGGGTGCACATGG - Intergenic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1024605016 7:51015762-51015784 GCCTGGGTGTTAGGGGCACAAGG - Intergenic
1024765172 7:52649424-52649446 GCCTGGGTGTGTGAGGCTCAGGG - Intergenic
1025615213 7:63112490-63112512 GTCAGTGTGTGTGGGGCGCAGGG - Intergenic
1025739598 7:64184119-64184141 GTCAGTGTGTGTGGGGCACAGGG + Intronic
1026582858 7:71632574-71632596 GTCTGTGTGTGTTGGGGACAAGG + Intronic
1027116473 7:75485778-75485800 ACCTTTGAGTGTGGGGCAGAGGG - Intronic
1027545835 7:79526512-79526534 CCCAGGGTGTGGGGGGCTCAGGG - Intergenic
1029425791 7:100493484-100493506 CCCTCTGGCTGTGGGGCCCATGG - Intronic
1029968757 7:104768452-104768474 CCCTAGGTGTGTGGGTGACAGGG - Intronic
1030397530 7:109006258-109006280 CACTGTGTAAATGGGGCACATGG + Intergenic
1031678106 7:124635687-124635709 CCCTGTATGACTGGGGCACAGGG - Intergenic
1031887648 7:127257763-127257785 TCCTGAGTGTGTGTGGCAGAGGG - Intergenic
1031908210 7:127485159-127485181 AGCAGTGTGGGTGGGGCACAGGG - Intergenic
1034309986 7:150079029-150079051 CCCTGTGTATGTGGGGATGAAGG - Intergenic
1034530706 7:151694828-151694850 CCCTCGGTGTTGGGGGCACATGG - Intronic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1034872224 7:154694888-154694910 GCATGTGTGTGTGTGGCACGAGG - Intronic
1035056866 7:156041621-156041643 CCCTGTGTCTGGGGGGCCCAGGG - Intergenic
1035244128 7:157551462-157551484 CACAGTGTCTGTGGGGTACATGG - Intronic
1035388721 7:158490932-158490954 CCCTCTGTGTGTCTGGCACAGGG + Intronic
1035429294 7:158805999-158806021 CCCTGTGTCCCTGGGGCCCATGG - Intronic
1035828979 8:2674444-2674466 CCCTGCGTGTGTGGTGAACCTGG - Intergenic
1037710746 8:21353513-21353535 CACTGTCTGGGTAGGGCACATGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1040859460 8:51984182-51984204 CCCTTTGTGCCTGGAGCACAGGG - Intergenic
1040877414 8:52167782-52167804 ACCAGTGTGGGTGGGGCCCACGG + Intronic
1041586285 8:59523702-59523724 CCCAGTGTGTGTGTGTTACAGGG - Intergenic
1042723523 8:71848719-71848741 CCCAGTGTGTGTTGGCCACGTGG + Intronic
1043348780 8:79333530-79333552 ACTGGTGTGTGTGAGGCACAGGG - Intergenic
1045227933 8:100268784-100268806 TCCTGTGTATGTGGGCCGCAAGG - Exonic
1046254626 8:111680310-111680332 CCTTATGTCTGTGGGGCCCAGGG - Intergenic
1046294653 8:112201878-112201900 ACCTGTATGTGTGGGTCACAGGG - Intergenic
1047251213 8:123183091-123183113 CCCAGGGTGTCTGGGGGACACGG - Exonic
1047622595 8:126623061-126623083 CCCTGTGTTATTGGGGCACCAGG + Intergenic
1048082941 8:131148665-131148687 CCCTGTGGGTGTGTGTTACAGGG + Intergenic
1049206136 8:141364519-141364541 GCCTGTGGGCGTGGGGGACAGGG - Intronic
1049287930 8:141786676-141786698 CCCTGAGTGCGAGGGGCACGAGG - Intergenic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1049412841 8:142481140-142481162 CCCTGTTTCTGGGGGCCACAGGG + Intronic
1049624552 8:143614194-143614216 CCCTGACGGTGTGGGGTACAGGG - Exonic
1051911016 9:22154392-22154414 GTCAGAGTGTGTGGGGCACAGGG + Intergenic
1051911056 9:22154499-22154521 GTCAGAGTGTGTGGGGCACAGGG + Intergenic
1053749164 9:41235639-41235661 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054254601 9:62800492-62800514 CTCTGGGTGTGTGGGGCAAGAGG - Intergenic
1054336702 9:63815110-63815132 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1055492927 9:76824942-76824964 CCTTGTGTGTATGCTGCACAAGG - Intronic
1055931407 9:81563266-81563288 CCCTGTGTATGTGAGACACCTGG + Intergenic
1056820117 9:89835321-89835343 CCCTGTGTGTGTGGTGCCCAGGG + Intergenic
1057214830 9:93222053-93222075 CCTTCTGTGTGTGGGTGACAGGG + Intronic
1057420303 9:94906917-94906939 CTCTGTGTCTGTGGGTCACCAGG - Intronic
1058485095 9:105435668-105435690 GCCTGTATGTGTGGGTCAGAGGG + Intronic
1058897129 9:109410188-109410210 CCCTGGGTGTGTGGATCACCCGG + Intronic
1061289105 9:129640829-129640851 CCCTGGCTCTGTGGGTCACAGGG + Intronic
1061370001 9:130192763-130192785 CCTTGTGTGCTTGGGGCACCTGG + Intronic
1061799387 9:133105718-133105740 CCCTGGGTGTTTGAGGGACAGGG - Intronic
1061899723 9:133666637-133666659 CCCTGAGTGTGCCGGGCATAGGG - Intronic
1062446705 9:136598283-136598305 CCATGAGCGTGTGGGACACATGG + Intergenic
1062545837 9:137063477-137063499 GTCAGTGTGTGTGGGGCGCAGGG - Exonic
1062616405 9:137398515-137398537 GCCTGTGTGTCTTGGGGACATGG - Intronic
1062672924 9:137722543-137722565 GGCTGTGTGTGTGGGCCCCACGG + Intronic
1203376634 Un_KI270442v1:382535-382557 CTCTGGGTGTGTGGGGCAACAGG + Intergenic
1186180485 X:6968432-6968454 CCCTGTGGGTCTGGGGCAGGGGG + Intergenic
1186524560 X:10236514-10236536 CCCTGGGTGAGTGGACCACATGG - Exonic
1188881419 X:35496748-35496770 GCCTGTATGTGTGGGTCACAGGG - Intergenic
1189272132 X:39759293-39759315 CCCTGAGTCTGTGGGCCACGTGG - Intergenic
1194387456 X:93273704-93273726 CCCTGTGGGTGTCTCGCACAGGG + Intergenic
1194816303 X:98446199-98446221 TCCTGTTTGTGTGAGGCTCAGGG + Intergenic
1195688599 X:107605977-107605999 CCCTCTGTGTGATGGGCACATGG + Intergenic
1196857350 X:119996692-119996714 CCCTTTTTGTGGGGGACACAGGG - Intergenic
1196870408 X:120108272-120108294 CCCTTTTTGTGGGGGACACAGGG - Intergenic
1198138620 X:133780337-133780359 GCCTGTTTGTGAGAGGCACAAGG - Intronic
1200425456 Y:3015609-3015631 GCATGTGTGTGTGGGGGACAGGG + Intergenic
1201073418 Y:10169952-10169974 CTCTGGGTGTGTGGGGCAAGAGG + Intergenic
1201934031 Y:19386628-19386650 GCCTTTGTGTTTGGGGCCCAAGG + Intergenic