ID: 935225936

View in Genome Browser
Species Human (GRCh38)
Location 2:101053235-101053257
Sequence AAGCATTTCAAAAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 657}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935225931_935225936 26 Left 935225931 2:101053186-101053208 CCAATAGGCTAAGTACAGAGAAA 0: 1
1: 0
2: 0
3: 14
4: 194
Right 935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG 0: 1
1: 0
2: 4
3: 71
4: 657
935225934_935225936 -7 Left 935225934 2:101053219-101053241 CCAGGTGTACTTTGAAAAGCATT 0: 1
1: 0
2: 0
3: 34
4: 202
Right 935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG 0: 1
1: 0
2: 4
3: 71
4: 657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935225936 Original CRISPR AAGCATTTCAAAAAGAAGGA AGG Intronic
901251039 1:7780462-7780484 CAGCCTTTCAAAAGGAAGAAAGG - Exonic
901430123 1:9209062-9209084 AAACATTTGTAAATGAAGGAAGG + Intergenic
901762993 1:11482664-11482686 AACCATTTCAAAGAGGGGGAAGG - Intronic
901809502 1:11759396-11759418 AAGCAATTCTTGAAGAAGGAGGG - Intergenic
901894560 1:12299716-12299738 AAGCATTATAAAAAGATGGAAGG - Intronic
903054775 1:20628030-20628052 CTGAATTTCAAAAGGAAGGAAGG - Intergenic
903583353 1:24389010-24389032 AAGCATTTTAGAAATAAGGATGG - Intronic
903638393 1:24837457-24837479 AAGCATTTGAGGAAGAAGTAAGG + Intronic
903803932 1:25990687-25990709 AAGCAGTGCAAACAGAAGAAAGG + Intronic
905970848 1:42141246-42141268 AATGATTAGAAAAAGAAGGAAGG + Intergenic
905999243 1:42409746-42409768 AGTCATTTCAAAAAGAGTGATGG + Intronic
906036469 1:42753582-42753604 AAGAAGTTCAAAAGAAAGGAGGG + Intronic
906423948 1:45693685-45693707 AAGTCTTTCAGAAATAAGGAAGG - Exonic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
906927638 1:50136072-50136094 AAGCCTCTTGAAAAGAAGGACGG + Intronic
907208433 1:52796086-52796108 CAACATTTCATAAAGAAAGAAGG - Intronic
907394459 1:54179510-54179532 ATGCCTTTCACAAACAAGGACGG - Intronic
907558420 1:55366034-55366056 AAGACTTTGAAAGAGAAGGAAGG + Intergenic
907760617 1:57355238-57355260 AGGAATTTAATAAAGAAGGAAGG - Intronic
908483943 1:64571939-64571961 ACGCATTTCAAATAAAAGGGAGG - Intronic
908498774 1:64722104-64722126 AAGAGTTTCTAAAAGAAAGAAGG - Intergenic
908582745 1:65533606-65533628 ATACTTTTCAAAAAGAAGAAAGG - Intronic
908668566 1:66520002-66520024 AAGCAGTTGAACCAGAAGGAAGG - Intergenic
909074040 1:71031568-71031590 AAGCATAACACAAAGAAGAAGGG + Intronic
909283131 1:73782936-73782958 AGGACTTTCAAAAAGAAGAAGGG + Intergenic
909292154 1:73897218-73897240 AAAAATTTTAAAAAGAAGCAGGG - Intergenic
909537978 1:76759755-76759777 AAGCATGGCAAAAAGAAAAATGG + Intergenic
910284618 1:85539807-85539829 AAGGATTTCAAAAAGAAGAAAGG - Intronic
910608966 1:89119225-89119247 AGGCATTTCAGAAAGGTGGAAGG + Intronic
910973927 1:92885787-92885809 CATTATTTCAATAAGAAGGATGG - Intronic
911090618 1:94014295-94014317 AAGCAATGAAAAAGGAAGGAAGG + Intronic
911110348 1:94177176-94177198 AAGCATGTCAAAAAAAAAGTAGG + Intronic
911459981 1:98177385-98177407 AAGCATTCCAAAATGAATTATGG + Intergenic
911469312 1:98297258-98297280 AAGCATGTGAGAAAGAAGGAAGG + Intergenic
911729750 1:101280637-101280659 TGGCATTTCAAGAAGAAAGAAGG + Intergenic
912929188 1:113941174-113941196 CAACATTTCAAAAACAAGGCAGG - Exonic
913481696 1:119294868-119294890 AAGCTTTAACAAAAGAAGGAGGG - Intergenic
914205403 1:145522901-145522923 AAGGATTTCAAAAAGAAGAAAGG + Intergenic
915057347 1:153146270-153146292 AAGCTTTTCTGAGAGAAGGAAGG + Intergenic
915494886 1:156274983-156275005 AAGGCTTCCAAAAAGGAGGAAGG + Intronic
916494466 1:165333150-165333172 AAACAAAACAAAAAGAAGGAAGG - Intronic
917295857 1:173518457-173518479 AAGCATTTTAAAAAGAGACAAGG - Intronic
917413746 1:174786692-174786714 ATGGATTTCTAAAAGAAGGGAGG - Intronic
917467105 1:175289617-175289639 AAGATTTTCAAAAACAAGCAAGG - Intergenic
917783805 1:178429898-178429920 AAGAATACCAAAAAGAAGGGAGG - Intronic
917793488 1:178514713-178514735 AAGCAGTTAAACAAGAAGGGCGG + Exonic
919084375 1:192903768-192903790 AAGCATTTCACCAAGTAGTATGG - Intergenic
919121788 1:193350133-193350155 AAGCTTTTAAAAAAGAATGCCGG + Intergenic
919345802 1:196376722-196376744 AACCAATTAAAAAAGAAAGAAGG + Intronic
919482456 1:198106836-198106858 AAGTATTGGAAACAGAAGGAAGG + Intergenic
919482721 1:198109136-198109158 AAGAAATTCAAAAAGAGGTATGG + Intergenic
920406649 1:205718832-205718854 AAGCAGGTCAAAAAGACGGAAGG + Intronic
920542292 1:206788040-206788062 AACCATGTCACAAGGAAGGAAGG - Intergenic
920703179 1:208233123-208233145 AAGTATTGCAAAAAGACAGAAGG - Intronic
920931781 1:210395381-210395403 ATGGATTTCAAAAGAAAGGAGGG + Intronic
921156239 1:212441059-212441081 AAGAATTACACAAAAAAGGATGG - Intronic
921304876 1:213786056-213786078 GACAATTTAAAAAAGAAGGAAGG + Intergenic
921345601 1:214181453-214181475 TAGCTCTTCAAAAAGAAGGCAGG + Intergenic
921367353 1:214386051-214386073 CTGCATTTCAAAAAGAGAGATGG - Intronic
921596424 1:217058574-217058596 AACTATTTAAAAATGAAGGAAGG + Intronic
921761606 1:218921721-218921743 CAGCGTTCCAAAAAGAAGAATGG + Intergenic
921903509 1:220473045-220473067 AAATAATTCAACAAGAAGGAAGG + Intergenic
922056714 1:222049243-222049265 AAGCATTTCAGAAGGAAAGCGGG + Intergenic
923050069 1:230384818-230384840 AAGCACTACTAAAAGGAGGAAGG - Intronic
923878149 1:238073529-238073551 AATCATTTGAAAAAGTTGGAGGG + Intergenic
923988078 1:239403917-239403939 CAACATTTCAGAAGGAAGGAGGG + Intronic
924874921 1:248092240-248092262 AAGCATTTAAACAGGAAGGAAGG - Intronic
924876821 1:248115295-248115317 AAGAATTATAAAAAGAAAGAGGG - Intergenic
1062883552 10:998490-998512 AAGCATTTGAAAAATCAGCAAGG - Intronic
1063633120 10:7753432-7753454 AAGAATTTCAAAAAGGAGAATGG - Exonic
1063707498 10:8445081-8445103 AAGAATTTTAAAAATAAGAAGGG - Intergenic
1064041414 10:11968385-11968407 TAACATTTCAAAAAGAAGGTTGG - Intronic
1064632020 10:17326186-17326208 AAGCAATTGAAAAAGAAACAGGG - Intronic
1064670911 10:17713104-17713126 AAGCATTTCAGAAAAGAGGAGGG - Intronic
1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG + Intronic
1065103817 10:22359095-22359117 ATGCTTTACAAATAGAAGGAAGG - Intronic
1066191080 10:33056828-33056850 AAGAATTTAAAAAAAAAGGAAGG - Intergenic
1066782102 10:38962436-38962458 AAGAATTTAAAAGAAAAGGAAGG + Intergenic
1066955013 10:42158190-42158212 AAGAATTTGAAAGAAAAGGAAGG - Intergenic
1067802513 10:49368841-49368863 ATGAATGTTAAAAAGAAGGAAGG + Intronic
1067918093 10:50422145-50422167 AGGGATCTCAAAAAGAAGGAAGG - Intronic
1068286587 10:54945193-54945215 AACTATTTCAAAAGGAAGAAAGG + Intronic
1068636978 10:59359031-59359053 GAGCATTTCACAAAGAAATAAGG - Intronic
1068706714 10:60085123-60085145 AAGGATTCCAAAAAGCAGTAAGG - Intronic
1068708717 10:60107895-60107917 AAACATTTCAAATAAAAGAAAGG + Intronic
1068989992 10:63140295-63140317 AAGCAATTAAAAAAGAATGTGGG + Intronic
1069389810 10:67921855-67921877 AAATTTTTCAAAAAGAGGGATGG - Intergenic
1069965902 10:72116225-72116247 AGGTTTTTAAAAAAGAAGGAAGG - Intronic
1071098348 10:82005623-82005645 AAGCATTGCAGAAAAAAGGATGG - Intronic
1071286846 10:84156723-84156745 AAGCAATTCAGGAAGATGGACGG + Intergenic
1071666223 10:87561525-87561547 GAGGATTCCCAAAAGAAGGATGG + Intergenic
1071848860 10:89548059-89548081 GAGAATTTCAAAAAGCAGGAAGG + Intronic
1071877466 10:89856826-89856848 CAGCAATACAAAAATAAGGATGG - Intergenic
1072108629 10:92297115-92297137 AAGCATTAAACCAAGAAGGATGG - Intronic
1072345952 10:94506333-94506355 AAAAATTTCAAAAAGTAGGCCGG - Intronic
1072438271 10:95432844-95432866 AAACATTTCAAAATGAAAGCAGG + Intronic
1073347753 10:102797203-102797225 AAGTGTTTTAAAAAGAAGAATGG + Intronic
1073553821 10:104428573-104428595 AAACATTTTAAAGAGAGGGATGG + Intronic
1073642410 10:105266406-105266428 AAGTATCTCAAAAAGAAGCAGGG + Intergenic
1073874657 10:107908271-107908293 AAGCATTTTAAAAAGCAAAAAGG + Intergenic
1074446852 10:113527768-113527790 AAACATTTCAAAAGAAAGCATGG + Intergenic
1074584885 10:114758139-114758161 AAAAATTTAAAAAAGAAGAATGG - Intergenic
1074590968 10:114812848-114812870 AAGAATTAAAAAAAAAAGGAAGG - Intergenic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1075618377 10:123907890-123907912 AAACATTTTAAAAAGAAAAAAGG + Intronic
1076120020 10:127928487-127928509 GAGCACTTCCAAAAGAAGGAAGG - Intronic
1076862907 10:133150177-133150199 AACCATTGCAGAAAGCAGGATGG + Intergenic
1079019602 11:16898535-16898557 GAGCATTTCAAGAAGAAGCAAGG + Intronic
1080123903 11:28708684-28708706 AAAAATTTAAAAAAGATGGATGG + Intergenic
1080156485 11:29117703-29117725 GAGCCTGTCAAAAATAAGGAAGG + Intergenic
1080156608 11:29118669-29118691 GAGCCTGTCAAAAAGAAGGAAGG + Intergenic
1080223005 11:29928385-29928407 ATGCATTTCAAACAGAAAAAGGG + Intergenic
1080402937 11:31954208-31954230 GAGCATTTCAGAGAGAAGGAGGG - Intronic
1081077964 11:38699182-38699204 AGCCATTTCAAAAATAAGGTTGG + Intergenic
1081369267 11:42278901-42278923 AAACATTTAAAAAAGAATGAAGG + Intergenic
1081473712 11:43403132-43403154 AAGCATTTTAAAGGGAAGAAGGG + Intronic
1081714985 11:45243681-45243703 AAGCATTTCAAAAATGATGAAGG - Exonic
1082715757 11:56611276-56611298 CAGTATCTGAAAAAGAAGGAAGG - Intergenic
1082731515 11:56803683-56803705 AAGAATTTAAGAAAGAAAGAGGG + Intergenic
1083202304 11:61127898-61127920 ATGCATTTCAAAAAGATGTTTGG + Intergenic
1083347752 11:62005500-62005522 AAGAATTTCAGAGAGAAAGAGGG - Intergenic
1083790260 11:64980236-64980258 GAGCATTTGAAAAGGAAGGATGG + Intergenic
1084627036 11:70316058-70316080 AAAAATTTAAAAAAAAAGGAAGG - Intronic
1084756670 11:71243933-71243955 AAACATTTAAAGAAGAATGAAGG + Intronic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1085228200 11:74941805-74941827 AAGAATTAAAAAAAGAAGGATGG + Intronic
1085372037 11:76017898-76017920 AATAATTTCAAAAAGAAACATGG + Intronic
1086081443 11:82907149-82907171 AAGCATTTTAGAGAGAAGAATGG + Intronic
1086332300 11:85766120-85766142 AAGGTATTCAAAAAGAAGGCTGG + Intronic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1089912904 11:122120743-122120765 AAGTAATTCAAAAAGAATGGAGG + Intergenic
1091061799 11:132470324-132470346 CAGCTATTCAAAATGAAGGAAGG + Intronic
1091261065 11:134234710-134234732 AAGCCTTTGGAGAAGAAGGAGGG + Intronic
1091296559 11:134477892-134477914 GGGCATCTCAAATAGAAGGATGG + Intergenic
1092576806 12:9793271-9793293 AATCATTTCAACCAGGAGGATGG + Intergenic
1092688807 12:11084015-11084037 AGGATTTGCAAAAAGAAGGAGGG - Intronic
1092798644 12:12140544-12140566 AACCAGTTCAATGAGAAGGAAGG + Intronic
1093803265 12:23399918-23399940 AAGCATTTCAAAAATAAAACAGG + Intergenic
1093822105 12:23633611-23633633 AAGAATGAAAAAAAGAAGGAAGG + Intronic
1093924877 12:24900088-24900110 AAGTATATCAAAAACAAAGATGG + Intronic
1094059222 12:26295730-26295752 AAGCATGTCAAAAATCAAGATGG - Intronic
1094069656 12:26398760-26398782 AATTATTTCAAAATGAAGGTTGG - Intronic
1094529647 12:31261975-31261997 AAGGTTTTTTAAAAGAAGGAGGG + Intergenic
1095212235 12:39507798-39507820 AAGGATGTCAAAAATAATGAAGG - Intergenic
1095374674 12:41512454-41512476 GAGATTTTCAGAAAGAAGGAAGG + Intronic
1096283287 12:50275651-50275673 AAGGATTTCAACAAGAGGGTGGG + Intronic
1096880400 12:54663538-54663560 CAACAATTCAAAAGGAAGGAAGG - Intergenic
1097174119 12:57133065-57133087 AGGTATTTCAGAAGGAAGGAGGG + Intronic
1097234727 12:57531559-57531581 AGGCATTACTAAAAGAATGAAGG + Intronic
1097570278 12:61323676-61323698 AAAAATTACAAAAAGCAGGAGGG + Intergenic
1097589578 12:61557810-61557832 AAACATTACAGAAGGAAGGAGGG + Intergenic
1097916160 12:65022291-65022313 AAGCATCTCAAATAGGAAGAGGG - Intergenic
1098067331 12:66632485-66632507 AAGCATGGGAAAAAGGAGGATGG - Intronic
1098147533 12:67512746-67512768 AAGGCTTTCAAAAAGAAAAAAGG + Intergenic
1099619402 12:84982161-84982183 GATCATTTGGAAAAGAAGGAAGG + Intergenic
1099835037 12:87899010-87899032 ACGCATTGCAAAATGAAGAAAGG - Intergenic
1101050003 12:100852178-100852200 ACAAATTTCAAAAGGAAGGAGGG - Intronic
1101260380 12:103023608-103023630 AAGCATTGCAAAGAAAAGAAAGG + Intergenic
1102352280 12:112202684-112202706 AAGCTTCTCAAATACAAGGATGG + Intronic
1103437244 12:120936460-120936482 AAGCATTCCAAGCAGAAGGCCGG - Intergenic
1104449830 12:128860163-128860185 AAGCATTTCAGAAATTAGGCTGG + Intronic
1104524023 12:129501194-129501216 AAGCATTTCACAGAGATTGAAGG + Intronic
1105274137 13:18904983-18905005 AGGCATTGCAAAAAGACGGTGGG - Intergenic
1105802707 13:23922785-23922807 AAGGATTTCATATAGGAGGATGG + Intergenic
1105806527 13:23954705-23954727 AGGCATTGCAAAAAGACGGTGGG + Intergenic
1106425040 13:29620145-29620167 AAGAATTTTAGAAAGAAGAATGG - Intergenic
1107063007 13:36181415-36181437 AAATATTTTAAAATGAAGGAAGG - Intronic
1108022769 13:46145607-46145629 GAGCATTTCTAAAAGAGGGCAGG + Intronic
1108461446 13:50671423-50671445 AAATATTTCAAAAACAATGAGGG - Intronic
1108561106 13:51645228-51645250 CAGCAATACAAACAGAAGGAAGG - Intronic
1108898115 13:55360924-55360946 AAGCATTTCAAAAGGAAAGTGGG - Intergenic
1109015509 13:57007387-57007409 AAGCATCTCAAAATGAACTAAGG + Intergenic
1109332907 13:60952537-60952559 CAGCATTACAAAAAGTAGGACGG - Intergenic
1109507511 13:63324791-63324813 AAACATTTTCAAAAGAAGGTGGG + Intergenic
1109581294 13:64339935-64339957 CTGAATTCCAAAAAGAAGGAGGG + Intergenic
1110104599 13:71655793-71655815 AAGCAAATGAAAAAGAAAGATGG - Intronic
1110346166 13:74450157-74450179 CAACAGTTCAAAAGGAAGGATGG - Intergenic
1110599354 13:77354224-77354246 AAGCATTGAAAAAAAAAGGAAGG - Intergenic
1110704923 13:78594510-78594532 AGGCATTTAAAAAAGCAGGTAGG - Intergenic
1111135970 13:84043907-84043929 AAGCACTACAATACGAAGGAAGG + Intergenic
1111423815 13:88052739-88052761 AAGCATGTCAAACAGGAAGAAGG + Intergenic
1111497020 13:89064086-89064108 ATGCATTAGAAAAAGATGGATGG + Intergenic
1111552354 13:89830743-89830765 AATCTTTTTGAAAAGAAGGAGGG + Intergenic
1112213152 13:97401498-97401520 AAGCATTTCAGGCAGAAGGAAGG - Intergenic
1112252784 13:97798720-97798742 GAGCAGTTAAAAAAGAAGAATGG - Intergenic
1112807063 13:103174490-103174512 AAGCATCACAAAGAGCAGGATGG - Intergenic
1114914010 14:27239375-27239397 AAGCATCTCTAGAAGAATGAAGG + Intergenic
1114995842 14:28350487-28350509 AAGCATTTAAAAAAGAATATAGG + Intergenic
1115011258 14:28548080-28548102 TGGCCTTTGAAAAAGAAGGAAGG - Intergenic
1115509118 14:34122735-34122757 AAACATTACAAAAAGAAGGAAGG + Intronic
1116010114 14:39341512-39341534 ATCCATTCTAAAAAGAAGGAAGG + Intronic
1116244445 14:42391747-42391769 AGGCATTTCAAAAAATAGTATGG + Intergenic
1116645143 14:47518654-47518676 AAACATTTTAAAAAGAAAGTTGG + Intronic
1117007514 14:51436981-51437003 AATAATTTAAAAAAGAAGGTTGG - Intergenic
1118302082 14:64625135-64625157 AAGCATTTCAAAGTAAAGGAAGG - Intergenic
1118635938 14:67748863-67748885 AAGAATTTAAAAAAGAAGGCAGG + Intronic
1118898729 14:69969014-69969036 AAGCATTACAAAAAGAGAGGAGG + Intronic
1119055613 14:71416809-71416831 AATAATTTAAAAAAGAATGATGG - Intronic
1119309660 14:73635107-73635129 AAGAATTTAAAAAAGAAAGATGG - Intergenic
1119829426 14:77688007-77688029 AGGCATTTCAAAAAACAGTATGG + Intronic
1120239976 14:81938678-81938700 AAGCATGGCTAAAAGAAGAAAGG + Intergenic
1120291855 14:82584306-82584328 AAGGAATAAAAAAAGAAGGAGGG - Intergenic
1120632707 14:86910438-86910460 AAGCATTTTTAGAAGAAGGCAGG - Intronic
1120741914 14:88117996-88118018 AGGCTTTCCAATAAGAAGGAAGG - Intergenic
1120863127 14:89272988-89273010 CAGAGTTTCACAAAGAAGGAAGG - Intronic
1121149558 14:91619411-91619433 AAGGGTTTCAGATAGAAGGAAGG + Intronic
1123736405 15:23188290-23188312 AGCCATTCAAAAAAGAAGGAAGG - Intergenic
1123756668 15:23402317-23402339 AAGAATGACAAAAGGAAGGAAGG + Intergenic
1124228043 15:27913373-27913395 AAGCATTTCAAAAGAAAGAAGGG + Intronic
1124287111 15:28411267-28411289 AGCCATTCAAAAAAGAAGGAAGG - Intergenic
1124295591 15:28500365-28500387 AGCCATTCAAAAAAGAAGGAAGG + Intergenic
1125966761 15:43881061-43881083 CAGCATTCCCAAAAGAGGGAGGG - Intronic
1126570321 15:50143723-50143745 AAGCATTTCAAATGGAAACAGGG + Intronic
1127183371 15:56450075-56450097 AATGATTACAAAAAGAAGGTAGG - Intronic
1127197342 15:56603119-56603141 AATCATGTCAAAACAAAGGAAGG - Intergenic
1127283042 15:57508401-57508423 AGGCAAATCAAAAAGGAGGAAGG + Intronic
1127369545 15:58325316-58325338 AACCATTTCAAAAAAATTGAGGG - Intronic
1127737992 15:61863506-61863528 AATCATATCAAAAAGTTGGAAGG - Exonic
1127843122 15:62847289-62847311 AGGCATTTGGAAAAGCAGGAAGG + Intergenic
1127878844 15:63138027-63138049 AAGCATTTTAAAAATAAGGCTGG + Intronic
1130217301 15:81984445-81984467 AACAATTACAAAAAGCAGGAAGG - Intergenic
1130397274 15:83513565-83513587 AAGACTTTCTAAAGGAAGGAGGG - Intronic
1130883196 15:88072536-88072558 AAGCAGTTAAAAAATAAAGAAGG - Intronic
1130889770 15:88123921-88123943 AGTAATTCCAAAAAGAAGGAGGG + Intronic
1130895082 15:88163691-88163713 AACTATCTCAAAAAGAATGAAGG - Intronic
1131205703 15:90444384-90444406 GAGAATTTGAAACAGAAGGATGG - Intronic
1131806472 15:96127266-96127288 AAGCATTAAAAAAAAAAGGGGGG - Intergenic
1131975960 15:97946182-97946204 CCTCATTTCAGAAAGAAGGACGG + Intergenic
1133000068 16:2845824-2845846 ATGAATTGCAAAAGGAAGGAGGG - Intergenic
1133396182 16:5449239-5449261 AAGCATTTCAGGAAGAGGAAAGG - Intergenic
1134823958 16:17269708-17269730 AAGAATTACCAAAAGCAGGAAGG - Intronic
1135023230 16:18979876-18979898 AAGAAATTCAGACAGAAGGATGG - Intergenic
1135142500 16:19933758-19933780 AAGCATTCCCAGAAGAAGGGAGG - Intergenic
1135259473 16:20968387-20968409 TAACATTTCAGAAAGAATGAAGG + Intronic
1135759595 16:25126404-25126426 AGGCATTCCAGACAGAAGGAAGG - Intronic
1137232189 16:46576934-46576956 AAGCATTTCCAAAGGAAGTGGGG + Intergenic
1137315324 16:47314050-47314072 AAGCATTTCTATAGGAGGGAGGG + Intronic
1137729786 16:50680980-50681002 TAGCATTTCAAAAGGAATGGAGG + Intronic
1137876302 16:51999608-51999630 TGGCATTTCAAGGAGAAGGAAGG - Intergenic
1137927893 16:52558600-52558622 AAGAATTTCACAAAGAGGCATGG - Intergenic
1137952635 16:52798147-52798169 AAGAAGTTCAAAAGGAAGGTTGG + Intergenic
1140232881 16:73132403-73132425 AATCAATTCAAGAAGAGGGAAGG + Intronic
1140417504 16:74786619-74786641 AGGAATTTGAAAAAGATGGAGGG - Intergenic
1140490750 16:75333889-75333911 AAGCGATTCAAAAATAAGGAAGG + Intronic
1140555825 16:75919981-75920003 AAGGTTTTCAAAATGAATGAAGG - Intergenic
1141458343 16:84160328-84160350 AAGCACTTCAAAAAGAAACTTGG - Intronic
1141798512 16:86291237-86291259 CAGCATTTAAAAAATAAAGATGG + Intergenic
1142322406 16:89392318-89392340 AAGCATTTCAAACACACTGATGG + Intronic
1142368168 16:89661709-89661731 AAGAACTTGAAAAAAAAGGAGGG + Intronic
1142971395 17:3614214-3614236 AGGCATTTCTTAAAGAAGCACGG - Intronic
1143272562 17:5686652-5686674 AAGCTTTGCAAAGAGAAAGAGGG - Intergenic
1144615149 17:16763720-16763742 AAGTAGTTCAAAGAGAGGGAGGG - Intronic
1144897552 17:18551938-18551960 AAGTAGTTCAAAGAGAGGGAGGG + Intergenic
1145134821 17:20393776-20393798 AAGTAGTTCAAAGAGAGGGAGGG - Intergenic
1145324073 17:21784210-21784232 AAGAATTTGAAAGAAAAGGAAGG - Intergenic
1145689523 17:26723751-26723773 AAGAATTTGAAAGAAAAGGAAGG + Intergenic
1145746828 17:27326108-27326130 AAGCAATGCAGAAAGATGGAAGG + Intergenic
1146235529 17:31157369-31157391 GACCATCTCAAAAAAAAGGAAGG - Intronic
1146499938 17:33355542-33355564 AAGAAATTCAAAAGGGAGGAAGG - Intronic
1148703723 17:49609382-49609404 GTGCTTTTCATAAAGAAGGAAGG + Intronic
1149282571 17:55124418-55124440 AAACATTTTAAAAATAAGGTAGG + Intronic
1149509127 17:57223308-57223330 AAGCATTGCAAAAAGAAGACAGG + Intergenic
1149982572 17:61322985-61323007 ACGCCTTTAAAAAAAAAGGAAGG - Intronic
1150180949 17:63120495-63120517 AAGAATTTCAGAAAGTAAGATGG - Intronic
1203190728 17_KI270729v1_random:185214-185236 AAGAATTTAAAAGAAAAGGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153513352 18:5879508-5879530 AAGCATTTCAAAAAGTACTTTGG + Intergenic
1153558165 18:6340150-6340172 AATCCTTTTAAAAAGAGGGAGGG + Intronic
1153797044 18:8633378-8633400 AATCATTATTAAAAGAAGGAGGG + Intronic
1154461512 18:14593970-14593992 AAACTTTTCAAAAATAAAGATGG + Intergenic
1154465839 18:14642235-14642257 AGGCATTGCAAAAAGATGGTGGG - Intergenic
1155370177 18:25090909-25090931 AAAGAGTTCCAAAAGAAGGATGG + Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155873140 18:31051996-31052018 AACTATTTCAAAGAGAAGTAGGG - Intergenic
1156052734 18:32956950-32956972 AAATATTTCTAAAGGAAGGAAGG + Intronic
1156584460 18:38416304-38416326 AACTAGTTCAAAAAGAAAGAAGG + Intergenic
1156782181 18:40863741-40863763 AAGTGTTTGAAGAAGAAGGAAGG - Intergenic
1157746088 18:50137123-50137145 AAGCATTGCAAAAAGAACAGTGG + Intronic
1157792879 18:50548678-50548700 AAGCATCTCAAATAGGAAGAGGG - Intergenic
1157804817 18:50650236-50650258 AAGCAACTCAAAAAGAAGGCAGG + Intronic
1158168279 18:54566915-54566937 AAACATTTCAAGAAAAATGAAGG - Intergenic
1159145342 18:64447001-64447023 AAGTATTTGAAGAAAAAGGAAGG + Intergenic
1159496650 18:69216198-69216220 TTCCATTTCAATAAGAAGGAAGG - Intergenic
1159598682 18:70408083-70408105 ATGCATTAAAAAAAGAAGCAAGG - Intergenic
1160074131 18:75655722-75655744 AAGAATTTCTTAAAGAAAGAAGG - Intergenic
1161182185 19:2891404-2891426 GAGCATTGCAAAAATAAAGATGG + Intergenic
1162645774 19:12049172-12049194 AAGAATAACAAAAAGAAGGCTGG + Intronic
1164625731 19:29726566-29726588 AAGCAATTTAAAAAAAAAGAGGG + Intergenic
1165808043 19:38593873-38593895 CTCCATTTCAAAAAGAGGGAAGG + Intronic
1165819347 19:38664786-38664808 ATGCCTTTCAAAAAAGAGGAAGG - Intronic
1166048731 19:40245377-40245399 AAAAATTTCAAAATTAAGGAAGG + Intronic
1166667323 19:44688909-44688931 AACCGTTTAAAAAAGAAGAAAGG + Intergenic
1168618849 19:57860566-57860588 AAGCAATACGAAAAGAATGAAGG - Exonic
925491399 2:4399045-4399067 AAGTATATTAAAAAGAAGTATGG - Intergenic
925509231 2:4606241-4606263 AAGGATTTCAGAAAGAAACAAGG - Intergenic
925683414 2:6447023-6447045 TAGCTTCTCAAAAAGCAGGAAGG - Intergenic
926045853 2:9709050-9709072 AGTCATTTCAGAAAGAGGGAGGG + Intergenic
926364465 2:12120504-12120526 AAGCATTTGAAAGAGAAGCTTGG - Intergenic
926472474 2:13278402-13278424 CAGCATTTGAAAAATAAGAAAGG + Intergenic
926480023 2:13380876-13380898 AAGCTATTCCAAAAAAAGGAGGG + Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
926763584 2:16302734-16302756 AATCATGTGAAAAATAAGGAAGG - Intergenic
926998455 2:18765858-18765880 ATGAAAGTCAAAAAGAAGGAGGG + Intergenic
927034530 2:19159918-19159940 AATCATTTCACTAAGAAAGAAGG + Intergenic
927133302 2:20079035-20079057 ATGCATTTCAAGGAGAAGGCTGG + Intergenic
927887806 2:26729151-26729173 AAGCAGGACAGAAAGAAGGAGGG + Exonic
928191385 2:29173066-29173088 AAGCATCTCACAAGGAAAGAAGG - Intronic
928415602 2:31089137-31089159 TAGGATTTCAAGGAGAAGGAGGG - Intronic
928667888 2:33568924-33568946 AAGAATTGCAAAAAAAAAGAAGG - Intergenic
929161853 2:38839883-38839905 AGACTTTTCAAAAAGAAGAAAGG + Intronic
929224099 2:39495163-39495185 GAGTATTTCAAGAAGCAGGAAGG - Intergenic
930306096 2:49676519-49676541 AAGGATTTCACCAAGCAGGAGGG + Intergenic
930500087 2:52203822-52203844 ATGCATGTCAAATAAAAGGATGG - Intergenic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
931123063 2:59242200-59242222 ATTCATTTCAAAGAGAAGAAGGG - Intergenic
931167391 2:59762795-59762817 AAGCATGTAAAAAGGAAAGAAGG + Intergenic
931642079 2:64390698-64390720 TAGTATTAGAAAAAGAAGGAAGG - Intergenic
931834833 2:66087659-66087681 CAGCATTTTAAAAAGACAGAGGG + Intergenic
932651392 2:73562016-73562038 AAGCAATTAAAAAAAAATGATGG + Intronic
933442620 2:82333237-82333259 AAGCAGTTCAAAATGAGGAAGGG + Intergenic
933540942 2:83642020-83642042 AAACACAACAAAAAGAAGGAAGG - Intergenic
933816634 2:86073888-86073910 GAGCAATGCAAAAAGAAGCAAGG - Intronic
934095272 2:88596289-88596311 AAGCATTGTTAAAAGAAGGGAGG - Intronic
934252331 2:90368252-90368274 AAGAATTTGAAAGAAAAGGAAGG - Intergenic
934257111 2:91434693-91434715 AAGAATTTGAAAGAAAAGGAAGG + Intergenic
934878892 2:97954898-97954920 AAACATTTTAAAAAGAATTAGGG + Intronic
935037206 2:99389859-99389881 AGGCTCTTCAGAAAGAAGGAAGG - Intronic
935066426 2:99652387-99652409 AAGCCCTTCAAAGAGCAGGAAGG + Intronic
935225936 2:101053235-101053257 AAGCATTTCAAAAAGAAGGAAGG + Intronic
935481192 2:103592345-103592367 AAGGATTTCAAAAGGAGGGGAGG - Intergenic
937510011 2:122584566-122584588 AAGTATTAAAAAAAGAAGGGGGG + Intergenic
938235073 2:129699382-129699404 AAGCATGGCTAAAAGGAGGAAGG + Intergenic
938539380 2:132273740-132273762 AAACATTTAAAAATGAAGGCCGG + Intergenic
939546013 2:143553681-143553703 AACCATTTGAAAAAGTAGTATGG - Intronic
939651977 2:144774696-144774718 AAAGATTTGAAATAGAAGGAAGG + Intergenic
940318653 2:152350746-152350768 AAGAATTTTACAAAGAAGGCTGG + Intronic
940389949 2:153120801-153120823 GAGCCTGGCAAAAAGAAGGAGGG - Intergenic
940527483 2:154835264-154835286 AAGCATTTCAAAAATTAACAAGG - Intronic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
941600865 2:167542711-167542733 ATGCATTTCAAAAACAAGATAGG - Intergenic
941698975 2:168583461-168583483 AAGCAAATGAAAAAGAAGCAAGG - Intronic
942693500 2:178612571-178612593 GAGGATCTGAAAAAGAAGGAAGG + Exonic
943418717 2:187638316-187638338 AAGCATTTTGAAATGAATGATGG - Intergenic
943508618 2:188795226-188795248 AAGAACTACAAATAGAAGGAGGG - Intergenic
943694574 2:190911341-190911363 AAGCTTTTAAAATAGAAGGCTGG + Intronic
943775400 2:191760067-191760089 AAAAATTTCAAAGTGAAGGATGG - Intergenic
943826473 2:192400194-192400216 CAGCATTCCCAAAAGAAAGAAGG + Intergenic
944363901 2:198893682-198893704 AAGGATTTTAAAAAGACAGAAGG + Intergenic
944563205 2:200962403-200962425 AATCCTTTGAAAAAGAAGGTTGG + Intronic
944565306 2:200984580-200984602 AAGCTTTTTAAACAGAAGAAAGG - Intronic
944890874 2:204116046-204116068 CATCATTTCATAAAGAAGGGAGG - Intergenic
945487458 2:210414133-210414155 AAGCATTTAAATAGGAAGAAAGG - Intergenic
945879379 2:215310932-215310954 AAGCCTATTAAAAAGGAGGATGG + Intergenic
945932960 2:215873976-215873998 AAAAATTTCAAAAAGAAGAGGGG + Intergenic
946228529 2:218277697-218277719 AAACACTTAAAAAGGAAGGAAGG + Intronic
946911700 2:224468203-224468225 AAGCAATTCCAAAAGAAGCGTGG - Intergenic
947026054 2:225739386-225739408 AAGCAATTAAAATAGAAGGTAGG + Intergenic
947346240 2:229192011-229192033 TATCACTTAAAAAAGAAGGAAGG - Intronic
947666759 2:231910851-231910873 AAGCATTTGAAGAGGAAGGAGGG + Intergenic
948042288 2:234911978-234912000 AAGCATTTGTCCAAGAAGGAAGG + Intergenic
948081752 2:235212167-235212189 CAATATTTCAGAAAGAAGGAAGG - Intergenic
1168901002 20:1364960-1364982 AAGCATTTCAAACAGAGGGTAGG + Intronic
1168984168 20:2033577-2033599 CAGTAGCTCAAAAAGAAGGAAGG + Intergenic
1170778942 20:19406050-19406072 AAGCAATTAAATAAGAAGGAGGG - Intronic
1170998938 20:21395014-21395036 AAGCATGACAAGAAGAAGAAAGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171258862 20:23713314-23713336 GGGAATTCCAAAAAGAAGGAGGG - Intergenic
1171809908 20:29738416-29738438 AAGCATTTCAATCAAAAGAATGG + Intergenic
1171868314 20:30506594-30506616 AAACATTTAAAAATGAAGGCCGG + Intergenic
1172002882 20:31794307-31794329 AAGAATCTGAAAAATAAGGAAGG - Intronic
1172854343 20:37989983-37990005 AAGCTTTTCAGAAAGAAGCATGG - Intronic
1173063772 20:39689140-39689162 AAGCATCTCATAACGAAAGATGG + Intergenic
1173837433 20:46135051-46135073 AAGCATTGGAGAAAGCAGGAAGG - Intergenic
1174488001 20:50873275-50873297 AACCATTTCAAAAAGGAACAGGG + Intronic
1174503476 20:51002210-51002232 ATTAATTTAAAAAAGAAGGAAGG - Intergenic
1174714132 20:52738754-52738776 AAGCATTTCGATAAGATGGGAGG + Intergenic
1174800740 20:53561044-53561066 AAGACTGTCAAAAACAAGGAAGG + Intergenic
1175021805 20:55859096-55859118 AAGCATGTCAGAGAGAGGGATGG + Intergenic
1176087019 20:63301641-63301663 GAGCATTTCAAAATGAAAAAGGG - Intronic
1176551738 21:8225917-8225939 AAACATTTAAAAATGAAGGCCGG - Intergenic
1176570647 21:8408916-8408938 AAACATTTAAAAATGAAGGCCGG - Intergenic
1176578556 21:8453083-8453105 AAACATTTAAAAATGAAGGCCGG - Intergenic
1176922194 21:14701192-14701214 AAGAATTTCAAAAAGAATGGAGG + Intergenic
1177524661 21:22275968-22275990 ACGCATTCAAAAAAGAAGCAAGG - Intergenic
1177539687 21:22476498-22476520 AAGCATTTCAAAAGCAACGCAGG + Intergenic
1177602452 21:23334024-23334046 AAGCAATTGAAAAAGGGGGAGGG + Intergenic
1177887966 21:26769012-26769034 TAACATTTCAAAGATAAGGACGG + Intergenic
1177938510 21:27380269-27380291 AAGAAAGACAAAAAGAAGGATGG + Intergenic
1178043021 21:28662408-28662430 AAGCATTTCACAAAGCAAAAAGG + Intergenic
1178551058 21:33539836-33539858 AGGTATTTCAAAAAGAAGGCAGG + Intronic
1178576541 21:33797482-33797504 GAGAGTGTCAAAAAGAAGGATGG + Exonic
1179296536 21:40067781-40067803 AGGAATTATAAAAAGAAGGAAGG - Intronic
1179564285 21:42236759-42236781 AACCTTTGCAACAAGAAGGAAGG + Intronic
1180700034 22:17776281-17776303 AACCACTTCAAAAAGAAAGGGGG + Intergenic
1180888913 22:19271003-19271025 AAGTATTTCCCAAAGAAGGCTGG - Intronic
1182719137 22:32383740-32383762 AAGAATTTCAAGAAGAAGTGAGG - Intergenic
1183123316 22:35749766-35749788 AAGTTTTTCAAAAAGAACAAGGG + Intronic
1185177587 22:49337554-49337576 AAACATTTAAAAAAGAAGTAAGG - Intergenic
1185214799 22:49592548-49592570 ATGGATTTCAGAATGAAGGAGGG - Intronic
1203256757 22_KI270733v1_random:142837-142859 AAACATTTAAAAATGAAGGCCGG - Intergenic
1203325681 22_KI270738v1_random:13729-13751 AAGAATTTGAAAGAAAAGGAAGG - Intergenic
949461262 3:4297307-4297329 AGTCATTTTAAAAAGAAGCATGG - Intronic
949478884 3:4474505-4474527 AAGCATTTGAAAAAGAAAAGGGG - Intergenic
950239598 3:11356900-11356922 AAGGATTTCAGGAAGAAGAAAGG - Intronic
950854748 3:16094601-16094623 CAGCATTTTAAACAGATGGAGGG - Intergenic
951186115 3:19715474-19715496 TTTCATTTCAAAAGGAAGGAGGG - Intergenic
951725684 3:25755700-25755722 ATGCATTTCAAAAGGAAAGCTGG + Intronic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
953485361 3:43289395-43289417 AAGCATTTGAAAAGGAAGGAGGG + Intronic
953495824 3:43386273-43386295 AAATACTTTAAAAAGAAGGAAGG + Intronic
953557506 3:43958408-43958430 AAATATTTCAAAAAAAAAGAGGG - Intergenic
954588052 3:51753993-51754015 AAGCATTTCAAACATCAGCATGG - Intergenic
955257511 3:57348649-57348671 AAGCCTTTTCAAAAAAAGGATGG + Intronic
955376596 3:58402273-58402295 AAGACTCTCAAAAAGAAGAAGGG - Intronic
955444629 3:58996724-58996746 AAGAATTTTCCAAAGAAGGAAGG + Intronic
956338148 3:68188129-68188151 ATTCATTTCAAAAGCAAGGAAGG - Intronic
957872400 3:86106390-86106412 GTGCATTTCCAAAAGAAGAAGGG - Intergenic
958027136 3:88060840-88060862 AAGCATTGAAAGAAAAAGGATGG + Intronic
958085834 3:88805076-88805098 GTGCATCTCAGAAAGAAGGATGG + Intergenic
958407423 3:93766615-93766637 AAACATATCAAAAAGAAGTTTGG + Intergenic
958535227 3:95393995-95394017 AAGAAATTCAACAAGAAGTATGG - Intergenic
958677253 3:97281342-97281364 ACATATTTCAAAGAGAAGGATGG + Intronic
958711925 3:97727204-97727226 AAGCATTTGAAAAGCAAGGAGGG - Intronic
958733384 3:97982215-97982237 AAACATCTCAAAGAAAAGGAAGG - Intergenic
958787059 3:98608861-98608883 AATCATTTCAAATAGTAGAATGG + Intergenic
958917035 3:100061149-100061171 AAAAATTTTAAAAGGAAGGAAGG + Intronic
958951368 3:100420317-100420339 CACCATCTCAAAAAGAAGGAAGG - Intronic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959635250 3:108559613-108559635 CAGAATTTCAGGAAGAAGGAAGG + Intronic
959890169 3:111545941-111545963 AAGTATTTCCAACAAAAGGATGG + Intronic
960257468 3:115526300-115526322 AAGCATTTTAAAAAGGGGGAAGG - Intergenic
960396317 3:117141821-117141843 AAACATTTCTGAAAGAAGGAAGG - Intergenic
960895645 3:122501917-122501939 AAGTATTTCAAAAACAACCATGG - Intronic
961375903 3:126465646-126465668 AAGCATTTCAAAGACATGGGAGG + Intronic
962194084 3:133343078-133343100 CAGCATTTCAAAAAGATATATGG + Intronic
963383277 3:144558478-144558500 CAGCATTTGAAACATAAGGAAGG - Intergenic
963547263 3:146675765-146675787 GAGCCTTTCAAAAAGCAAGAAGG - Intergenic
963638566 3:147830629-147830651 ATGCATTAAAAAAACAAGGATGG - Intergenic
963794205 3:149615399-149615421 AAACATTTCTAAAAGAGGAAGGG + Intronic
964186795 3:153955245-153955267 ATGCATTTCCAAAAAAAGTAAGG - Intergenic
964415448 3:156443258-156443280 AAGCTTATCATAAGGAAGGAAGG + Intronic
964837479 3:160955305-160955327 AATAATTTAAAAAAGAAGGCTGG - Intronic
964864791 3:161244886-161244908 GAGGATTTCAAAAAAAAGAAAGG - Intronic
965018022 3:163185987-163186009 AAGTGTTACAAAAAGTAGGAAGG + Intergenic
965495209 3:169389750-169389772 CAGCATATCTAAAAGAAGGCAGG + Intronic
965675702 3:171193610-171193632 TAGAAGTTAAAAAAGAAGGAAGG - Intronic
966104592 3:176321456-176321478 CTGCATTTCACAAAGAAGGTAGG + Intergenic
966274156 3:178144201-178144223 GAGCAATTAAAAAAGAAGGGTGG + Intergenic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
967464993 3:189794711-189794733 AAGGATTTCGAACAGAAGAATGG + Intronic
967669196 3:192212054-192212076 ATGCATTTGAAAAAGAAGTTAGG - Intronic
968077968 3:195826755-195826777 CAGGATTTTAAAAAGAGGGAAGG - Intergenic
970517409 4:16846654-16846676 AAGCATTGCTAAAAGCAGGTAGG + Intronic
970916143 4:21337436-21337458 AAGCATTGCAGAAAAAAGAATGG + Intronic
971389416 4:26172120-26172142 AAACATTTCAACAACATGGATGG + Intronic
972295987 4:37738976-37738998 TAGCATTTCAAAAAAAAGGGGGG - Intergenic
972722945 4:41719052-41719074 AGGAATTTGAAAAAGGAGGAAGG + Intergenic
973221745 4:47734218-47734240 AAGCACTTCAGAAAGGAGAATGG + Intronic
973302962 4:48609744-48609766 AAGCACTTTAAACATAAGGAAGG - Exonic
974189102 4:58480510-58480532 AATCATTTAAAAAGGAAGAAAGG - Intergenic
974372408 4:61034519-61034541 AAGGTTTACAAAAAGAAAGAAGG - Intergenic
974524636 4:63033070-63033092 AAGGATTACAAGAAGAAGGTAGG + Intergenic
974661613 4:64897570-64897592 AAGTCTTTCAAAGAGAAGGTGGG - Intergenic
975256753 4:72246094-72246116 AAGGATATTAAAATGAAGGATGG + Intergenic
975718891 4:77231295-77231317 AAGCATTTCAAAACTGAGGGGGG + Intronic
975837639 4:78441404-78441426 AACCATTTCAAAGAAATGGAAGG + Intronic
975895897 4:79089816-79089838 ATGCACTTCTAAAAGAAGTAAGG - Intergenic
975922412 4:79408045-79408067 AAGAGTTCCCAAAAGAAGGATGG - Exonic
976491172 4:85672296-85672318 AAGTATTTCAAAAACAAGAGAGG - Intronic
976832979 4:89335926-89335948 AAACAATCCTAAAAGAAGGATGG - Intergenic
976887044 4:89998633-89998655 AAGCACTTCAAAAAGACAAAGGG - Intergenic
976896999 4:90125393-90125415 TTGCATTGTAAAAAGAAGGAGGG + Intergenic
977098742 4:92780531-92780553 AATCATTTAAACAATAAGGAAGG + Intronic
977347778 4:95839776-95839798 AAGCGTATCAAATAGAAGAAAGG - Intergenic
977549523 4:98425611-98425633 CAGCAGTTCAAAAAGACAGAGGG + Intronic
977620663 4:99133387-99133409 AAGCACATCAAAAAGAAAGAGGG + Intronic
977700118 4:100012358-100012380 AAGGATCTCAGACAGAAGGAAGG - Intergenic
978323642 4:107525873-107525895 AAGTATATCAGAAATAAGGAAGG + Intergenic
979530959 4:121768845-121768867 AAGCATTTTAAAAAGCAGAAAGG + Intergenic
980002707 4:127508983-127509005 AAGCATTTAAAAAAAAATGATGG - Intergenic
980296562 4:130925994-130926016 TAGCATTTAAAAGAGAATGAAGG + Intergenic
980647815 4:135666144-135666166 AAGCATTTTAAACAGCAGGTTGG - Intergenic
980727322 4:136780345-136780367 CTGGATTTTAAAAAGAAGGAGGG - Intergenic
981021073 4:140029429-140029451 AAGGAATACAAAAAGAAGGAGGG - Intronic
981102868 4:140849724-140849746 CAGCATTTCAGAAAACAGGATGG + Intergenic
981322982 4:143414245-143414267 AAGAATTTCAAAGAGGAGTAAGG + Intronic
981427526 4:144620846-144620868 AAGCATTTGAAAAAATAGAAAGG + Intergenic
981455097 4:144944443-144944465 CTGCATTTAAAAAACAAGGAAGG + Intergenic
981746648 4:148058592-148058614 AAACATTTCAGAAAGGGGGAAGG - Intronic
982530014 4:156528676-156528698 AAGTATTAGAAAAAGATGGATGG + Intergenic
982543511 4:156705734-156705756 AAAAATATCTAAAAGAAGGAAGG + Intergenic
983077139 4:163339831-163339853 AAGCATTTTCAAAGGAAGTAGGG - Intronic
983084563 4:163427330-163427352 AAGAAAGTCAGAAAGAAGGAAGG + Intergenic
983094414 4:163544528-163544550 GAGCATTTCAAAAAGCCGAAAGG - Intronic
983107890 4:163712486-163712508 AAGCACTTCTACATGAAGGATGG - Intronic
983537441 4:168873259-168873281 AAGCACTTTAAAAGTAAGGAGGG - Intronic
983943402 4:173560028-173560050 AAGCATTTGAAGAAGATTGATGG - Intergenic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
985774143 5:1831868-1831890 AAGCATTCCAAGAAGCTGGAAGG - Intergenic
986242882 5:5977267-5977289 AAGAATTCCAACAAGAAGTAAGG + Intergenic
986361925 5:6987130-6987152 AAGTTTTTTAAAAAGAATGATGG - Intergenic
986764573 5:10913280-10913302 AAAAATTTTAAAAAGAAAGAAGG + Intergenic
986843940 5:11731294-11731316 ACGCTATTCAAAAAGAAGAAGGG - Intronic
988130614 5:27099317-27099339 AAGACTTACAAAAAGAAGGATGG + Intronic
988373980 5:30409367-30409389 AGGCATTGCTAAAATAAGGATGG + Intergenic
988722072 5:33889299-33889321 AAATATTTCAAAAATAAGAATGG + Intronic
988819727 5:34869781-34869803 AAGCATTGAAAAAAGTAGGATGG - Intronic
989394078 5:40934366-40934388 AAGCATTTCCAACACAAGGCTGG - Exonic
989666606 5:43861278-43861300 ATGCATTTTAAAAAGAAGCTGGG + Intergenic
989732307 5:44663708-44663730 AAGGGTTTGAAAAAGAAAGAAGG - Intergenic
989794689 5:45452837-45452859 AAACACTTCAAAAAAAATGATGG + Intronic
989994805 5:50816834-50816856 TCACATTTAAAAAAGAAGGATGG - Intronic
990219618 5:53573274-53573296 ACAATTTTCAAAAAGAAGGATGG - Intronic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
990858760 5:60302208-60302230 AACTATTCCAAAAAAAAGGAGGG - Intronic
992019663 5:72609752-72609774 AACTTTTTTAAAAAGAAGGATGG - Intergenic
992590448 5:78290644-78290666 GAATATTTTAAAAAGAAGGAAGG + Intronic
992813710 5:80415036-80415058 AAGAAGTCCAGAAAGAAGGAAGG - Intronic
993572496 5:89558747-89558769 AAGCATTTTTAGAAGCAGGACGG + Intergenic
993916768 5:93753642-93753664 ATGTATTTTAAAAAGAAGAAAGG - Intronic
994025477 5:95077034-95077056 GATCATTTCCAAAATAAGGAAGG - Intronic
994223962 5:97230293-97230315 AGGGCTTTAAAAAAGAAGGAAGG - Intergenic
994303325 5:98172972-98172994 AAGGATTTCACAAAAATGGACGG - Intergenic
994349087 5:98723874-98723896 GAACATTTCAAAAAGAAGAAAGG + Intergenic
994648224 5:102496301-102496323 AATCATTTCAAACATAAAGAAGG - Intronic
995484829 5:112629582-112629604 AAACATTTTAAAAAGAGGGTGGG - Intergenic
996003556 5:118392694-118392716 AAACACTTCAAAAACAAGCAGGG - Intergenic
996177936 5:120382151-120382173 AGGCATTTCAAAAATAAAGTTGG - Intergenic
996402847 5:123082194-123082216 AGGCATGTTAAAAAGAAGCAGGG + Intergenic
996627888 5:125591396-125591418 TAGCATTTTAGAAAGAAGAAGGG + Intergenic
996722370 5:126642488-126642510 AACCCTTTCAAAAAATAGGAAGG - Intergenic
997512771 5:134465017-134465039 AAACAATTCAAAAAGAGGGGAGG - Intergenic
997660748 5:135587835-135587857 AATCATATCAAAAGCAAGGAGGG + Intergenic
998678246 5:144434676-144434698 AATCACTTCAACAAGAATGAAGG - Intronic
999030240 5:148282427-148282449 AATCATTTAAAAAAGAAAAAAGG + Intronic
999387864 5:151168024-151168046 CAGCATTTAAAAAATAATGAAGG + Intergenic
999706982 5:154282563-154282585 AACCATTTGAAAATGAAAGAAGG + Intronic
1000077088 5:157801204-157801226 AAGAATTTCAGAAAGTAGGCTGG + Intronic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000483986 5:161816134-161816156 AAGCAGATGAAAATGAAGGAAGG - Intergenic
1000616117 5:163428791-163428813 AAGCATTTTAAAAAGGAAAAGGG - Intergenic
1000785939 5:165543460-165543482 AAGCATATTACAAAGAAGGCAGG - Intergenic
1000804623 5:165774553-165774575 AAACATTTTAAAAAGCAGTATGG - Intergenic
1001519014 5:172377457-172377479 CAGGATTTGAAAAGGAAGGAAGG - Intronic
1002049473 5:176561993-176562015 GAGCATTCCAAAAAGAGGGACGG + Intronic
1002509273 5:179702419-179702441 AAAGTTTTAAAAAAGAAGGAAGG - Intronic
1002587874 5:180263443-180263465 ACGCTTTTCAAACAGAAGGCAGG + Intronic
1003476074 6:6484381-6484403 AAATGTTTCAAAAAGAAGAAAGG + Intergenic
1003680363 6:8247031-8247053 AAGCTGTTCATATAGAAGGAAGG - Intergenic
1005382555 6:25251823-25251845 AAGCATGTGAAAAAGAAGGCTGG - Intergenic
1005471842 6:26168552-26168574 AAGCATTTCAAATATAAAAAAGG - Intronic
1005735102 6:28738361-28738383 AAGGCTTTGAAAAGGAAGGAAGG + Intergenic
1006027505 6:31156948-31156970 AAGAATTACAAAAACAAAGATGG + Intronic
1006283065 6:33071431-33071453 AAGCATTTTAAAAAGTACAAGGG - Intronic
1006673555 6:35745747-35745769 AATCATTTCAAAATAAAGGCCGG + Intronic
1008419706 6:51283999-51284021 AAACAGTTCAGAAAGAAAGAGGG + Intergenic
1009638118 6:66293311-66293333 AAATAATTAAAAAAGAAGGAAGG + Intergenic
1009916136 6:69999217-69999239 TAGCAATTAAAAAAGAAGGCCGG - Intronic
1009993941 6:70878681-70878703 AATGAATTCAAAAAGAAGAAGGG - Intronic
1010288987 6:74114183-74114205 AAGAATTCCAGAGAGAAGGAAGG + Intergenic
1010357196 6:74948214-74948236 AACTGTTTCAAAAAGAAAGAAGG + Intergenic
1010609942 6:77942260-77942282 AAGGATTACAAAGAGGAGGAAGG - Intergenic
1010800246 6:80166929-80166951 AGGCATACCAAAAAAAAGGAGGG - Intronic
1010986018 6:82425290-82425312 AAGCATTCCAAAAAGAGAAATGG - Intergenic
1010987687 6:82443838-82443860 ACACATTTCAAAAGGAAGGATGG - Intergenic
1011280741 6:85674964-85674986 AAGCTTTTGAAAAGGCAGGAAGG + Intergenic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1011556825 6:88578490-88578512 AAGCACTTCAAAGGGAAAGATGG - Intergenic
1012139282 6:95601980-95602002 AATCATTTAAAAAAGAATCACGG - Intronic
1013381777 6:109579855-109579877 AAACATGTCAAAAATAAGAAAGG + Intronic
1013921559 6:115411338-115411360 AAGCATTGAAAAAAGCAGGCTGG + Intergenic
1013961139 6:115901914-115901936 CAGCAATTCAAAAAGAAAGATGG - Intergenic
1014607111 6:123490169-123490191 ATGCATTTCAAAGAGAAAAAAGG + Intronic
1015031587 6:128601995-128602017 AAGCCTATGCAAAAGAAGGAAGG - Intergenic
1015035992 6:128655167-128655189 AAGCATTTTAAATAGAAACATGG - Intergenic
1015059057 6:128940382-128940404 AAGCTTATAATAAAGAAGGAAGG - Intronic
1015383022 6:132591396-132591418 GGGCAGGTCAAAAAGAAGGAAGG + Intergenic
1015664760 6:135616457-135616479 AAATATTTCATAAAGAATGATGG - Intergenic
1016225056 6:141724721-141724743 AAACATCTCAAAAGGAAAGAAGG - Intergenic
1016676509 6:146776527-146776549 AAGAATGTAAAGAAGAAGGATGG + Intronic
1016944817 6:149520715-149520737 AAGCATAACAAAAACAAGGCCGG + Intronic
1016954375 6:149612205-149612227 AAACATTTAAAAAAGAATTAAGG + Intronic
1017185756 6:151598676-151598698 TATCATCTCAGAAAGAAGGAGGG + Intronic
1017439054 6:154445818-154445840 TAGAATTTTTAAAAGAAGGAAGG + Intronic
1018364871 6:163109518-163109540 AAATATTTCAAAAGGAAGAAAGG - Intronic
1018551439 6:165002720-165002742 AAGAACATCAAAAACAAGGAAGG - Intergenic
1018788700 6:167129582-167129604 AAGCATTTCAAAAATATTCAGGG - Intronic
1018803941 6:167244256-167244278 AAGCCTCACAAAAAGCAGGATGG - Intergenic
1018891071 6:167982921-167982943 AGGCAATTCAAAAACAAGGATGG + Intergenic
1020222378 7:6249610-6249632 AAGCAGATAAAACAGAAGGAGGG - Intronic
1020422870 7:8029051-8029073 AAGCTTTTCCAAAAAATGGAGGG + Intronic
1020427780 7:8089515-8089537 AAGCTTTACAAAACAAAGGAGGG + Intronic
1020583012 7:10029492-10029514 AAGCATTCCAAAAGAAAGGGTGG + Intergenic
1020810563 7:12845797-12845819 AAGCATCCCCAGAAGAAGGAAGG - Intergenic
1021173841 7:17427061-17427083 AAGCATGTGAGAAAGAATGAAGG - Intergenic
1021352691 7:19614661-19614683 AAGCATTTCAGAGAGAGAGAGGG - Intergenic
1022238747 7:28488546-28488568 CATCATTTCAGAAAGAGGGAAGG + Intronic
1022488211 7:30796513-30796535 AAGCATTTTAAAAAGCAGGGTGG + Intronic
1023145236 7:37144447-37144469 AAGCATCTCATAAATAAGAAAGG - Intronic
1023416119 7:39934426-39934448 AAGTATTACAGAAAGAAAGAGGG - Intergenic
1023529943 7:41142428-41142450 CAGCATCTCAAAAAAAAGCAAGG - Intergenic
1023564519 7:41510421-41510443 AAGCTATTCCAAACGAAGGAAGG - Intergenic
1024807214 7:53157027-53157049 AAGAATTTAAAAGAAAAGGAAGG - Intergenic
1024982828 7:55171927-55171949 GAGCATGCCAAAATGAAGGAAGG - Intronic
1025888020 7:65617060-65617082 ATCCATTTAAAAAAGAAGGGAGG - Intergenic
1026425831 7:70292522-70292544 ACACATTTCATAAAGAAGAAGGG + Intronic
1026674060 7:72414750-72414772 AAGCATGTCACAAAAATGGAAGG - Intronic
1027363516 7:77433284-77433306 AAACATGTCAAAATTAAGGAAGG + Intergenic
1027555628 7:79661398-79661420 AAGCAATTCTAACAGAATGATGG - Intergenic
1027976768 7:85167347-85167369 AAGCATTTCAACGGGAATGAAGG + Intronic
1028028915 7:85883908-85883930 AAGCATTTTAAAAAACAGAAAGG - Intergenic
1028388013 7:90281359-90281381 AAGCATAGCATAAAGAAGGGAGG + Intronic
1028517373 7:91693151-91693173 AAGCATTTCAAAAGGAAAACAGG + Intronic
1028872407 7:95783979-95784001 AAGCATTTCAAAATGATCCAAGG - Intronic
1029143480 7:98429001-98429023 AAGTATTTAAAAAAATAGGATGG + Intergenic
1029874730 7:103738396-103738418 AAAAATTTCAATAAGAAGAAAGG - Intronic
1030372183 7:108713045-108713067 AATCATTTCAAAATCAAGTAGGG + Intergenic
1030954924 7:115840596-115840618 CAGAATTTCAAAAAGTATGAAGG + Intergenic
1031081185 7:117258451-117258473 AGTAATTTCAAAAGGAAGGACGG + Intergenic
1031346415 7:120672429-120672451 AGGCATTTCAACAGGTAGGAGGG - Intronic
1032155598 7:129465037-129465059 AAGCATTTCACAAAAATGGGGGG + Intronic
1032731624 7:134648433-134648455 AGGCAGTTCAAAAAAAAAGAAGG - Intronic
1033056904 7:138064584-138064606 AAGCATGTCCAAAGGAATGAGGG - Intronic
1033097762 7:138445805-138445827 AAGGAATTCAAATATAAGGAGGG - Intergenic
1033101712 7:138479190-138479212 AAGCTTTTCAAAAAGTGTGAGGG + Intronic
1033319310 7:140325505-140325527 AAGCTTTTCAAAGGGAAAGACGG + Intronic
1033372268 7:140720334-140720356 ATGCATTTTAAAATGAAGGCAGG + Intronic
1033883752 7:145918694-145918716 AAGCAAATAAAAATGAAGGATGG + Intergenic
1033890361 7:146005470-146005492 AAACATTTAAAAAAGAAGAATGG + Intergenic
1035279324 7:157767302-157767324 AAGCTTCTGAACAAGAAGGAGGG + Intronic
1036473850 8:9075487-9075509 AAGCATTGCAAAAAAAAAAAAGG - Intronic
1036962947 8:13265767-13265789 AAACATTTAACAAGGAAGGAAGG - Intronic
1037077155 8:14734544-14734566 AAGCATTTTAAAAAGACTAATGG - Intronic
1037143271 8:15542391-15542413 CAGAATTCCAAGAAGAAGGAGGG + Intronic
1037329712 8:17732375-17732397 AAGCCTTTCAAGAAGAAAGGAGG - Intronic
1037332943 8:17762639-17762661 ATGCATTTCAAAATGGTGGACGG + Intronic
1037764029 8:21760886-21760908 AAGAGTTTCGAAAAGGAGGATGG + Intronic
1037981111 8:23255090-23255112 CGGCTTTTCAAAAAGGAGGAAGG - Intronic
1039139977 8:34375830-34375852 AAGGATTTGAAAAAGGTGGAGGG - Intergenic
1039338966 8:36625904-36625926 AAGCATTTTTAAATGAATGAAGG - Intergenic
1039432708 8:37537842-37537864 AAGCATTTTAAAAACAATCATGG + Intergenic
1039585055 8:38699993-38700015 ATGCATTCCTAAAAGAAGAATGG + Intergenic
1039843924 8:41312262-41312284 AAGCCATTCAAAAAGGAGGGAGG - Intergenic
1039867909 8:41521761-41521783 AAAAATTGTAAAAAGAAGGAAGG + Intergenic
1041611745 8:59858209-59858231 AAGCATTTAAATAGGAAGCAAGG + Intergenic
1042332970 8:67601268-67601290 AAGCATTTCAAAAGGATGTGTGG - Intronic
1042798060 8:72686110-72686132 AAACATCTCAAAAAAAAGAAAGG - Intronic
1042811797 8:72833752-72833774 GAGCATTTCTAAATGAAGAAGGG + Intronic
1043555236 8:81422595-81422617 AACCATTTCAAAAGGAAAGAAGG + Intergenic
1043820967 8:84863698-84863720 ATGCAGTTCAAAATGCAGGAAGG + Intronic
1043867396 8:85391414-85391436 AAACAATTCAAAAGGAAGGGAGG - Intronic
1044015383 8:87044352-87044374 AACTATTTCAAAAGGAAGGAAGG - Intronic
1044076411 8:87826920-87826942 AAGCATTTGAAAAAAAAAAAGGG + Intergenic
1044350642 8:91161332-91161354 AACCATTCCGAAAAGAAAGAAGG - Intronic
1044627102 8:94244770-94244792 AGGCATTTCAGGCAGAAGGAAGG - Intergenic
1045029101 8:98117818-98117840 TATCATTTCAGAAAGAAAGATGG + Intronic
1045834849 8:106507852-106507874 AAGGATTTCAAAGAGAATGTTGG + Intronic
1046204670 8:110977421-110977443 AAAGCTTTCAAAAAGAAGAAAGG - Intergenic
1046216051 8:111148827-111148849 AGGCATTTAAAAAGGAAGGGAGG - Intergenic
1046355318 8:113076723-113076745 ATGGATTCCAAATAGAAGGATGG + Intronic
1046680247 8:117161426-117161448 AAGCATTTGATAATGAAGGGAGG - Intronic
1047872052 8:129094723-129094745 AATCATTTCAAAGAGATAGAGGG - Intergenic
1048578460 8:135711156-135711178 AAGCAAAGCAAAAAGAGGGAAGG + Intergenic
1048926328 8:139275845-139275867 AGGCATGCCAAAAAGAAGAATGG - Intergenic
1049485773 8:142859344-142859366 AGGAATTTCAAAACGGAGGACGG - Intronic
1050374954 9:4961064-4961086 AAGCCTTTAAAAAAGTAGAATGG - Intergenic
1051775401 9:20626970-20626992 AATCATTACATAAAGAAAGAAGG - Intergenic
1052043991 9:23773483-23773505 AAGGATCTCAAAAAGTAGGTGGG + Intronic
1052558391 9:30050393-30050415 AAACATTTCACAAAGAAGGTGGG + Intergenic
1052638825 9:31137611-31137633 AAGCATTTAAAAAAAAGGTAAGG - Intergenic
1052659372 9:31408346-31408368 AAGTGTTTCAAAAAGGAGAATGG - Intergenic
1052717637 9:32136432-32136454 AAATTTTTCAAAAAGAAGGAAGG - Intergenic
1053033007 9:34798369-34798391 AAGGACTCCAAAAAGCAGGAGGG - Intergenic
1053151370 9:35745423-35745445 GATCATTTTAAAAAGAAGAAAGG - Intronic
1053722889 9:40965714-40965736 AAGGAGTTCAAAAAGTAAGAAGG - Intergenic
1054921609 9:70548619-70548641 AAGCATTTGCAATAGAAAGATGG - Intronic
1054950230 9:70842263-70842285 AGGCATTTAAAAAAGGAGGTAGG - Intronic
1055169201 9:73234389-73234411 AAGCATTTTTAATAGAATGAAGG - Intergenic
1055401172 9:75925678-75925700 GAGCATTTCAGGCAGAAGGAAGG + Intronic
1055574097 9:77645843-77645865 AAGCATTGCAAAATGAAATAGGG + Intronic
1055839912 9:80491136-80491158 AATCATTTGAAAAAGAAGGTAGG - Intergenic
1055841215 9:80506497-80506519 AAGAATATTAAAAAGAAGAAGGG - Intergenic
1056100130 9:83293157-83293179 AATCTTTACAAAAGGAAGGAGGG + Intronic
1056257902 9:84819116-84819138 AAACATTTCTAAAAGAGAGAGGG - Intronic
1057540528 9:95964350-95964372 AAGAAGTGCAAAAAGAATGATGG - Intronic
1058629359 9:106970583-106970605 AAGCCTTTCAAAAAGCAGGGGGG - Intronic
1058777934 9:108303484-108303506 AGGCAATTCAAAAAGTAGCATGG + Intergenic
1058887106 9:109329917-109329939 AAACATCTCTCAAAGAAGGAGGG - Intergenic
1059931002 9:119260876-119260898 AAGCATCATAAGAAGAAGGAAGG + Intronic
1061126417 9:128679318-128679340 CAGCAGCTCAAAAAGAAGAAAGG + Intergenic
1061866846 9:133496694-133496716 TGGACTTTCAAAAAGAAGGAGGG - Intergenic
1062180385 9:135188160-135188182 CTGCATTTCAAAAGGAAAGATGG - Intergenic
1203472917 Un_GL000220v1:124541-124563 AAACATTTAAAAATGAAGGCCGG - Intergenic
1203360205 Un_KI270442v1:214156-214178 AAGCATTTCAATCAAAAGAATGG + Intergenic
1185834136 X:3329283-3329305 AAGCAAGGAAAAAAGAAGGAAGG + Intronic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186091656 X:6055132-6055154 ACACATCTCAAAAAGATGGAAGG + Intronic
1186285643 X:8041331-8041353 CAGCATTTCACATAGAAGCAGGG - Intergenic
1186542709 X:10417279-10417301 AAGCATTTTAAGAAAAAAGAGGG + Intergenic
1186728814 X:12385824-12385846 AAGCAGTCCAAAGAGAAAGAGGG + Intronic
1186958668 X:14711099-14711121 AAGTATTTTCAAAAGAATGAAGG - Intronic
1187198688 X:17113786-17113808 ACTTCTTTCAAAAAGAAGGAAGG - Intronic
1187232729 X:17437902-17437924 GAGCATTTCAAAGAGAGGGAGGG + Intronic
1187308486 X:18118738-18118760 AAGCAATTCTCAAACAAGGAGGG + Intergenic
1188153204 X:26705448-26705470 AAGCATTAGAAAAATAAGGAGGG + Intergenic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1188524003 X:31070615-31070637 AAGAATCTCAGGAAGAAGGAAGG - Intergenic
1188965319 X:36544503-36544525 AAGCCTTTCAAAAACAAGAGGGG - Intergenic
1189533307 X:41909353-41909375 AAGCAATTTAAAAAGAAGCTGGG + Intronic
1189552887 X:42111981-42112003 AAGCATGTGAGAAAGAACGAAGG + Intergenic
1190523151 X:51300044-51300066 AAGGCTTCCCAAAAGAAGGATGG + Intergenic
1190699468 X:52976024-52976046 CAGCATTTAAAACAGAAGGAAGG - Intronic
1191767680 X:64716786-64716808 AACAATTTCAAAAAAATGGAAGG + Intergenic
1192247073 X:69382325-69382347 AATCATTTGAAGCAGAAGGAAGG - Intergenic
1192306670 X:69967618-69967640 AAGATTTTAGAAAAGAAGGAGGG + Intronic
1192857626 X:75030251-75030273 AAGTGTTTCAAAAAGTAGGAGGG - Intergenic
1193151674 X:78131568-78131590 ATGCATTTCAAAAGGAAAGTTGG - Exonic
1193249542 X:79272843-79272865 AAGCATGTCACAGAGCAGGAAGG - Intergenic
1195696344 X:107670435-107670457 AAGCATTTCACACAGGTGGAGGG + Intergenic
1195953138 X:110299480-110299502 AAGCATTTTCAAAACAAGAAAGG + Intronic
1196335604 X:114529258-114529280 TAGCATTTCAAAAATCAGCATGG - Intergenic
1196636766 X:118011216-118011238 AAGCATTCCAGAAAGAAGGGTGG + Intronic
1196800321 X:119537362-119537384 ACTCATTTCTAAAACAAGGATGG + Intergenic
1197992123 X:132329583-132329605 AAAGACTCCAAAAAGAAGGAGGG + Intergenic
1198479038 X:137023656-137023678 AAGGATTTCAAAAGGAGGGAGGG - Intergenic
1198593543 X:138210988-138211010 AACCATTTGGAAAAGAATGAAGG - Intergenic
1199215063 X:145253420-145253442 AAACATTAAAAAATGAAGGATGG - Intronic
1199344658 X:146724234-146724256 AGACATCTCAAAAAAAAGGAAGG + Intergenic
1199919619 X:152384944-152384966 AGGCACTTCACAAAAAAGGAAGG + Intronic
1200336119 X:155353375-155353397 AAGCATTTAAAAAAAAAAGGTGG + Intergenic
1200350351 X:155487852-155487874 AAGCATTTAAAAAAAAAAGGTGG - Intergenic
1202341937 Y:23878760-23878782 ATTCATATCAAAAAGTAGGAAGG - Intergenic
1202528831 Y:25791325-25791347 ATTCATATCAAAAAGTAGGAAGG + Intergenic