ID: 935227045

View in Genome Browser
Species Human (GRCh38)
Location 2:101061767-101061789
Sequence GGCAGGAAGTGGAGAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 975
Summary {0: 1, 1: 0, 2: 5, 3: 110, 4: 859}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935227045_935227056 23 Left 935227045 2:101061767-101061789 CCTCTTGCTCTCCACTTCCTGCC 0: 1
1: 0
2: 5
3: 110
4: 859
Right 935227056 2:101061813-101061835 CACAAAGCCCCTGGCCCTTCAGG 0: 1
1: 0
2: 1
3: 17
4: 210
935227045_935227052 -3 Left 935227045 2:101061767-101061789 CCTCTTGCTCTCCACTTCCTGCC 0: 1
1: 0
2: 5
3: 110
4: 859
Right 935227052 2:101061787-101061809 GCCATCTGGGAGGGCTCCTGCGG 0: 1
1: 0
2: 0
3: 26
4: 284
935227045_935227055 14 Left 935227045 2:101061767-101061789 CCTCTTGCTCTCCACTTCCTGCC 0: 1
1: 0
2: 5
3: 110
4: 859
Right 935227055 2:101061804-101061826 CTGCGGTGTCACAAAGCCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935227045 Original CRISPR GGCAGGAAGTGGAGAGCAAG AGG (reversed) Intronic
900432861 1:2611247-2611269 GGCAGGCTGTGGACGGCAAGGGG + Intronic
900642766 1:3695299-3695321 AGGAGGAAGTGGGGGGCAAGGGG - Intronic
900658271 1:3770804-3770826 AGGAGGAAGGGGAGAGAAAGAGG + Intronic
900681699 1:3920205-3920227 GGAAGGAAGGGGAGAAAAAGAGG - Intergenic
900731112 1:4260973-4260995 AGCAGGAAGAAGAGAGGAAGGGG - Intergenic
900810568 1:4798562-4798584 GGCAGGAAGAGGAGGGGAAGGGG - Intergenic
900876646 1:5347698-5347720 GGAAGGAAGGGAAGAACAAGAGG + Intergenic
901017346 1:6239573-6239595 GGCAGGAAGGGGAGGGAAGGGGG - Intergenic
901121208 1:6895588-6895610 GGTAGGAAATGGAGAGGCAGAGG - Intronic
901127265 1:6938409-6938431 AGCAGGAGGTGGGGAGCAAAGGG + Intronic
901634570 1:10664559-10664581 GGAAGGAAGAGGAGGCCAAGGGG + Intronic
902189220 1:14749742-14749764 GGCAGGAAATGGAGAGGACTGGG - Intronic
902402811 1:16167379-16167401 AGCAGGAAGAGGAGAGGGAGCGG - Intergenic
902528429 1:17074813-17074835 GACAGGAAGTGGCGAGCTGGAGG - Intronic
902924128 1:19684511-19684533 CGGAGGAAGTTGAGAGCCAGAGG - Intronic
903186022 1:21629500-21629522 GCCAGGAACTGGAGAGCCAAGGG - Intronic
903516707 1:23916069-23916091 GGCTGGAATTGGAGACCCAGGGG + Intergenic
903524084 1:23979920-23979942 GGCAGGAAGCAGGGAGAAAGGGG + Intronic
903561850 1:24233948-24233970 AGCAGGAAAAAGAGAGCAAGGGG + Intergenic
903662606 1:24987503-24987525 GGCAGGAAGCGGCGAGGGAGCGG - Intergenic
903852334 1:26315600-26315622 GCCAGGAAGTGGAGAGGGAGGGG - Intronic
904352414 1:29917337-29917359 GGAGGGAAGGGGAGAGGAAGGGG - Intergenic
904403373 1:30271438-30271460 GGGAGGAAATGGAGAGGCAGGGG + Intergenic
905393605 1:37653320-37653342 CCCAGGAAGTGGAGACCCAGAGG + Intergenic
905627322 1:39497763-39497785 GGCAGGAAGTTGAGGGAAAGAGG + Intronic
905669100 1:39779355-39779377 GGCAGGAAATTGAGGGAAAGAGG - Intronic
905698068 1:39990581-39990603 GTGAGGAAGTTGAGACCAAGAGG - Intergenic
905708660 1:40082053-40082075 GGCTGGAAGGGAAGAGGAAGTGG - Intronic
906192148 1:43905396-43905418 GGCAGGAAGAGGAGCAGAAGGGG - Intronic
906566194 1:46802888-46802910 GGCAGGAAGTGCAGAAGAAAAGG + Intronic
906666480 1:47625697-47625719 GGCAAGAAGTGCTGAGCAAAAGG - Intergenic
906783031 1:48589546-48589568 GGCAGGAAGAGGAGATAAGGAGG - Intronic
907011585 1:50968553-50968575 GGGAGGAGGTGGAGAGCGGGAGG + Exonic
907107269 1:51895106-51895128 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
907246342 1:53111465-53111487 GACAGGAAGCAGAGAGGAAGCGG + Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907390628 1:54155891-54155913 GGCAGGAGAGAGAGAGCAAGCGG + Intronic
907409742 1:54275490-54275512 GGCAGGAAATGGACAGCATTTGG + Intronic
907626586 1:56036292-56036314 GGGGGGATGTGGAGAGTAAGAGG - Intergenic
907791347 1:57667872-57667894 GTCAGGGGTTGGAGAGCAAGGGG + Intronic
907816039 1:57919126-57919148 TGGAGGAAATGGAGAGTAAGGGG - Intronic
908413090 1:63886159-63886181 GACAGGAAGTGGAGCTCAGGTGG + Intronic
908588698 1:65604728-65604750 GACAGGAGGTGGAGCGCAGGTGG - Intronic
908627526 1:66061752-66061774 GTCAGTGGGTGGAGAGCAAGGGG + Intronic
908723486 1:67150416-67150438 GTCAGAAGGTGGGGAGCAAGGGG - Intronic
909297404 1:73968261-73968283 GGCAGGGGGTGGGGAGCAAGGGG + Intergenic
910467718 1:87517909-87517931 GGCAGGAAGTGTTGATAAAGAGG + Intergenic
911093025 1:94032847-94032869 GGTAGAAAGGGGAGAGGAAGTGG + Intronic
911231324 1:95364654-95364676 GGAATGGAGTGGAGAGCAAATGG - Intergenic
911358755 1:96851440-96851462 GGGAGGAACTGGAGCCCAAGAGG + Intergenic
911894038 1:103406554-103406576 GGCAGGAGGTGGAGCTCAGGTGG - Intergenic
911938053 1:104006295-104006317 GTCAGGAGGTGGGGGGCAAGGGG - Intergenic
912181435 1:107223451-107223473 GGCAGGAAGAGGTTAGGAAGAGG + Intronic
912505082 1:110150706-110150728 GGCAGGGAGTGAGGAGCGAGCGG + Exonic
912749834 1:112277544-112277566 GGCAGGGGGTGGAGGGAAAGTGG + Intergenic
912924853 1:113905038-113905060 GGCTGGAACTGGAGAGGGAGGGG - Intronic
914692035 1:150038266-150038288 AGCAGGAAGTGAAGAGAAAAGGG - Intergenic
914703253 1:150151661-150151683 GGCAGGAAGTGGGTAGAAAATGG - Intronic
914826696 1:151142596-151142618 GGCATGAAGTGGGGGGCACGGGG + Exonic
914898450 1:151697693-151697715 GAAAGGAAGTGCAGAGGAAGGGG - Exonic
915656684 1:157366575-157366597 GGCAGGGAGGGGAGAGCAGTGGG + Intergenic
915672281 1:157499665-157499687 GGCAGGGAGGGGAGAGCAGCAGG - Intergenic
915907039 1:159886528-159886550 AGGAGGAACTGGAGAGGAAGAGG - Exonic
916018746 1:160775073-160775095 GGCAGGATGTGGTGGGGAAGAGG + Intergenic
916991932 1:170253890-170253912 GGCAGGAAGTGTCCAGCCAGAGG + Intergenic
917359347 1:174159471-174159493 GGCAGGAAGAGGCGAGGGAGGGG - Intronic
917935569 1:179863430-179863452 GGCTGGAAGTAGAGAGCAAAAGG - Intronic
918339472 1:183556196-183556218 GGCTGGAAGGGGAGTGCAAAGGG - Exonic
919310527 1:195901211-195901233 GGCAAGAAGAGGAGGACAAGAGG + Intergenic
919743108 1:200992327-200992349 GGCGGCTAGTGGAGACCAAGAGG - Exonic
920442234 1:205988996-205989018 GACAGGACGTGGAGAGGATGAGG - Intronic
920851698 1:209632548-209632570 GGTGGGAAGGGGAGAGGAAGGGG - Intronic
921893894 1:220379496-220379518 GGCTGGATGTGGAGAGGACGTGG - Intergenic
922183873 1:223257384-223257406 GGAAGGGAGTGAAGATCAAGTGG + Intronic
922621750 1:226994227-226994249 GGCAGGGAGCGGAGAGCGAGAGG + Exonic
922890071 1:229055106-229055128 GGCAGGAAGTGAACAGGTAGGGG + Intergenic
922987205 1:229874978-229875000 GGCAGGAGCTGGAGAGGAAGTGG + Intergenic
923127028 1:231041091-231041113 GGCAGGACGTCGAGGGCAGGAGG + Intergenic
923400065 1:233608139-233608161 GGCAGGAAGAGGATATGAAGGGG + Intergenic
923630321 1:235645305-235645327 GGCGGGAAGAAAAGAGCAAGAGG - Intronic
924032263 1:239897725-239897747 GGCACGAAGTGAAAAGCAGGCGG - Intronic
924260799 1:242228714-242228736 GAGAGGAAGAGGAGAGGAAGAGG + Intronic
924426214 1:243952564-243952586 GGCTGGAAGTGGAGGGCCTGAGG + Intergenic
924464252 1:244285654-244285676 AGCAGGAAGGGAAGGGCAAGTGG + Intergenic
924927972 1:248702010-248702032 AGCAGGAGGAGGAGAGCAAACGG + Intergenic
1062857581 10:786969-786991 TGCAGAAAGTGGGGAGGAAGAGG - Intergenic
1063253818 10:4304268-4304290 GGCAGGATTTGGTGAGCAAATGG - Intergenic
1063691887 10:8295585-8295607 GGAAGGAGGAGGAGAGGAAGGGG - Intergenic
1064188570 10:13185443-13185465 GGCAAGAAGTGAAGAGGAAGGGG + Intronic
1064598844 10:16973121-16973143 GGGAGCATGTGGAGACCAAGGGG - Intronic
1064788929 10:18933705-18933727 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1064868766 10:19913313-19913335 GGAAGGAAAGGGAGAGCAGGAGG - Intronic
1064978237 10:21140787-21140809 GTCGGGGAGTGGAGGGCAAGGGG + Intronic
1065161498 10:22927589-22927611 GGCAGGAAGAGGAAAGAAAGAGG + Intergenic
1065526666 10:26629148-26629170 GACTGGAACTAGAGAGCAAGCGG + Intergenic
1065852140 10:29799497-29799519 GGCAGGAAATGGAGAGGAAGAGG + Intergenic
1065866419 10:29919059-29919081 GGGAGGAGGTGGAGAGGAGGAGG - Intergenic
1065898981 10:30188184-30188206 GGCAGGGGCTGGTGAGCAAGGGG - Intergenic
1066311447 10:34200946-34200968 GGCAGGCAGTGGGGGGCAGGGGG - Intronic
1067069048 10:43119314-43119336 AGCAGGAGGCAGAGAGCAAGTGG + Intronic
1067187971 10:44046056-44046078 GGGATGAAGTGGAGAGCAGTGGG - Intergenic
1067311174 10:45114971-45114993 GGCAGGAGAAGGAGAGCACGAGG + Intergenic
1067742555 10:48906643-48906665 GGCAGGAACTGCAGGGAAAGGGG + Intronic
1067808289 10:49408184-49408206 GTCAGGGGGTAGAGAGCAAGAGG + Intergenic
1067827611 10:49589676-49589698 GGCAGGAAGGAGAGAGCAATGGG + Intergenic
1068227124 10:54119917-54119939 GTCAGGGAGTGGGGAGCTAGGGG - Intronic
1068610607 10:59056256-59056278 GACAGGAAGTGGAGCTCAGGAGG - Intergenic
1068765567 10:60759401-60759423 GACAGGAGGTGGAGCTCAAGTGG + Intergenic
1069387044 10:67893292-67893314 GTCAGGAGGTGGGGGGCAAGGGG - Intronic
1070385647 10:75921956-75921978 GGAAGGAAGAGGAGAACAATTGG - Intronic
1070512671 10:77175812-77175834 GGCAGGAAGTACAGGGAAAGGGG + Intronic
1071059886 10:81557333-81557355 GTCAGGGGTTGGAGAGCAAGGGG - Intergenic
1072430020 10:95362645-95362667 GGCGGGAGGTGGAGAGTAAAGGG - Intronic
1073478320 10:103768919-103768941 GACAGGAAGCAGAGGGCAAGGGG + Intronic
1073571277 10:104582924-104582946 GGCTGGAAGTGGAAGGCATGAGG + Intergenic
1073668748 10:105563277-105563299 GGCAGGAGGGGGAGAGCACCAGG + Intergenic
1074200160 10:111227489-111227511 GCCAAGAGGTGGAGAGAAAGTGG - Intergenic
1074245927 10:111693259-111693281 AGAAGGAAGAGGAGAGGAAGAGG + Intergenic
1074599056 10:114895358-114895380 AGCAGAAAATGTAGAGCAAGCGG - Intronic
1074961458 10:118449584-118449606 GGGAGGAAGAGGAGCGCACGTGG + Intergenic
1074996108 10:118758869-118758891 GGCAGGTAGTGGAGAGGCTGGGG - Intergenic
1075132800 10:119754792-119754814 GGCAGGGAGAGGAGAGGAGGAGG - Intronic
1075229709 10:120665020-120665042 GTCAGGAAGTGGGAGGCAAGGGG + Intergenic
1075769082 10:124917710-124917732 CGCAGGAGGTGGAAAGCAAGCGG - Intergenic
1075983377 10:126761201-126761223 GTCAGGAGGTTGAGGGCAAGAGG - Intergenic
1076057339 10:127386456-127386478 GGCAGGAGGTGGAGCTCAGGTGG - Intronic
1076068025 10:127464299-127464321 GGCAGAAAGCTGAGAGCAAAGGG + Intergenic
1076179033 10:128391646-128391668 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
1076560078 10:131356911-131356933 GGCAGGGACTGGGGAGCACGAGG + Intergenic
1076778136 10:132709399-132709421 GGAAGGAGGGGGAGAGAAAGAGG + Intronic
1077003912 11:341703-341725 GGCAGAAGGTGAAGAGGAAGGGG - Intergenic
1077095063 11:795739-795761 GGGAGGAAGGGGCGGGCAAGGGG - Intronic
1078347147 11:10560658-10560680 GGCAGGTATTGTAGAGTAAGGGG + Exonic
1078429213 11:11274695-11274717 GTCAGGGAGTGGAGGGCTAGGGG - Intronic
1078706346 11:13747521-13747543 GGAAGGAAGTGGACAGCAAAAGG - Intergenic
1078799416 11:14628027-14628049 GACAGGAGGTGGAGCTCAAGCGG - Intronic
1078962932 11:16300650-16300672 AGCAGGAATGGCAGAGCAAGTGG + Intronic
1079366488 11:19814441-19814463 GGCAGCAAGTGGAAAGCCATGGG - Intronic
1079492982 11:21010358-21010380 GGCAGGGAGGGTGGAGCAAGGGG - Intronic
1079611610 11:22439746-22439768 GTCAGGGAGTGGAGGGCTAGGGG - Intergenic
1080278354 11:30527799-30527821 GGCAGGAATTGGAGAGACAGGGG - Intronic
1080385866 11:31810749-31810771 GGAAGGAAGGGGGGAGGAAGGGG + Intronic
1080470309 11:32538977-32538999 GACAGGAAGTGGAGCTCAGGCGG + Intergenic
1080573761 11:33579781-33579803 GGATGGAAGAGGAAAGCAAGAGG + Intronic
1080653699 11:34242286-34242308 GGCAGGAGGGTGGGAGCAAGGGG + Intronic
1080668279 11:34354927-34354949 GGCAGGAAGTGGAGGGCCAGGGG - Intronic
1080962265 11:37174360-37174382 GGCAGGAGAGAGAGAGCAAGGGG - Intergenic
1081068600 11:38579965-38579987 GTCTGGGAGTGGGGAGCAAGGGG - Intergenic
1081541099 11:44035142-44035164 GGTAGGATATTGAGAGCAAGAGG - Intergenic
1081693378 11:45093325-45093347 GAAAGGCAGTGGAGAGGAAGGGG + Intergenic
1081699457 11:45144013-45144035 GGCAGAAAGTGGGCAGAAAGTGG - Intronic
1081747702 11:45484537-45484559 GGGAGGAAGTGGAGGGAAAGAGG + Intergenic
1081886904 11:46505749-46505771 GGAAGGAAGGGGAGAGAGAGAGG + Intronic
1083162886 11:60866462-60866484 TGCTGGAAGGGGAGAGCAAGAGG - Intergenic
1083369811 11:62169549-62169571 GTCTGGAAGTGGAGAACCAGAGG + Intergenic
1083484913 11:62977180-62977202 TGCAGGACCTGGAGAGCAGGTGG - Exonic
1083673619 11:64313820-64313842 GGGAGGAAAGGGAGAGCAGGGGG - Intronic
1083687060 11:64382826-64382848 GGCAGGAGATGGTGAGAAAGGGG - Intergenic
1083929436 11:65832730-65832752 GGCAGAAAGCTGAGATCAAGTGG - Intronic
1084009805 11:66341130-66341152 GGCAGGAACGAGAGAGGAAGGGG + Intronic
1084144881 11:67259801-67259823 GGCTGTGAGTGGAGAGGAAGAGG - Intergenic
1084427585 11:69094110-69094132 GGCAGGAGGTGCAGTGCCAGGGG + Intergenic
1084582527 11:70032826-70032848 GGAAAGAAGTGGAGGGAAAGAGG + Intergenic
1084582943 11:70035682-70035704 GTCAGGGGGTGGGGAGCAAGGGG - Intergenic
1084793417 11:71489373-71489395 GCCAGGAAGTGGGGACCATGGGG - Intronic
1085537217 11:77229319-77229341 GGCTGGAGGAGGAGAGGAAGAGG + Intronic
1085592653 11:77778231-77778253 GGAGGGAAGGGGAGAGCATGGGG + Intronic
1085804654 11:79624091-79624113 GACAGGAAGTGGAGGGCTAAGGG + Intergenic
1085853760 11:80152396-80152418 GGCAGAACACGGAGAGCAAGGGG - Intergenic
1086222399 11:84463927-84463949 TGCCCGAAGTGGAGGGCAAGAGG - Intronic
1086453789 11:86942185-86942207 AGCAGGAAGTGGCAAGCAGGAGG + Intronic
1087173693 11:95076716-95076738 ATAAGGAAGTGGAGAGCCAGAGG - Intergenic
1087635609 11:100697864-100697886 CGGTGGGAGTGGAGAGCAAGGGG + Intronic
1088572081 11:111232050-111232072 GGCAGGAATCTGAGATCAAGTGG - Intergenic
1088723110 11:112611783-112611805 GGCAGGAGGTGGAGAACAGCTGG + Intergenic
1088804262 11:113337527-113337549 GCCAGCAAGAGGAGAGCAACAGG + Intronic
1089043041 11:115471949-115471971 GGGAGGAAGAAGAGGGCAAGGGG + Intronic
1089664677 11:120010697-120010719 AAGAGAAAGTGGAGAGCAAGAGG - Intergenic
1089706079 11:120278760-120278782 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
1089827380 11:121291029-121291051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1089868529 11:121652354-121652376 GGCATGAAGTGGGGAGAAAGGGG - Intergenic
1089957151 11:122582043-122582065 GTCAGGAGGTGGGGGGCAAGGGG - Intergenic
1090167952 11:124571200-124571222 GGAAGGAAGAGGAAAGGAAGAGG - Intergenic
1090703179 11:129314684-129314706 GGCAGGGAGGGGAGGGGAAGGGG - Intergenic
1091369033 11:135043490-135043512 GGCAGCAAGTAGAGTACAAGTGG + Intergenic
1091568146 12:1662604-1662626 GGCGGGAAGTGGGGAGGAGGAGG - Intergenic
1091915536 12:4269996-4270018 GTCGGGAAGCGGAGAGCACGGGG - Intergenic
1092284399 12:7120537-7120559 AGCAGGAGGTGAAGGGCAAGAGG - Intergenic
1092729263 12:11512959-11512981 AGCAGGAAGTGGAGAACTTGGGG + Intergenic
1093004245 12:14034838-14034860 GGGAGGAAGTAGGGGGCAAGGGG + Intergenic
1093066672 12:14665382-14665404 GGGAGGAAGCTGAGAGCATGGGG + Intronic
1094355564 12:29573991-29574013 GGGAGGAAGTGGAAAGGGAGGGG + Intronic
1095605192 12:44059119-44059141 GACAGGAAGTGGAGCTCAGGTGG + Intronic
1095632266 12:44392268-44392290 GGCAGATGGTGGAGAACAAGTGG + Intergenic
1096245953 12:49986564-49986586 AGCAAGAAGTGCAGAGCAAAAGG + Intronic
1096370423 12:51064532-51064554 AGCTGGAGCTGGAGAGCAAGCGG - Exonic
1096478506 12:51923135-51923157 GGCAGGAAGTGGAGTGACAGGGG + Intronic
1096667195 12:53173664-53173686 GGCAGTCAGTGCTGAGCAAGTGG + Intronic
1097627921 12:62023219-62023241 GGTTGGAAGTGGAGGGAAAGGGG + Intronic
1097705792 12:62866946-62866968 GGCAGGAGGGGGAAAGCATGGGG - Intronic
1097924081 12:65108627-65108649 GGAAGGCAGTGGAGAGGGAGGGG - Intronic
1097956594 12:65493151-65493173 TTCAGCAAGTGGAGAGGAAGTGG + Intergenic
1097981432 12:65741423-65741445 GGCAGGAAGCGGTGGGCTAGCGG - Intergenic
1098370057 12:69749184-69749206 GACAGGAGGTGGAGCTCAAGTGG - Intronic
1098915661 12:76254413-76254435 AGCAGGAAGTGAACAGCAAGAGG - Intergenic
1099011143 12:77292531-77292553 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1099485713 12:83226982-83227004 ACCAGGGGGTGGAGAGCAAGGGG - Intergenic
1099809470 12:87562202-87562224 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1100143483 12:91648236-91648258 GCCAAGAAGTGGAAAGGAAGAGG + Intergenic
1100658484 12:96672058-96672080 GGCAGGAAATGTAGAGCTGGGGG + Intronic
1101086261 12:101239496-101239518 GGGAGGAAGTGCACAGCAACTGG - Intergenic
1101138775 12:101773305-101773327 GGGAGCAGGTGGAGAGCATGGGG - Intronic
1101827655 12:108232906-108232928 GGCAGGGAGGGCAGGGCAAGAGG + Intronic
1102373066 12:112398788-112398810 GTCAGGGAGTTGAGGGCAAGGGG + Intergenic
1102455605 12:113069240-113069262 AGCAGGAAGTGGAGGGGGAGGGG - Intronic
1102555601 12:113724653-113724675 GTCAGGAAGGGGAGGGCCAGGGG + Intergenic
1102604357 12:114057262-114057284 GGCAGGTGGGGGAGAGCTAGTGG - Intergenic
1103034171 12:117642881-117642903 GGAAGGAAGGGGAGACCCAGGGG + Intronic
1103199138 12:119072344-119072366 GGAAGGAAGGAGAGAGGAAGGGG - Intronic
1103948698 12:124540613-124540635 GGTGGGAGGTGGAGAGCTAGAGG + Intronic
1103948922 12:124541257-124541279 GGCTGGGGGTGGAGAGCTAGAGG + Intronic
1103948977 12:124541420-124541442 GGTGGGGAGTGGAGAGCTAGAGG + Intronic
1104085916 12:125474129-125474151 GGCAGGAAGGCGAGAGAGAGAGG - Intronic
1104245974 12:127041802-127041824 GGCAGGAGGAAGAGAGAAAGTGG + Intergenic
1104443060 12:128810948-128810970 GGCAGGGAGTGGAGGGACAGTGG - Intronic
1105222463 13:18344655-18344677 GGCTGGAAGTGAAGTGCAAATGG + Intergenic
1105430326 13:20331244-20331266 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1105900944 13:24752698-24752720 GACAGGAAGTGGAGCTCAGGTGG + Intergenic
1106256015 13:28022596-28022618 GGAAGGAAGTGGAGGAGAAGAGG + Intronic
1106471524 13:30060332-30060354 AGTAGGAAGTGGGGAGCCAGGGG - Intergenic
1106601525 13:31191642-31191664 GCTTGGAAGTGTAGAGCAAGGGG + Intergenic
1108028447 13:46203314-46203336 GACAGGCAGTGGAGAGCTACTGG - Intronic
1108033003 13:46256438-46256460 GGCAGAAACTGGAAAGCAGGTGG + Intronic
1108583466 13:51847280-51847302 GACAGGAAGTGGAGCTCAGGTGG - Intergenic
1108854056 13:54771868-54771890 GCCAGGGGGTGGAGGGCAAGGGG - Intergenic
1109393048 13:61718556-61718578 GGCAGGGGGTGGAGAGCATCAGG - Intergenic
1109533309 13:63682895-63682917 GTCAGGGGGTGAAGAGCAAGGGG - Intergenic
1109648781 13:65296837-65296859 GGCAGGAAGTGGAGCTCAAGTGG + Intergenic
1109648801 13:65296992-65297014 GGCAGGAGGTGGAGCTCAAGTGG + Intergenic
1109693697 13:65926790-65926812 GGCAGGAACTAGAGTGCAGGAGG + Intergenic
1109921141 13:69061242-69061264 GGCAGGAAGAGGAGAGTGAAAGG + Intergenic
1110243977 13:73300596-73300618 GGAAGGAAGAGGAAAGCCAGTGG - Intergenic
1110575882 13:77054293-77054315 GGCAGCAAATGGAGAGCAAATGG + Intronic
1110655688 13:77996006-77996028 TGTAGGGAGTGGGGAGCAAGGGG + Intergenic
1110817636 13:79879701-79879723 GGCCAGAAATGGAGAGAAAGGGG + Intergenic
1111073182 13:83196894-83196916 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1111742831 13:92226096-92226118 GGCAGGAGAGAGAGAGCAAGAGG - Intronic
1111992948 13:95134802-95134824 GGTGGGAAGAGGAGTGCAAGAGG + Intronic
1112294540 13:98175448-98175470 GGGAGGGAGTGGAGAGGATGGGG - Intronic
1112695413 13:101942983-101943005 GGCAGAAAGTGGGGATTAAGAGG - Intronic
1113305533 13:109074480-109074502 GGCAGGAGACAGAGAGCAAGGGG + Intronic
1113868202 13:113543010-113543032 GGCCGGGGGTGCAGAGCAAGGGG - Intronic
1113895490 13:113761411-113761433 GCCAGGAAGGGGAGAGCAGGTGG + Intronic
1114550715 14:23531414-23531436 AGCAGGATGTGGGGAGCAGGGGG - Intronic
1115385421 14:32790763-32790785 GCCAGGGAGTGGGGGGCAAGGGG - Intronic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1115985899 14:39103262-39103284 GGCAGGAAGGGGGCAGGAAGGGG + Exonic
1116286580 14:42980553-42980575 GACAGGAAGTGGAGCTCAGGTGG + Intergenic
1116776196 14:49183654-49183676 GTCGGGGAGTGGGGAGCAAGGGG + Intergenic
1116779339 14:49218859-49218881 GGCAGGAGGTGGAGAGGTGGGGG + Intergenic
1118065417 14:62185358-62185380 GGAGGGAAGTGGACAGCCAGTGG + Intergenic
1118820548 14:69342508-69342530 GGAAGGAAGGGGAGAGGGAGAGG + Intronic
1119207659 14:72806723-72806745 GGCAGGGAGGGGAGAACTAGGGG - Intronic
1119378751 14:74215420-74215442 GGGAGGGAGTGGAGAGGAAGTGG - Intergenic
1119583749 14:75812240-75812262 GGGAGGAGGAGGAGAGCAAGGGG + Intronic
1120502263 14:85311082-85311104 GGAAGGAAGTGGAAAGGAAGTGG - Intergenic
1120797982 14:88656463-88656485 GTCAGGGAGTGGGGAGCTAGGGG + Intronic
1121038373 14:90725415-90725437 GGCAGGAAAAGGAGTCCAAGAGG - Intronic
1121451743 14:94012404-94012426 GAGAGGAAGGGGAGAGGAAGGGG - Intergenic
1122292413 14:100686875-100686897 GGCAGGAGGGGGAGGGGAAGAGG + Intergenic
1122381388 14:101309596-101309618 GGCAGGTAGGGGAGGGCTAGTGG + Intergenic
1122515396 14:102304918-102304940 GGCAGGGACTGGAGAGCGAGTGG - Intronic
1122917740 14:104866496-104866518 GGCAGGCACTGGAGGCCAAGGGG - Intronic
1124545929 15:30626468-30626490 AGCAGGAAGTGGAGAGAATCTGG + Exonic
1125078936 15:35654103-35654125 GGCAAGAAGGGGAGAGCAAAAGG - Intergenic
1125084549 15:35714817-35714839 GTCAGGGGGTGGGGAGCAAGGGG - Intergenic
1125599409 15:40907121-40907143 AACAGGAAGTGGAGAGGAAAAGG + Intergenic
1126369096 15:47926917-47926939 GGCAAGAGGTGGAGAGCCATGGG + Intergenic
1126441528 15:48694657-48694679 GGCAGGAGGTAGAGAGCAAAGGG - Intergenic
1126474938 15:49055409-49055431 GACAGGAGGTGGAGCTCAAGTGG + Intergenic
1126613233 15:50550756-50550778 GTCAGGGAGTGGGGAGCTAGAGG - Intergenic
1126658006 15:51001517-51001539 GCCAAGAGGTGGAGAGGAAGGGG - Intronic
1126679312 15:51188252-51188274 GGCAGGAGGTGCAGACCCAGAGG - Intergenic
1126764776 15:52001155-52001177 GACAGAAAGTGGAAGGCAAGAGG - Intronic
1126866187 15:52939770-52939792 GGCAGGAACGGGACAGAAAGGGG + Intergenic
1127244573 15:57158089-57158111 GGAGAGAAGTGGAGAGCATGAGG + Intronic
1127760204 15:62132048-62132070 GGGAGGGAGTGGAAATCAAGAGG + Intergenic
1127794662 15:62427472-62427494 GGCAGGAAGAGGAAGGCAACGGG + Intronic
1127873102 15:63089561-63089583 GGCAGGATGTGGAGTGAGAGAGG + Intergenic
1127895624 15:63296302-63296324 GGCAGGATGTGAAGATCAATGGG - Intronic
1128108602 15:65062103-65062125 TGGAGGAGGAGGAGAGCAAGAGG + Intronic
1128564712 15:68693270-68693292 GGCAGGAAGTGGTGGGGAAGAGG + Intronic
1128702816 15:69816501-69816523 GTAAGGAAGGGGACAGCAAGAGG - Intergenic
1128940883 15:71786786-71786808 GGCAGGAAGAGGGGAGGAGGAGG + Intergenic
1129238352 15:74237123-74237145 GCCAGGGATTGGAGAGCATGGGG - Intronic
1129267704 15:74402899-74402921 GGCAGGTAGCTCAGAGCAAGAGG + Intergenic
1129281726 15:74490278-74490300 GGCAGGAAGTGGAGACAGAAAGG - Intergenic
1129503616 15:76062556-76062578 GGCAAGAAGCAGAAAGCAAGAGG + Intronic
1129720500 15:77875434-77875456 GGCAGGATGGGCAGAGCAAGAGG - Intergenic
1129783842 15:78294437-78294459 GGCAGGGATGGGAGAGCAGGTGG - Intronic
1130063573 15:80586991-80587013 GGCAGGAGCTGGGGAGGAAGAGG - Intronic
1130145240 15:81269103-81269125 GGCAGGAGGTGGTGGGCAAGGGG - Intronic
1130410371 15:83642916-83642938 GGGAGGAAGTGCAGAACAACTGG - Intergenic
1130586630 15:85188563-85188585 GGCAGAAAAAGGAGATCAAGAGG + Intergenic
1130615430 15:85402206-85402228 GGCATGAAAAAGAGAGCAAGTGG + Intronic
1131014163 15:89043547-89043569 GGAAGGAGGAGGAGAGGAAGAGG + Intergenic
1131015973 15:89058191-89058213 GGCCAGAAGTGGAGAGCCAGGGG - Intergenic
1131017871 15:89072549-89072571 AGCAGGAGGGGGAGAGGAAGGGG + Intergenic
1131055063 15:89370210-89370232 GGCAGGGAGTGCAGGGCAAGGGG - Intergenic
1131981930 15:98002975-98002997 GGCAGGAAGGGGAGGGGAGGTGG + Intergenic
1132047297 15:98575172-98575194 GGGAGGAGGAGGAGAGAAAGGGG - Intergenic
1132207987 15:99999535-99999557 GTGAGGAAGGGGAGAGCGAGGGG + Intronic
1132814118 16:1817813-1817835 AGCAGCAAGAGGAGGGCAAGCGG - Intronic
1132834898 16:1947844-1947866 GGCAGACGGTGGGGAGCAAGGGG + Intronic
1133320212 16:4909077-4909099 GGCAGGAGGTGGAGGCCCAGGGG + Intronic
1133422331 16:5656928-5656950 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1133859070 16:9577026-9577048 GTCAGGAGGTGGGGGGCAAGGGG - Intergenic
1133977032 16:10606751-10606773 GGCAGGGAAGAGAGAGCAAGCGG + Intergenic
1133978637 16:10617825-10617847 GGCAGGATCTGGAGAGGGAGAGG + Intergenic
1134073921 16:11277403-11277425 GGGAGGAGGTGGAGAGCCAAGGG - Intronic
1134518113 16:14903365-14903387 GGCAGGAAGTGGTGAGCTTGGGG + Intronic
1134601706 16:15538795-15538817 GGCAGCAAGTGGAGAGGAACTGG - Intronic
1134682156 16:16133811-16133833 GGCAGGAAGGGGAGAACTGGAGG + Intronic
1134690252 16:16186491-16186513 GGCAGGAGGTGGAGCTCAGGCGG - Intronic
1134705784 16:16302019-16302041 GGCAGGAAGTGGTGAGCTTGGGG + Intergenic
1134779766 16:16885237-16885259 GGGAGGAAATGGGGAGAAAGGGG - Intergenic
1134961757 16:18410095-18410117 GGCAGGAAGTGGTGAGCTTGGGG - Intergenic
1134966055 16:18492694-18492716 GGCAGGAAGTGGTGAGCTTGGGG - Intronic
1135183137 16:20292210-20292232 GGCAGGAAGAAGTGGGCAAGGGG - Intergenic
1135344689 16:21679076-21679098 AGAAGCAAGTGGAGATCAAGGGG - Intronic
1136367408 16:29815118-29815140 GGCGGGACGTGGAGAGGAAAGGG - Intronic
1136574993 16:31117990-31118012 GGCTGGGAGTGGAGAGGAGGAGG + Intronic
1137551641 16:49441522-49441544 GGCGGGCAGTGGAGAGGAGGCGG - Intergenic
1138109548 16:54312667-54312689 GACAGGAGGTGGAGCTCAAGTGG + Intergenic
1138152179 16:54669017-54669039 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
1138196417 16:55055468-55055490 GACAGGAAGTAAAGAGGAAGGGG - Intergenic
1138418898 16:56886700-56886722 GCCAGGAAGGGGAGAGAATGGGG - Intronic
1138592573 16:58010127-58010149 GGGAGGGAGTGGAGAGGCAGAGG - Intronic
1138629733 16:58283860-58283882 GGCAGGATTTTTAGAGCAAGGGG - Intronic
1138667411 16:58583575-58583597 CACAGGAAGTGGAGCCCAAGCGG - Intronic
1139475666 16:67201435-67201457 GGTAGGAAGTGGTGGGCCAGGGG + Exonic
1139492325 16:67292933-67292955 GGCAGGTAGTGGAGGGAAGGAGG - Intronic
1139686665 16:68609298-68609320 GGCAGCAGGTGCAGAGGAAGTGG + Intergenic
1140256268 16:73338928-73338950 GGCAGGAGGAAGAGAGCAAGGGG - Intergenic
1140277355 16:73522608-73522630 GGCAGGAAATTTAGGGCAAGAGG + Intergenic
1140559345 16:75959958-75959980 GGAAGGAAGTGAAGAGATAGGGG - Intergenic
1140884609 16:79232045-79232067 GACAGGAGGTGGAGCTCAAGTGG + Intergenic
1141330410 16:83105835-83105857 GGCAGGTAGTGAAGACCAGGAGG + Intronic
1141335114 16:83147347-83147369 GGCAGGAAGTGGAGGCAAAGGGG - Intronic
1141357867 16:83365523-83365545 GCCAGGAGGTGGAGATCATGGGG - Intronic
1141520293 16:84574270-84574292 GGCGGGATGTGGGGAGAAAGTGG - Intronic
1141830353 16:86506900-86506922 GGCGGGGAGTGGAGAGAATGGGG - Intergenic
1141833043 16:86520262-86520284 TGCACGAAGTGGACAGCAGGTGG - Intergenic
1141920125 16:87130056-87130078 GGCAGGAAGAGGGGAGCTGGGGG - Intronic
1142116828 16:88361213-88361235 GACAGGAAGTGGAGCTCAGGTGG + Intergenic
1142358849 16:89616815-89616837 GCCAGGAAGTGGCCAGGAAGCGG + Intronic
1142358852 16:89616826-89616848 GCCAGGAAGCGGACAGGAAGTGG + Intronic
1142358861 16:89616859-89616881 GGCAGGAAGTGGGCAGGAAGCGG + Intronic
1142713943 17:1737928-1737950 AGCAGGAAGTTAAGAGCAGGAGG + Exonic
1143032022 17:3973200-3973222 GGCAGGAAGTGGTGAGGGTGGGG - Intergenic
1143088743 17:4435971-4435993 GACAAGAAGAGAAGAGCAAGTGG - Intronic
1143103244 17:4515352-4515374 GGCTGGCAGTGGAGAGCAGCCGG + Intronic
1143136452 17:4715144-4715166 CACAGGAAGTGGGGAGCTAGGGG - Intronic
1143209642 17:5175587-5175609 GGAAGCAAGTAGAGAGCAGGTGG + Intergenic
1143447616 17:7018521-7018543 GGCAGGAAATGGAGACCAGGGGG + Intergenic
1143524949 17:7466457-7466479 GGCTGGAGGGGGAGAGGAAGAGG + Exonic
1144020761 17:11239279-11239301 GGGAGGAAGTGCAGAGGAAGAGG + Intergenic
1144367786 17:14561246-14561268 GGCAGGAAGAAGACAGCAATAGG - Intergenic
1144413597 17:15024378-15024400 GGCAGGAGGTGGTGAGGTAGGGG - Intergenic
1144584065 17:16477468-16477490 GGCAGGAAGGGGAGACCAGGCGG + Intronic
1144617755 17:16792088-16792110 GGAAGCAAGTAGAGAGCAGGTGG - Intronic
1144697324 17:17313814-17313836 GCCAGGTAGTGAAGGGCAAGGGG + Intronic
1144832777 17:18140756-18140778 GGCAGGAAGAGGACAGCATGAGG - Intronic
1144854098 17:18258549-18258571 GACAGGAAGCGGAGGCCAAGCGG + Intronic
1144894950 17:18523594-18523616 GGAAGCAAGTAGAGAGCAGGTGG + Intergenic
1145029958 17:19496842-19496864 GGCAGGGAGTGGACAGCAAAAGG + Intronic
1145137272 17:20420640-20420662 GGAAGCAAGTAGAGAGCAGGTGG - Intergenic
1145215803 17:21051402-21051424 GGCAGGAAGGGAAGAAAAAGAGG + Intergenic
1146370804 17:32264950-32264972 GGTGGGAAGAGGAAAGCAAGAGG + Intergenic
1146938545 17:36827353-36827375 GGCAGGAAGAGCAGGGGAAGGGG - Intergenic
1146977800 17:37130654-37130676 GGCAGCTGGTGGAGAGAAAGGGG - Intronic
1147421138 17:40322709-40322731 GGCAGGAAGTGGAAAAGAGGGGG + Intronic
1147870371 17:43582870-43582892 GGCAGAGAGAGGAGAACAAGAGG + Intergenic
1147947008 17:44086111-44086133 GGCAGGAGGGGGAAAGCAGGAGG - Intronic
1148096448 17:45055752-45055774 GGCAGGAACTGGAGAGTCAGGGG - Intronic
1148341131 17:46874138-46874160 GGCAGGAAGTAGTGAGCTGGTGG + Intronic
1148545316 17:48514354-48514376 GGCAGGCAGAGGAGAGGAAAGGG - Intergenic
1148687667 17:49509637-49509659 GTCAGGAAGCAGAGAGCCAGTGG - Intronic
1148736030 17:49865405-49865427 GGGAGGCAGGGGAGAGAAAGAGG + Intergenic
1148743701 17:49907121-49907143 GGCTGGAAGTGGGGACAAAGCGG + Intergenic
1149003310 17:51779022-51779044 GGCAGGAAGTACAGAGCCTGGGG + Intronic
1149444216 17:56701084-56701106 GGCACGAACTGGGGAGCCAGAGG + Intergenic
1149532737 17:57408524-57408546 GGCAAGGAGAGGAGAGCCAGCGG + Intronic
1149656669 17:58312725-58312747 GGCAGGAGGAGGACAGGAAGGGG + Intronic
1149827038 17:59838175-59838197 GGCAGGGATTGGATAGGAAGAGG - Intronic
1149870503 17:60176619-60176641 GGAAGCAAGTAGAGAGCAGGTGG - Intergenic
1149995267 17:61402966-61402988 GAGAGAAAGTGGAGAGGAAGAGG + Intronic
1150525943 17:65922909-65922931 GGCTGGAATTGGGGAGGAAGGGG - Intronic
1150583633 17:66498127-66498149 GGCAGGAGGCGGGGAGCAGGGGG - Intronic
1150981851 17:70151345-70151367 GACAGGAAGTGGAGCTCAGGTGG - Intergenic
1151075498 17:71267509-71267531 GTCAGGAGGTGGGGGGCAAGAGG + Intergenic
1151100275 17:71548843-71548865 GGAAAGAAGTGGGGGGCAAGGGG - Intergenic
1151350233 17:73527519-73527541 GGCAAGAAGAGGAAAGGAAGAGG + Intronic
1151649373 17:75456773-75456795 GCCCGAAAGTGGGGAGCAAGGGG + Intronic
1151745668 17:76010424-76010446 AGCTGGAAGAGGAGAGGAAGCGG - Exonic
1151911116 17:77083943-77083965 GGGAGGCAGAGGAGAGCAGGGGG - Intergenic
1152178878 17:78805573-78805595 GGCAGGAAGTTGAGAGTAACTGG - Intronic
1152417338 17:80171157-80171179 GGGAGGAAGGGGAGGGGAAGGGG - Intronic
1152649392 17:81484818-81484840 GGCAGGAACTGGGGAGCATAAGG + Intergenic
1152793223 17:82293216-82293238 GGAGGGAAGAGGAGGGCAAGGGG + Intergenic
1154085428 18:11300577-11300599 CGCAGTAAGTGGAGGACAAGTGG - Intergenic
1154143064 18:11842674-11842696 GACAGGAGGTGGAGCTCAAGTGG + Intronic
1154162242 18:11989314-11989336 GGCAGGAGGGGGAGAGGAGGCGG + Intronic
1155073014 18:22332712-22332734 GGCAGCAAATGCAGACCAAGAGG - Intergenic
1155123107 18:22842768-22842790 GGCAAGAATGGGAGAGCAAGAGG + Intronic
1155261013 18:24042464-24042486 GACAGGAGGTGGAGCGCAGGTGG + Intronic
1155519682 18:26656385-26656407 GGGAGGAGGTGGGGAGGAAGAGG + Intronic
1156501505 18:37562479-37562501 TTAAGGAAGGGGAGAGCAAGAGG + Intronic
1156766529 18:40663154-40663176 GGCTGGAAGGGTAGAGGAAGTGG - Intergenic
1156875186 18:42001992-42002014 TGCAGGAGGTGTAGAGGAAGTGG + Intronic
1157068688 18:44381017-44381039 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
1157118738 18:44887757-44887779 GGCAGAAAGTAGTGAGCAAGTGG + Intronic
1158133872 18:54184257-54184279 GGCAGGAGGTGGAGCCCAGGTGG - Intronic
1158244331 18:55413679-55413701 GGAAGGAAGAGGAGAGGCAGAGG + Intronic
1158387180 18:57008195-57008217 GACAGGAAGGAGAGGGCAAGCGG - Intronic
1158446281 18:57524727-57524749 AGGAGGAAGAGGAGAGGAAGAGG + Intergenic
1158446283 18:57524738-57524760 GAGAGGAAGAGGAGAGGAAGAGG + Intergenic
1158889787 18:61862413-61862435 AGCAAGAGGTGAAGAGCAAGAGG + Intronic
1159076370 18:63686020-63686042 GGGAGCAAGTGGAAAGGAAGAGG - Intronic
1159503711 18:69307020-69307042 GTCAGGAAGTGGGGGGCATGGGG + Intergenic
1159778792 18:72637093-72637115 GGTAGGGAATGGAAAGCAAGGGG + Intronic
1160409701 18:78667522-78667544 AACATGGAGTGGAGAGCAAGAGG + Intergenic
1160749748 19:728180-728202 GGCAGGAAGGGGACAGGATGGGG + Intronic
1161059790 19:2209188-2209210 GGCTGGGAGAGGAGAGGAAGAGG - Intronic
1161524108 19:4742934-4742956 GGCAGGGAGAGGGGACCAAGGGG - Intergenic
1161574660 19:5048855-5048877 GGCGGGAAGTGGCGAGCAGCCGG + Intronic
1161604808 19:5208746-5208768 GGCAAGAAGTGGTGAGGATGAGG - Intronic
1162333802 19:10047465-10047487 GGCAGGAAGTTGAGGGCTTGGGG - Intergenic
1162646323 19:12052787-12052809 GCCAGGAAATGGTGAGCATGCGG - Exonic
1162890881 19:13732227-13732249 GGCAGGACGTGAAGGGGAAGAGG + Exonic
1163011713 19:14430780-14430802 GGCTGGAAGGAGTGAGCAAGGGG + Intergenic
1163182543 19:15614768-15614790 GGCTGGCAGTGGAGGGCAACAGG + Intergenic
1163351229 19:16777615-16777637 GGAGGGAAGTGGAGGGGAAGGGG + Intronic
1163609014 19:18291687-18291709 GGGAGGAAGTGGCGAGAATGCGG + Intergenic
1163611375 19:18303616-18303638 GGCAGGAAATGGGGAGGATGTGG - Intergenic
1163827251 19:19530546-19530568 GGGAGGAAGTGGAGGGCGGGAGG - Intronic
1164580472 19:29432128-29432150 GTGAGGAAGTGGAGAGGAAGTGG - Intergenic
1164654440 19:29910313-29910335 GGAAGGAAGGAGAGAGAAAGGGG - Intergenic
1164673617 19:30087717-30087739 GGCACCAAGTGGGGAGAAAGAGG - Intergenic
1164814701 19:31186430-31186452 GGCAAGAAGTGCTGAGCAAAAGG - Intergenic
1165506919 19:36238874-36238896 GGCAGGAGGTGGAGCTCAGGTGG - Intronic
1166002460 19:39885946-39885968 GGCAGGGAGGGGAGAGCTTGAGG - Intronic
1166005245 19:39902198-39902220 GGCAGGGAGGGGAGAGCTTGAGG - Intronic
1166128506 19:40731227-40731249 GACAGGAGGTGGAGTTCAAGCGG - Intronic
1166228430 19:41411521-41411543 GGCAGGAAGTAGAGGGAAGGCGG + Intronic
1166305281 19:41934036-41934058 GCCAGGAAGTGGGGAGGAAGGGG + Intergenic
1166426233 19:42680859-42680881 GGCAGGAAGAAGAGAGCAAGGGG - Intronic
1166522049 19:43486993-43487015 GGAAGGAAGTGGGGAACAGGGGG + Intronic
1166542713 19:43616025-43616047 GGCAGGAAATGGAGGGCAGGAGG + Intronic
1168079880 19:54002029-54002051 GGAAGGAAGGGGAGAGAAGGAGG - Intronic
925109675 2:1323158-1323180 GGTAGGAAGTGGAAAGGAGGTGG + Intronic
925340218 2:3130999-3131021 GGCAGGAAGTGGACAGAGAGGGG + Intergenic
925473413 2:4186794-4186816 GTCGGGAGGTGGGGAGCAAGGGG - Intergenic
926147847 2:10407579-10407601 GGCAGGAAATGCTGAGAAAGGGG + Intronic
926391112 2:12393828-12393850 AACAGGAAGAGGAGAGGAAGTGG + Intergenic
926669000 2:15558207-15558229 GACAGGAAGTGGAGCTCAGGTGG + Intronic
926990823 2:18677724-18677746 GGCCAGAACTGAAGAGCAAGTGG - Intergenic
928179126 2:29055343-29055365 AGTAGGAAGTGGGGAACAAGGGG + Exonic
928787225 2:34903223-34903245 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
929008279 2:37416362-37416384 GACAGGAAGTGGAGCTCAGGTGG - Intergenic
929656685 2:43739700-43739722 GGCAGGAAGTGGAGAAAGAGCGG - Intronic
929817559 2:45246941-45246963 GTCAGGTGGTGGGGAGCAAGGGG + Intergenic
929967377 2:46545208-46545230 TGGAGGATGTGGAGGGCAAGGGG + Intronic
930671423 2:54155481-54155503 GGCAGGAAGTGGAGCTCAGGTGG - Intronic
930959966 2:57250043-57250065 GGCAGAAGGTGAAGAGGAAGAGG - Intergenic
931118444 2:59190090-59190112 GGCGGGAAGGGGAGGGGAAGAGG - Intergenic
931245884 2:60492516-60492538 GTGAGGAAGGAGAGAGCAAGGGG - Intronic
931802449 2:65771808-65771830 GGAAGGAAATGCAGGGCAAGAGG - Intergenic
933920225 2:87038629-87038651 GGCAGGAAGTGAAGTGAAGGTGG + Intergenic
933931399 2:87155157-87155179 GGCAGGAAGTGAAGTGAAGGTGG - Intergenic
933969689 2:87460352-87460374 GGAAGGAAGTGGAGGGCAAAAGG + Intergenic
934002772 2:87731264-87731286 GGCAGGAAGTGAAGTGAAGGTGG - Intergenic
934250597 2:90350990-90351012 GGCAGGTGCTGGAGAGCAAGTGG - Intergenic
934258971 2:91452420-91452442 GGCAGGTGCTGGAGAGCATGTGG + Intergenic
934573874 2:95388539-95388561 GGCAGGGTGAGGGGAGCAAGAGG - Intergenic
934785294 2:97000781-97000803 GTCAGGGGGTGGAGGGCAAGGGG - Intronic
934853420 2:97715159-97715181 GGCAGGGAGTGGTCAGCACGGGG - Intronic
935227045 2:101061767-101061789 GGCAGGAAGTGGAGAGCAAGAGG - Intronic
935734462 2:106095878-106095900 GGCAGGAAGGGCACAGCAGGCGG + Intronic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
936068979 2:109353029-109353051 GGCACCCAGTGGAGAGCAGGTGG - Intronic
936079324 2:109421624-109421646 GGGAGAAGGTGGAGAGCTAGAGG - Intronic
936091719 2:109505850-109505872 TGTAGGAAGAGGAGAGCCAGAGG + Intergenic
936324094 2:111490145-111490167 GGAAGGAAGTGGGGGGCAAAAGG - Intergenic
936361720 2:111810282-111810304 GGCAGGAAGTGAAGTGAAGGTGG + Intronic
936478214 2:112859763-112859785 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
936527781 2:113253472-113253494 GGCAGGAGGTTGAGTGGAAGGGG - Intronic
936850196 2:116886834-116886856 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
937266046 2:120615219-120615241 TGCAGGAAGAGGAGGGCAGGGGG - Intergenic
938536664 2:132253853-132253875 GGAAGGCTGGGGAGAGCAAGCGG + Intronic
939063518 2:137453761-137453783 GGCTGGAAGTGGAGGGAAGGGGG - Intronic
939171495 2:138701413-138701435 GGAAGGAAGAAGAAAGCAAGGGG + Intronic
940048364 2:149434629-149434651 GAAAGGGAGTGGAGGGCAAGAGG + Intronic
940302391 2:152188783-152188805 AGCAGGAATTGGAAGGCAAGAGG - Intergenic
940323327 2:152399909-152399931 GGGAGGAAGTGGAATGAAAGTGG + Intronic
940623911 2:156148969-156148991 GACAGGAAGTGGAGCTCAAGTGG - Intergenic
940948488 2:159645559-159645581 GACAGGAGGTGGAGATCAGGTGG + Intergenic
941788758 2:169527544-169527566 GACAGGAGGTGGAGCTCAAGTGG - Intergenic
942117635 2:172743750-172743772 GGCAGAAAGAAGAGAGGAAGGGG - Intronic
942298245 2:174537722-174537744 TGGGGGAAGGGGAGAGCAAGTGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942803207 2:179899562-179899584 GGCAGGAAGTGGTGAACGAGTGG + Intergenic
943096600 2:183436582-183436604 GACAGGGAGTGGAGAGGAAAGGG + Intergenic
943818857 2:192292654-192292676 GACAGGAGGTGGAGTGCAGGAGG + Intergenic
944228258 2:197369733-197369755 GGCAGGAAGAGAGGAGGAAGGGG - Intergenic
944228995 2:197374785-197374807 GCCAGGAAGTGAAAAGCATGTGG - Intergenic
945157053 2:206849966-206849988 GGCAGGAGGTGGAGCTCAGGTGG + Intergenic
945938835 2:215928183-215928205 GTTAGGAAGTGGAGAGCTGGAGG + Intergenic
946172559 2:217904169-217904191 GGCAGGAAGGAGAGGGGAAGGGG - Intronic
946288249 2:218721911-218721933 GGCAGGAATTCGAGACCAACTGG + Intronic
946706289 2:222461744-222461766 GACAGGAGGTGGAGCACAAGTGG + Intronic
947440060 2:230112204-230112226 GTCAGGGAGTGGAGGGTAAGGGG - Intergenic
947471724 2:230406968-230406990 GGCAGGGAGTGGGGAGGCAGTGG + Intergenic
947724005 2:232386458-232386480 GGCAGGCAGTGGGGAGCGGGTGG - Intergenic
947747599 2:232517000-232517022 GGGAGGAAGAGGAGAACTAGGGG + Intergenic
948045484 2:234940549-234940571 GGCAGAGAGTGGAGGGCAGGTGG - Intergenic
948104375 2:235401213-235401235 AGCAGGATGAAGAGAGCAAGGGG - Intergenic
948118256 2:235509906-235509928 GACAGGAAGTGGAGCTCAGGGGG - Intronic
948266358 2:236637925-236637947 GGAAGGAGGTGGAGAGGAAGAGG - Intergenic
948325880 2:237120407-237120429 GGCAGTAAGTAGAGGGAAAGGGG - Intergenic
948561586 2:238857184-238857206 GAGAGGAAGAGGGGAGCAAGAGG + Intronic
1169007031 20:2216117-2216139 GGGAGGAAAGGGACAGCAAGAGG + Intergenic
1169044363 20:2524433-2524455 GGTAAGAAGTGGAGACCTAGTGG - Intronic
1169254542 20:4086770-4086792 GGAAGGAAGTGCAGAGAGAGGGG - Intergenic
1169342279 20:4805574-4805596 GGCAGCAAGAGGAAAACAAGGGG + Intronic
1170549564 20:17465298-17465320 TACAGGAAGCAGAGAGCAAGAGG - Intronic
1170635373 20:18099714-18099736 GGCAGGAAGTGGAGAAGCTGCGG - Intergenic
1170744033 20:19082158-19082180 GGCAGGAGGTGGAGCTCAGGTGG - Intergenic
1170956387 20:20983853-20983875 GGCAGGAAGCAGAGTGCATGGGG + Intergenic
1171032564 20:21690832-21690854 GACAGGCAGTGGATAGCAGGAGG + Intergenic
1171123872 20:22585572-22585594 GGCAGGAGGTGGGGAGGGAGGGG + Intergenic
1172030064 20:31975384-31975406 TGCAGGCAATGGAGAGCAAGGGG - Intronic
1172107443 20:32525109-32525131 GCCAGGAAGTGCAGAGCAAAGGG + Intronic
1172391221 20:34566713-34566735 GGTAGGAAGTGAAGAGTTAGGGG + Intronic
1172392842 20:34577630-34577652 TGCTGGAAGTGGAGAGGCAGAGG + Intronic
1172619357 20:36308986-36309008 GGGAGGGGGTGGGGAGCAAGAGG - Intronic
1172804933 20:37604941-37604963 GACAGGAAGTGGAGCTCAGGTGG - Intergenic
1172841304 20:37904064-37904086 GGCTGGGTGTGGAGAGGAAGAGG - Intronic
1172878026 20:38177914-38177936 GATTGGAAGTGGGGAGCAAGGGG - Intergenic
1173580732 20:44144829-44144851 GGCAGGCAGTGGTGAGAAGGGGG + Intronic
1173725925 20:45297838-45297860 GGCAGGGAGTGAATAGGAAGGGG + Intronic
1173838030 20:46138528-46138550 GGCAGCAGGGGGACAGCAAGGGG + Intergenic
1173881799 20:46419698-46419720 GCCAGGAAAAGGAAAGCAAGTGG + Intronic
1173913041 20:46684476-46684498 AGCAGGAAGTGCCGAACAAGAGG + Exonic
1174110807 20:48196617-48196639 GACAGGAGGTGGAGATCAGGTGG + Intergenic
1175118507 20:56700978-56701000 GGAAGAAAGTGGAGAGGAAGGGG - Intergenic
1175226070 20:57444682-57444704 GGCAGGAAGGAGGGAGAAAGAGG + Intergenic
1175597122 20:60244170-60244192 GGCAGAAAGAAGAGAGCATGTGG + Intergenic
1176214535 20:63941888-63941910 GGCAGGAAGAGGAAAGCGACAGG + Intronic
1176409371 21:6439674-6439696 GGATGAAAGTGGAGAACAAGGGG + Intergenic
1176731011 21:10497078-10497100 GGCTGGAAGTGAAGTGCAAATGG + Intergenic
1176973852 21:15296025-15296047 GACAGGAAGTGGAGCTCAGGTGG + Intergenic
1177188289 21:17821565-17821587 GTTGGGGAGTGGAGAGCAAGGGG - Intergenic
1177354734 21:19994231-19994253 AGCTGGAACTGGAGAGTAAGAGG + Intergenic
1177776123 21:25568330-25568352 GGTAGGGAGGGGAGAGCTAGTGG - Intergenic
1177916931 21:27100626-27100648 GGCAGGAAGTGGTCAGCCAATGG + Intergenic
1178926675 21:36781046-36781068 GACAGGAAGTGGAGCTCAGGTGG - Intronic
1179054961 21:37922863-37922885 GTCAGGGGGTGGGGAGCAAGGGG - Intergenic
1179254474 21:39703335-39703357 GGCAGGAGGAAGAGAGCAAATGG - Intergenic
1179684864 21:43047996-43048018 GGATGAAAGTGGAGAACAAGGGG + Intergenic
1180074962 21:45457551-45457573 GGCAGGAAGAGGAGGGAAAGGGG + Intronic
1180130266 21:45822571-45822593 GACAGGATTAGGAGAGCAAGGGG + Intronic
1181530226 22:23513117-23513139 GGCAAGGAAGGGAGAGCAAGTGG - Intergenic
1181839206 22:25641306-25641328 GGAAGGAAGAGGACAGAAAGAGG - Intronic
1182072442 22:27473310-27473332 GGGAGGAAGGGGAGAGGAAGAGG - Intergenic
1182122208 22:27795441-27795463 GGCAGGATGTGGGGAGGATGAGG + Intronic
1182712670 22:32332402-32332424 GGGAGGAAGTGGGAAGTAAGTGG - Intergenic
1182747393 22:32616195-32616217 GGCAGGAGGTGGGGGGCAGGAGG + Intronic
1182884718 22:33763561-33763583 AGCAGGAAGTGCAGAAAAAGAGG + Intronic
1183139568 22:35923869-35923891 GGAAGCAAGTGGGAAGCAAGTGG + Intronic
1183225478 22:36546972-36546994 GGCAGGGAGAGGAGAGGCAGGGG + Intergenic
1183279693 22:36925285-36925307 GACAGGAAGTGGCGTGCAACAGG - Intronic
1183404461 22:37623667-37623689 GGCAGGAGGTGGAGGGAGAGGGG - Intronic
1183616643 22:38949971-38949993 GGCAATAAGAGGAGAGCCAGCGG + Intergenic
1183782450 22:40007492-40007514 GACAGGAGGAGGAGAGGAAGAGG - Intronic
1184116297 22:42424595-42424617 GGAAGGAAGAGAAGAGCAGGAGG + Intronic
1184594430 22:45505189-45505211 GGGAGGGAGTGGAGAGGAGGAGG + Intronic
1184753407 22:46502304-46502326 GGGAGGAAGAGGGGAGGAAGAGG + Intronic
1184961134 22:47929495-47929517 GGCAGGAGGTGGAGAGGTTGTGG + Intergenic
1185036297 22:48478928-48478950 GGCCAGAACTGGACAGCAAGAGG + Intergenic
1185060463 22:48603816-48603838 AGCAGCAAGTGGAGATCCAGTGG + Intronic
1185110216 22:48896432-48896454 GGCAGGGGGTGGAGGGCATGTGG + Intergenic
949925181 3:9035518-9035540 GGCACAAAGTGGGGAGCAGGGGG + Intronic
950125262 3:10506485-10506507 GGCAGGAAGAGGTGAGCAGCTGG - Intronic
950138608 3:10600363-10600385 GCCAGAAAATGGTGAGCAAGGGG - Intronic
950364443 3:12473148-12473170 GGCTGGAAGAGGAGAAGAAGTGG - Intergenic
950396378 3:12737237-12737259 AGGAGGAAGGGGAGGGCAAGAGG - Intronic
950624949 3:14238488-14238510 GACAGGAGGTGGAGATCAGGTGG + Intergenic
950744467 3:15075621-15075643 AGGAGGAAATGGAGAGGAAGAGG - Exonic
951450505 3:22832252-22832274 GTCAGGAGGTGGGGAGCTAGGGG + Intergenic
951917366 3:27816121-27816143 GTCAGGGAGTGGAGGGCTAGGGG - Intergenic
952884754 3:38005714-38005736 GACAGGGAGTGGACAGGAAGGGG + Intronic
952961030 3:38589175-38589197 GGCTGGAACAGGAGAGCAACAGG - Intronic
953205603 3:40825293-40825315 GGCAGAGAGTGGAGAGAAAATGG - Intergenic
953423670 3:42774409-42774431 GGCAGCAATTGGAGACCAACGGG - Intronic
953679478 3:45028805-45028827 GCCAAGAGGGGGAGAGCAAGTGG + Intronic
954140882 3:48604727-48604749 AGAAGGAGGTGGAGAGCATGGGG - Exonic
954160568 3:48718701-48718723 GGCAGCAAGAGGAGACCAGGAGG - Intronic
954264044 3:49459711-49459733 GGAAGGAAGAGGAGAGCACTTGG - Intergenic
954439430 3:50513578-50513600 GGTAGGAAGTGGGGATGAAGGGG - Intergenic
954993531 3:54861412-54861434 GGCAGGGAGTGGCGAGAAAGAGG + Intronic
955123221 3:56082812-56082834 GGCAGGAGGTGGAGCTCAAGTGG - Intronic
955611487 3:60762173-60762195 GGCAAGAAGTGGAGAATAACTGG - Intronic
955905472 3:63803391-63803413 GGCAAAAGGAGGAGAGCAAGAGG - Intergenic
956034415 3:65074992-65075014 GTCAGGAGGTGGGGAGCTAGGGG - Intergenic
956318077 3:67961825-67961847 GTCAGGGGGTGGAGAGCAAGGGG + Intergenic
956515146 3:70038376-70038398 GGCAGAAAGTGGAAAGGGAGGGG - Intergenic
956701230 3:71960667-71960689 GGGAAGAAGGGGAGAGGAAGAGG + Intergenic
957280312 3:78143194-78143216 GTCAGGAAGTGGAGAGAACTGGG - Intergenic
957771417 3:84696968-84696990 GGCTGGAAATGCTGAGCAAGTGG - Intergenic
958108885 3:89114085-89114107 GGAAGGAGGAGGAAAGCAAGTGG + Intronic
958560636 3:95744007-95744029 AGCAGGAAGAAGAGAGCAAATGG + Intergenic
958917448 3:100065372-100065394 GTAAGGAAGTGGAGAGTCAGAGG + Intronic
959337464 3:105084005-105084027 GGCAACAGGTGGAGAGCAAGAGG + Intergenic
959506478 3:107162251-107162273 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
959632408 3:108522141-108522163 GGCAGGTGGTGGGGAGCAATAGG + Intronic
960284715 3:115814967-115814989 GGCAGAAAATGGACAGCAGGTGG - Intronic
961029548 3:123589895-123589917 GGCAGGAGGTGGAGATCAGGTGG + Intergenic
961393343 3:126569634-126569656 GGCTGGAAGAGGAGAGGAACTGG + Intergenic
961685170 3:128625015-128625037 GGAAGGAAGAAAAGAGCAAGAGG + Intronic
961826900 3:129603889-129603911 GGCAGGCAGTGGAGCTGAAGTGG + Intronic
962916774 3:139911631-139911653 GTCAGGGAGTGGGGAGTAAGGGG - Intergenic
962947748 3:140187301-140187323 GGCAGGCAGTGGTCACCAAGAGG - Intronic
964267801 3:154920388-154920410 AGCAGGAGGAAGAGAGCAAGGGG + Intergenic
964299103 3:155268174-155268196 GTCTAGAAGTGGAGAGCAAATGG - Intergenic
964501012 3:157348103-157348125 GGCTGGAAGTGCAGAGCATGAGG - Intronic
964698937 3:159541593-159541615 GGCAGGCAGTGGGGAGGAAGAGG + Intronic
964905377 3:161713029-161713051 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
965289774 3:166864799-166864821 GGAAGGAAGTGGGAAGGAAGTGG + Intergenic
965400607 3:168208355-168208377 GGCAGGAAGTGGGAAGGAATGGG + Intergenic
965422338 3:168476928-168476950 GTCAGCAAGAGGAGAGCACGTGG + Intergenic
965800659 3:172490615-172490637 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
965979311 3:174667795-174667817 AGTAGGAAGTGGAGAACAGGAGG + Intronic
966023633 3:175247595-175247617 GGGAGAAAGTGGAGAGTAATAGG + Intronic
966214553 3:177489113-177489135 AGCAGGAAGTGGAGATCATTGGG + Intergenic
966374835 3:179285782-179285804 TGCGGGGAGTGGAGGGCAAGTGG - Intergenic
967165177 3:186773619-186773641 GGAAGGAAGAAGAGAGCAACGGG + Intergenic
967586789 3:191222892-191222914 AGCAAGAAGTGCAGAGCAAAAGG - Intronic
968199252 3:196738554-196738576 GGAAGGCAGTGGAAAGAAAGAGG - Intergenic
968523245 4:1043943-1043965 GGCAGGAACGGCAGAGCAGGGGG + Intergenic
968528007 4:1074313-1074335 AGCAGTGAGTGGAGAGCCAGAGG - Intronic
968789762 4:2651488-2651510 GGCAGGAGAGAGAGAGCAAGAGG + Intronic
968887789 4:3344572-3344594 GGCAGGTTGTGCAGAGCACGTGG - Intronic
968902002 4:3436302-3436324 GGCAGGAAGGGGGGAGCGAGGGG - Intronic
969131942 4:4996538-4996560 GTCAGTGGGTGGAGAGCAAGGGG - Intergenic
969213179 4:5703572-5703594 GGCAGGAAGTGGTGAGGCAGTGG - Intronic
969319521 4:6403352-6403374 GGCAGGAAGCGAGGAGGAAGAGG - Intronic
969579131 4:8053834-8053856 GGCAGGACGGGGAGAGAAGGCGG - Intronic
969938311 4:10705217-10705239 TGCAGTAAGTGGAGAGAAAGAGG + Intergenic
970496878 4:16635137-16635159 GTCAGGGGGTGGGGAGCAAGGGG + Intronic
970782803 4:19759044-19759066 GGCAGGATAGGGAGAGCCAGTGG - Intergenic
971086934 4:23289367-23289389 GGGATGATGTGGTGAGCAAGTGG - Intergenic
971221070 4:24706447-24706469 AGGAGGAAGTGGAGGGGAAGAGG - Intergenic
971636175 4:29061523-29061545 AGCAGAAAGTGGAAAGCAGGTGG + Intergenic
971700028 4:29960596-29960618 GGCAGAAATTGGAAAGCATGAGG - Intergenic
971884523 4:32426086-32426108 GGCAGGAAAGAGAGAGCAATGGG - Intergenic
972091712 4:35294780-35294802 GGCAGAAAGTGAAGAGCGGGAGG - Intergenic
972230922 4:37072003-37072025 AGAAGGAAGCGGAAAGCAAGGGG - Intergenic
972919394 4:43919649-43919671 GTCAGGGAGTGGGGGGCAAGAGG - Intergenic
973714668 4:53663930-53663952 GTCAGGAGGTGGGGAGCTAGGGG - Intronic
974129568 4:57737014-57737036 TCCACAAAGTGGAGAGCAAGAGG + Intergenic
974488750 4:62536592-62536614 GGAAAGAAGAGGAGAGTAAGTGG - Intergenic
974706789 4:65528748-65528770 GGCCTGAAGCGGACAGCAAGAGG + Intronic
974864225 4:67560971-67560993 GTCAGGGAGAAGAGAGCAAGAGG + Intronic
974936378 4:68413630-68413652 AAAAGGAAGTGGAGAGGAAGGGG + Intergenic
975098875 4:70489423-70489445 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
975362298 4:73485312-73485334 GGCAGCAAGGGAAGAGTAAGAGG + Intronic
976330797 4:83829028-83829050 TCCAGGAGGTGGAGACCAAGGGG + Intergenic
976603627 4:86962077-86962099 GCCAGGGAGTTGAGAGCAAAGGG + Intronic
977122500 4:93120591-93120613 GTCAGGGAGTGAGGAGCAAGGGG + Intronic
977299181 4:95248469-95248491 GACAGGAAGTTGAGACCACGGGG - Intronic
977354424 4:95927087-95927109 GTCAGGCTGTGGGGAGCAAGGGG - Intergenic
977768574 4:100830051-100830073 GGCAAGGATTGAAGAGCAAGTGG - Intronic
978692572 4:111532928-111532950 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
978874218 4:113619412-113619434 GACAGTAAGTGGAGAGCCATTGG - Intronic
979352063 4:119655702-119655724 GGCAGGAAAGGCAGAGCATGTGG - Intergenic
979531553 4:121774004-121774026 AGCAGAAAGTGTAGGGCAAGAGG - Intergenic
979542262 4:121898349-121898371 GACAGGAGGTGGAGCTCAAGCGG - Intronic
982047927 4:151467825-151467847 GTCAGGGGGTGGAGGGCAAGGGG + Intronic
983578783 4:169286992-169287014 GGCAGGAGGTGGAGCTCAGGAGG + Intergenic
983851419 4:172585401-172585423 GTCAGGAGGTGGAGGGCAAGGGG - Intronic
983938438 4:173518849-173518871 GGCGGGAAGCGGGGAGCAGGGGG - Intergenic
984214127 4:176887282-176887304 GGGAGGAAGGGGAAAGAAAGAGG - Intergenic
985477474 5:86338-86360 AGCAGGGAGGGGAGAGCGAGGGG - Intergenic
985532657 5:443163-443185 GGCCGGAAGTGGACAGCGCGCGG - Exonic
985538673 5:477954-477976 GGCAGGGCCTGGAGAGCATGAGG + Intronic
985564312 5:607702-607724 AGAAGGATGTGGAGAGCAGGTGG + Intergenic
985714551 5:1448099-1448121 GGCAGGAAGTGCAGAGGCAGGGG - Intergenic
985747648 5:1656144-1656166 GGATGGAAGTGGAGAGAAACTGG + Intergenic
985778119 5:1855819-1855841 GGCTGTAAGTGCAGGGCAAGCGG - Intergenic
985793272 5:1943976-1943998 TGCAGGAAGAGGACAGCACGAGG - Intergenic
985821552 5:2164056-2164078 GGCAGGAAGCAGAGGGCCAGAGG - Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
986118873 5:4811526-4811548 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
986362400 5:6993118-6993140 GGGAGGAGGAGGAGGGCAAGGGG - Intergenic
986524622 5:8660346-8660368 AGCAAAAAGTGGAGAGAAAGTGG - Intergenic
986837613 5:11657454-11657476 GGCAGGAAGGAGAGAGAAACAGG - Intronic
987106669 5:14646430-14646452 GGCAGGGAGAGGAGAGGAACTGG - Intergenic
987317370 5:16736214-16736236 GGTGAGAAGTGGAGAACAAGCGG + Intronic
988066217 5:26230613-26230635 GGAAGGAAGGGGAGAGAAATGGG - Intergenic
988454124 5:31372529-31372551 GGCAGGCTTTGGAGAGCTAGAGG - Intergenic
988599649 5:32627709-32627731 GGCAAGGAGAGGAGAGAAAGGGG + Intergenic
988942781 5:36162899-36162921 GGCATCAAGTGCAGAGCAAAGGG + Intronic
989142953 5:38220235-38220257 GGGAGGAGGTGGTGAGAAAGAGG + Intergenic
989745830 5:44828329-44828351 GGCAGGAAGTGGATAGCATTGGG + Intergenic
991240064 5:64448060-64448082 GCCAGGAATTTGAGAGCAAATGG + Intergenic
991248817 5:64536289-64536311 GTGAGGAAGTGGAGAGCATATGG + Intronic
991665580 5:68996386-68996408 GACAGGAAATGGAGCTCAAGTGG - Intergenic
991997207 5:72400062-72400084 GAAAGGAAGGAGAGAGCAAGGGG - Intergenic
995763999 5:115596093-115596115 TGCAGGAATAGGAGAGTAAGAGG - Intronic
996175355 5:120349693-120349715 AGCAAGAAGTTGGGAGCAAGTGG - Intergenic
996277333 5:121682809-121682831 GGCAGGAGGTGGTGAGGTAGTGG + Intergenic
996314452 5:122146121-122146143 TGCAAGAAGTGGGGAGCAAGAGG - Intronic
996829305 5:127721832-127721854 GGCAGGAGGAAGAGAGAAAGCGG + Intergenic
997061735 5:130513303-130513325 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
997172419 5:131736574-131736596 GACAGGAGGTGGAGTGCAGGCGG - Intronic
997369924 5:133353030-133353052 GGCTGGAAGGGGAGAGAAATGGG - Intronic
997467722 5:134099414-134099436 AGGAGGAAGTGGAAAGGAAGCGG - Intergenic
998390287 5:141783080-141783102 GGCAGGAGGTGGAGGGCATGTGG - Intergenic
998553663 5:143102228-143102250 GGCAGGAAGTGAAGAGAAGAGGG - Intronic
999050967 5:148523537-148523559 GGTAAAAAGAGGAGAGCAAGTGG + Intronic
999081843 5:148851711-148851733 GGAAGGGAGCCGAGAGCAAGTGG + Intergenic
999105271 5:149064927-149064949 GGCAGGGAGTAGAGCGCAGGAGG + Intergenic
999222750 5:149994986-149995008 AGCAGGAAGTGAAGATGAAGGGG - Exonic
1000270360 5:159678186-159678208 AGCAGGAGGAAGAGAGCAAGTGG + Intergenic
1000334357 5:160231093-160231115 GGCAAGAAGTGGCCACCAAGAGG - Intronic
1000376382 5:160586123-160586145 GTCAGGAGGTGGGGAACAAGCGG - Intronic
1000533085 5:162447958-162447980 GGAGGGAAGAGGAGAGCATGGGG - Intergenic
1000668852 5:164034610-164034632 AGCAGGAACAAGAGAGCAAGGGG + Intergenic
1001266153 5:170276005-170276027 GGGAGGAAGTGAAGAGCAGAGGG - Intronic
1001530239 5:172456087-172456109 GGCAGGAGATTGAGGGCAAGAGG + Intergenic
1001678997 5:173542672-173542694 GGCAGGGAGTGTAGAGGAAGTGG + Intergenic
1002189297 5:177470440-177470462 GGCCGGAGGTGGGGAGCCAGGGG - Intronic
1002438899 5:179253778-179253800 GGCAGGAAGTGAGGAGCCTGAGG - Intronic
1002930264 6:1629518-1629540 TGCAGGCAGTGGAGAGGAAGTGG + Intronic
1003069941 6:2938132-2938154 GGCTGGAAGTTGAGAGGAATGGG - Intergenic
1003768919 6:9274947-9274969 GGCATGAAGTGGAAAGAAATGGG - Intergenic
1003958540 6:11188760-11188782 GGAAGGAAGTGGAGAGAGAGAGG - Intronic
1003961200 6:11210960-11210982 GCCAGGATGGGGAGGGCAAGAGG - Intronic
1004133251 6:12941559-12941581 GGCAGGAAGTGGCGAGTGAGAGG - Intronic
1004171661 6:13300049-13300071 TGCAGGGAGTGGTGAGCAAGGGG - Intronic
1004234776 6:13864839-13864861 GTCAGGGGGTGGAGGGCAAGGGG - Intergenic
1004286597 6:14326922-14326944 AGAAGGAAGAGGTGAGCAAGAGG + Intergenic
1004497352 6:16176976-16176998 GTCAGGCAGTGGGGGGCAAGAGG + Intergenic
1004829488 6:19462151-19462173 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1004976372 6:20971841-20971863 GCCTGGAATTAGAGAGCAAGTGG - Intronic
1005040727 6:21596933-21596955 GGCAGTCAGTGGAGGGCGAGTGG + Exonic
1005267948 6:24132839-24132861 GTCAGGGGGTGGGGAGCAAGGGG - Intronic
1005302930 6:24488855-24488877 GGCAGGAGTTGGAGAGCAGAAGG - Intronic
1005709311 6:28488332-28488354 GGCAGGAATTGGAGACCAGCCGG + Intergenic
1006359193 6:33578031-33578053 GGCATGAACTTGAGAGCCAGCGG - Intronic
1006418961 6:33921639-33921661 GGCAGGTTGGGGAGAGGAAGAGG + Intergenic
1006440368 6:34050048-34050070 GGCAGGTAGTGCAGATCATGTGG - Intronic
1006624584 6:35388363-35388385 GGCAGGAAGGGGAGAGCTTCCGG + Intronic
1006946611 6:37788594-37788616 GGCAGGGAGTGCTGAGCAGGTGG - Intergenic
1007419388 6:41710631-41710653 GGTAGGTAGTGGAGAGCAATTGG - Intronic
1007465518 6:42048723-42048745 GGCAGGAAGTGGGGAAGAGGGGG + Intronic
1007571135 6:42891615-42891637 GGCAGGAAGTGTGAAGAAAGTGG - Intergenic
1007603190 6:43096645-43096667 GGCAGGAAGTGCAGAGCACAAGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008207915 6:48685926-48685948 GTCAGGGGGTGGAGGGCAAGGGG + Intergenic
1008450160 6:51641891-51641913 GTCAGGGAGTGGGGAGCAAGGGG + Intronic
1008817359 6:55584414-55584436 GGGAGTAAGTGTAGAGCATGTGG - Intergenic
1008967513 6:57328031-57328053 GACAGGAAGTGGAGTTCAGGTGG + Intronic
1009584878 6:65587474-65587496 GGCAGGAAGGAGAGAGCTAAGGG - Intronic
1010024418 6:71199146-71199168 GACAGAAAGTAGAGAGAAAGTGG + Intergenic
1010593725 6:77739567-77739589 GTCAGGGGGTGGGGAGCAAGGGG + Intronic
1010773473 6:79859110-79859132 GGGAGGAGGTTGAGATCAAGAGG - Intergenic
1010858589 6:80876142-80876164 GTCAGGTAGTGGGGAGCAAGGGG - Intergenic
1011089309 6:83577868-83577890 TGAGGGAAGTGGAGAGGAAGAGG - Intronic
1011147294 6:84232816-84232838 CCCAGGGAGTGGAAAGCAAGAGG - Intergenic
1011739756 6:90348004-90348026 GGAAGGATTTGGAGAGAAAGAGG + Intergenic
1011889201 6:92135674-92135696 AGCAAGAAGTGCAGAGCAAAGGG - Intergenic
1013427898 6:110031562-110031584 GGCACAAAGGGAAGAGCAAGGGG + Intergenic
1013660564 6:112292135-112292157 GGCAGGAATTGTAGAGAAAATGG - Intergenic
1014043093 6:116851706-116851728 AGCAGGAAAGAGAGAGCAAGTGG - Intergenic
1014344685 6:120253194-120253216 GTCAGGAAGTGGAGGGCAGGGGG + Intergenic
1015112459 6:129609060-129609082 GGAAGGAAGAGGAGAGAGAGGGG + Intronic
1015270948 6:131338484-131338506 GGCAGGAAGTGTTGAGCAATGGG + Intergenic
1015812813 6:137178110-137178132 AGCAGGAAGTGGAAAGAAATGGG - Intergenic
1015894006 6:137998889-137998911 GGAATGAAGAGGAGAGGAAGGGG - Intergenic
1016312056 6:142744731-142744753 GCCAGGAAAGGGATAGCAAGAGG - Intergenic
1016998000 6:149974571-149974593 GGCAGGAAGTGGAGCTGCAGTGG + Intergenic
1017000273 6:149991649-149991671 GGCAGGAAGTGGAGCTGCAGTGG - Intergenic
1017010500 6:150060148-150060170 GGCAGGAAGTGGAGCTGCAGTGG - Intergenic
1017297770 6:152818434-152818456 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1017426628 6:154328668-154328690 GGCAGAGAGAGGAGAGAAAGAGG - Intronic
1017710969 6:157167563-157167585 CGCTGGAAGGGCAGAGCAAGGGG + Intronic
1017752025 6:157496911-157496933 GAGAGGAAGAGGAGAGCAAGAGG - Intronic
1017788091 6:157772876-157772898 GGCTGGAAATGGAGATCATGGGG + Intronic
1017978695 6:159379722-159379744 TGCAGGATGGGGAGAGCAATGGG + Intergenic
1018394842 6:163370224-163370246 GGAAGGAAGAGGAAAGAAAGAGG - Intergenic
1018515402 6:164574183-164574205 GACAGGAGGTGGAGATCAGGTGG + Intergenic
1018910244 6:168097514-168097536 GGCACCCAGTGGAGAGCATGGGG + Intergenic
1018928383 6:168222769-168222791 GGCAGGAAGGGGTGGGAAAGGGG + Intergenic
1019048326 6:169164658-169164680 GACAGGAGGTGGAGCTCAAGGGG + Intergenic
1019322855 7:423490-423512 GGCTGGAAGTGGACACCAGGCGG - Intergenic
1019506670 7:1394924-1394946 CCCAGGAAGTGGAGATCATGGGG + Intergenic
1019716088 7:2539998-2540020 GACAGGAAGTGGAGAGAGAAGGG + Intronic
1020011443 7:4807839-4807861 GGCAGGGAGGGGAGAGAGAGAGG - Intronic
1020458857 7:8405519-8405541 GTCGGGGAGTGGGGAGCAAGGGG - Intergenic
1020469041 7:8514782-8514804 GGCAGGAAGTGGAGTGGAGATGG - Intronic
1020706498 7:11550547-11550569 GGCAGGAAAGAGAGAGCAAAGGG - Intronic
1020716584 7:11681197-11681219 GTCAGGGGGTGGGGAGCAAGTGG + Intronic
1020740688 7:12012818-12012840 GACAGAAAATGGAGAACAAGTGG - Intergenic
1020873348 7:13662435-13662457 GGCAGAAAGTGGAGCAGAAGCGG + Intergenic
1021091338 7:16486554-16486576 GTCAGGCAGTGGGGGGCAAGGGG + Intronic
1021564549 7:22004105-22004127 GGCAGGGCCTGGAGAGCCAGTGG + Intergenic
1021616144 7:22505071-22505093 GGCAGGAAAAGGAGAGGGAGAGG + Intronic
1021778122 7:24073699-24073721 GGAGGGAAGAGGAGAGGAAGGGG + Intergenic
1022473513 7:30695586-30695608 GGCAGGAACTGGCCAGCAGGAGG + Intronic
1022895280 7:34744443-34744465 GGCAGGAAGAGCAGAGGAAATGG + Intronic
1022925935 7:35056287-35056309 GGCAGGAAAAGGAGAGGGAGAGG + Intergenic
1023509657 7:40938035-40938057 GACAGGAGGTGGAGTGCATGTGG + Intergenic
1023762467 7:43479365-43479387 GACAGGAGGTGGAGCTCAAGTGG + Intronic
1023862177 7:44223429-44223451 AGCAGGAACTGGAGGGGAAGGGG - Intronic
1023903709 7:44505654-44505676 GGAAGGAAGGGGAGAGGAAAAGG + Intergenic
1024373119 7:48608666-48608688 GGCAGGAAGGGCAGACCATGAGG - Intronic
1024655224 7:51446471-51446493 GGCAGGAAGGGGAGAGCGGCGGG - Intergenic
1024746613 7:52414100-52414122 GGAAGGAAGGAGAGAGGAAGGGG + Intergenic
1025077273 7:55953880-55953902 GACAGGAGGTGGAGCGCAGGCGG + Intronic
1025091404 7:56067097-56067119 TTCAGTAAGTGGAGAGGAAGAGG + Intronic
1025284732 7:57652212-57652234 GACAGGAAGTGCAGAGGAAATGG + Intergenic
1026019517 7:66696755-66696777 GGCAGGCATGGGAGAGCAAAAGG + Intronic
1026837878 7:73650122-73650144 GGCAGGAGGTAGAGCGCAGGGGG + Intergenic
1028067573 7:86406418-86406440 GACAGGAAGTGGAGCTCAGGTGG - Intergenic
1028311910 7:89349171-89349193 GGAAGGAAGTGGGGAGCAAGAGG + Intergenic
1028376327 7:90149264-90149286 GGCAGGAAAAGGAGAGGGAGAGG - Intergenic
1028486377 7:91362400-91362422 GGCAGGGAGTGGGGAGGGAGAGG + Intergenic
1029254310 7:99258999-99259021 GGCAGGAGAAAGAGAGCAAGGGG + Intergenic
1029353469 7:100032438-100032460 GGCAAAGAGTGGAGAGTAAGGGG - Intronic
1029382294 7:100221897-100221919 GGCAGGGTGTGGAGAGTAGGGGG + Intronic
1029818583 7:103122920-103122942 GTCAGGCAGTAGAGAGCCAGTGG - Intronic
1029823941 7:103170977-103170999 GGCAGGAAAAGGAGAGGGAGAGG + Intergenic
1031432503 7:121689497-121689519 GGCAGGAGACAGAGAGCAAGAGG - Intergenic
1031441393 7:121799097-121799119 GGAAGGATGAGGAGAGAAAGAGG - Intergenic
1031900227 7:127401255-127401277 GTCAGGGAGTGGAGGGCAAGGGG - Intronic
1032366619 7:131306081-131306103 GGCAGGAGGGAGAGAGCAAGGGG - Intronic
1032646843 7:133834336-133834358 AAAAGGAAGTGGAGAGGAAGGGG - Intronic
1032704817 7:134412673-134412695 GGCAGGAAGGAGAGAGGAAGAGG + Intergenic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1033437527 7:141347017-141347039 GGCAGGAGAGAGAGAGCAAGGGG - Intronic
1034008004 7:147495911-147495933 GACAGGAAGTGGAGCTCAGGTGG - Intronic
1034039029 7:147856990-147857012 GGCAGGAAAGGGAGAGACAGAGG + Intronic
1034435121 7:151059740-151059762 GGCACGAAGTCCAGAGCGAGCGG + Intronic
1034606821 7:152323799-152323821 GGCAGGGAGGGGAGGGGAAGGGG + Intronic
1034847391 7:154458996-154459018 GGAAGGAAGAGGAGAGGAAGAGG + Intronic
1035044500 7:155954785-155954807 GTCAGGAGGTGGAGGGCAGGAGG - Intergenic
1035280673 7:157776265-157776287 GGGAGGAGGTGAAGAGGAAGAGG - Intronic
1035789519 8:2290910-2290932 GGCAGGAGGTGGGGAGAACGGGG + Intergenic
1035803286 8:2430795-2430817 GGCAGGAGGTGGGGAGAACGGGG - Intergenic
1035822632 8:2610726-2610748 ACCAGGAGGTAGAGAGCAAGTGG - Intergenic
1036553035 8:9831938-9831960 GGCAGGAGGTGGAGAACAAAGGG + Intergenic
1037033927 8:14142833-14142855 GGCAGGAGGAAGAGAGCAAGGGG - Intronic
1037378376 8:18257796-18257818 GGCAGAACATGGAGGGCAAGTGG + Intergenic
1037522203 8:19691217-19691239 GGCAGCAGGTGGTGAGCAAAGGG + Intronic
1037689900 8:21172804-21172826 GGCAGGAAGAGAAGGCCAAGGGG + Intergenic
1037721707 8:21449939-21449961 AGCAGGACGTGGTGACCAAGGGG - Intergenic
1037901725 8:22692736-22692758 GGAAGGAAGGGGAGAGGAAGAGG - Intronic
1037943513 8:22972537-22972559 GGCAGAAAGTGGTGTGGAAGTGG - Intronic
1038504431 8:28072305-28072327 GGCTGGAGCTGGAGAGGAAGAGG + Intronic
1038586021 8:28790031-28790053 GGCAGACACTGGACAGCAAGGGG + Intronic
1038741791 8:30223112-30223134 GGAAGGAGGTGGGGAGCAGGGGG - Intergenic
1039088436 8:33802729-33802751 GCCAGGAAGTAGAGAGTCAGAGG - Intergenic
1039623764 8:39026249-39026271 GTCGGGAGGTGGGGAGCAAGGGG - Intronic
1040091148 8:43400306-43400328 GGCAGGAGGTAGATAGCAAGGGG + Intergenic
1040099665 8:43487352-43487374 GACAGGAGGTGGAGCTCAAGTGG + Intergenic
1040319440 8:46285292-46285314 GGCAGGCAGAGGTGAGCAGGTGG - Intergenic
1040566057 8:48568604-48568626 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
1040865830 8:52048137-52048159 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1041583428 8:59489295-59489317 GTCGGGAGGTGGAGAGCTAGAGG - Intergenic
1041783637 8:61607010-61607032 GGCAGGAGATGGAAAGCAACTGG - Intronic
1041818907 8:62006439-62006461 GGAAGAAAGAGGGGAGCAAGAGG + Intergenic
1042036127 8:64536133-64536155 GTCAGGGGGTGGAGAGCTAGGGG - Intergenic
1042456875 8:69015431-69015453 GACAGGAGATGGAGAGCATGGGG + Intergenic
1042504176 8:69541959-69541981 GGAAGGAACTGGAGAGGGAGTGG + Intronic
1043282728 8:78488739-78488761 GGCAGAAAGGGAAGAGAAAGTGG - Intergenic
1043425120 8:80140903-80140925 GGCAGGAAGAACAGACCAAGAGG + Intronic
1043532967 8:81171181-81171203 GTCAGGGAGTGGGGGGCAAGGGG + Intergenic
1044201270 8:89440958-89440980 AGCAAGAAGTGCAGAGCAAAAGG - Intergenic
1044835658 8:96293056-96293078 GGCAGGAGGTGGGAAGAAAGGGG - Intronic
1044888953 8:96811899-96811921 TGGAGGAAGTGGAAAGAAAGAGG + Intronic
1044957110 8:97492529-97492551 GGTAGGCAGGGGAGAGGAAGCGG + Intergenic
1045587827 8:103559207-103559229 AGAAGGAAGTGGGGAGGAAGAGG - Intronic
1046082402 8:109387123-109387145 GGGAGGGAGTTGAGAGCAATGGG + Intronic
1046345079 8:112913369-112913391 GACAGGAGGTGGAGCTCAAGTGG + Intronic
1047010027 8:120662561-120662583 AGCAGGCAGTGGAGAGCGAGAGG + Intronic
1047459287 8:125046951-125046973 GACAGGAAGTGGAGCTCAGGTGG + Intronic
1047467425 8:125131049-125131071 TGAAGGAAGTGGAGAACAAAGGG - Intronic
1047889913 8:129296371-129296393 GGCAGGAGAGAGAGAGCAAGGGG + Intergenic
1048117927 8:131545864-131545886 AGGAGGAAGTGGGGAGGAAGAGG + Intergenic
1048541088 8:135342777-135342799 GTCAGGGGGTGGGGAGCAAGGGG - Intergenic
1049122012 8:140747623-140747645 AGGAGGAAGGGGAGAGGAAGGGG + Intronic
1049191217 8:141288811-141288833 GACAGGAAGACGAGGGCAAGGGG + Intronic
1049369064 8:142254889-142254911 GGCAGGCAGGGGAGGGCATGGGG - Intronic
1049400302 8:142423710-142423732 GGCAGAAAGTGGAGGCCAGGAGG - Intergenic
1049968691 9:802215-802237 GGCAAGAAGTGTACAGGAAGGGG - Intergenic
1050231679 9:3532373-3532395 GGGAGGAAGTGGAGAGGGAGAGG - Intergenic
1050377171 9:4985246-4985268 TGCAGGAAGGAGAGAGGAAGAGG + Exonic
1050412783 9:5383752-5383774 GGCAGGAGGTGGAGCTCAGGTGG + Intronic
1051000938 9:12280895-12280917 GGCAGGAGGTGGAGCTCAGGCGG + Intergenic
1052143496 9:25019733-25019755 GTCAGGGAGTGGGGGGCAAGGGG - Intergenic
1056262944 9:84867037-84867059 GGCTGAAAGTGGAGAGAATGGGG + Intronic
1056275766 9:84992624-84992646 GGCAGGGAGTGGAAAGAGAGAGG - Intronic
1056750289 9:89345675-89345697 TGCAGGAGGTGTAGAGCTAGAGG + Intronic
1056812770 9:89777089-89777111 GGCAGGGAGCAGAGAGCCAGGGG + Intergenic
1056954949 9:91074258-91074280 GCCAGGAAGCCCAGAGCAAGAGG - Intergenic
1057259282 9:93575417-93575439 GGGAGGATGGGGAGAGAAAGAGG + Intergenic
1057357976 9:94347374-94347396 GGAAGAAAGTGGGGAGGAAGAGG - Intergenic
1057649774 9:96910243-96910265 GGAAGAAAGTGGGGAGGAAGAGG + Intronic
1058427242 9:104885588-104885610 GAAAGAAAGAGGAGAGCAAGAGG - Intronic
1059310372 9:113384756-113384778 AGCAGGAAGAGAAGAGCAAATGG - Intergenic
1059869614 9:118557430-118557452 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1060271751 9:122148037-122148059 GGCAGGAGGTGGTCAGCAAAGGG - Intronic
1060338110 9:122746017-122746039 GTCGGGGAGTGGAGGGCAAGGGG - Intergenic
1060497176 9:124127273-124127295 GGCAAGAATTGGGGAGCAAGGGG - Intergenic
1060497876 9:124131201-124131223 GGAGGGAAGGGGAGGGCAAGAGG + Intergenic
1060827987 9:126697209-126697231 GGGAGGAAGGGGAGAGGAAGAGG + Exonic
1060987657 9:127828877-127828899 GGTAGGAAGGGGAGAGCCCGGGG - Intronic
1061144771 9:128791199-128791221 GGGAGGCAGTGGGGAGGAAGGGG + Intronic
1061407916 9:130402938-130402960 GGGAGCAGGTGGAGAGCCAGAGG + Intronic
1061807066 9:133142551-133142573 GTGAGGAAGTGGAGAGGAAAGGG - Intronic
1061832235 9:133303533-133303555 GGCTGGAAATGGTGAGTAAGGGG - Intergenic
1062050534 9:134444477-134444499 GGAAGGAAGGAGAGAGGAAGAGG - Intergenic
1062127494 9:134871443-134871465 GGCAGGAAGTGGAGAGGAGCGGG + Intergenic
1062236885 9:135514634-135514656 GGCTGGAAATGGTGAGTAAGGGG - Intergenic
1062603821 9:137333644-137333666 GGCAGGAGCGAGAGAGCAAGAGG - Intronic
1186749817 X:12609838-12609860 GGCAGGCAGTGAAAAGCCAGTGG + Exonic
1187009628 X:15266416-15266438 GGCAGGAAATTGAGAGCCATTGG - Intronic
1187277230 X:17826801-17826823 GGCAGGAAAGAGAGAGCATGAGG - Intronic
1188753649 X:33934609-33934631 GGAAGGAATTGGAGAACAATAGG - Intergenic
1189249042 X:39585838-39585860 GGCAGGAGGAGGAGTGGAAGGGG + Intergenic
1189249044 X:39585859-39585881 GGCAGGCAGTGTTGAGCAAAAGG + Intergenic
1189469256 X:41301394-41301416 AGCAGGAAGTGGGCAGGAAGTGG + Intergenic
1189880198 X:45483075-45483097 GACAGGAAGTGGAGCTCAGGTGG + Intergenic
1190920806 X:54850673-54850695 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1190965233 X:55293733-55293755 GTCAGGAGGTGGGGGGCAAGGGG - Intergenic
1191899103 X:66022759-66022781 GGCAGGAAATGTGGAGGAAGGGG - Intronic
1192038894 X:67596082-67596104 AGCAGGAACAAGAGAGCAAGGGG - Intronic
1192343151 X:70280611-70280633 GGCAAGAAGAGGAGGACAAGGGG + Intronic
1192538280 X:71947167-71947189 GGCAGGGAGGGTAGAGGAAGGGG - Intergenic
1192618105 X:72648977-72648999 GGCAGGATTTGGAGAGGAAGAGG + Intronic
1192976648 X:76293356-76293378 AACAGGTAGTGGAGAGCATGTGG + Intergenic
1193186709 X:78521979-78522001 TGCAGGAGGCAGAGAGCAAGAGG + Intergenic
1195002278 X:100653376-100653398 GGCAGGAAGTGATGAGGAAAAGG - Intronic
1195129441 X:101839207-101839229 GGCAGGAAGCGGAAGGCAGGGGG + Intronic
1195176797 X:102320622-102320644 GGCAGGAAGCGGAAGGCAGGGGG - Intronic
1195182067 X:102366471-102366493 GGCAGGAAGCGGAAGGCAGGGGG + Intronic
1195670584 X:107466495-107466517 GGAGGGAAGTGGAGAGCAGCAGG - Intergenic
1197629288 X:128839784-128839806 GGCAGGTAGGGGAGAACAATAGG - Intergenic
1197671849 X:129285737-129285759 GTCAGGAGGTGGGGGGCAAGGGG + Intergenic
1197848445 X:130830389-130830411 GGCAGGAAGTGGAGTGGAGTGGG - Intronic
1197993821 X:132350599-132350621 AACAGTAAGTGGACAGCAAGAGG - Intergenic
1199330799 X:146555919-146555941 GTCAGGGGGTGGGGAGCAAGGGG + Intergenic
1199492276 X:148413509-148413531 GGCAACTAGTGGAGAGAAAGGGG + Intergenic
1199599768 X:149535021-149535043 GGGAGGAGGAGGAGAGTAAGAGG - Intergenic
1199650871 X:149945226-149945248 GGGAGGAGGAGGAGAGTAAGAGG + Intergenic
1199664204 X:150083666-150083688 GGGAGGAAGGGGAGAGAAGGGGG - Intergenic
1200145347 X:153923468-153923490 GGCAGGGAGTGGAGGGACAGAGG - Intronic
1200426095 Y:3021953-3021975 GGCAAAAAGTGGACAGCAAGTGG + Intergenic
1201592847 Y:15634611-15634633 GGCAAGAAGTGGGGAGAAACAGG - Intergenic
1201691799 Y:16775147-16775169 GGAAGGAGGTGGGGAGGAAGGGG - Intergenic
1202254505 Y:22906985-22907007 GGCTGTGAGTGGAGAGCAAGTGG - Intergenic
1202407496 Y:24540734-24540756 GGCTGTGAGTGGAGAGCAAGTGG - Intergenic
1202463286 Y:25129347-25129369 GGCTGTGAGTGGAGAGCAAGTGG + Intergenic