ID: 935231231

View in Genome Browser
Species Human (GRCh38)
Location 2:101098541-101098563
Sequence ATGTATACACTGTTGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12479
Summary {0: 3, 1: 116, 2: 7238, 3: 3367, 4: 1755}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935231231_935231236 26 Left 935231231 2:101098541-101098563 CCCCAAATCAACAGTGTATACAT 0: 3
1: 116
2: 7238
3: 3367
4: 1755
Right 935231236 2:101098590-101098612 TCTAAAATTGACCACATAATTGG 0: 1322
1: 1687
2: 6749
3: 2899
4: 1370
935231231_935231234 -4 Left 935231231 2:101098541-101098563 CCCCAAATCAACAGTGTATACAT 0: 3
1: 116
2: 7238
3: 3367
4: 1755
Right 935231234 2:101098560-101098582 ACATTCTTCTCAGTGCCACACGG 0: 170
1: 327
2: 396
3: 545
4: 1414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935231231 Original CRISPR ATGTATACACTGTTGATTTG GGG (reversed) Intronic
Too many off-targets to display for this crispr