ID: 935233868

View in Genome Browser
Species Human (GRCh38)
Location 2:101121663-101121685
Sequence CTGTTTCAACATATGGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3103
Summary {0: 1, 1: 3, 2: 63, 3: 602, 4: 2434}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935233862_935233868 7 Left 935233862 2:101121633-101121655 CCAGCTGCTAATACCATCCTGCT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233860_935233868 9 Left 935233860 2:101121631-101121653 CCCCAGCTGCTAATACCATCCTG 0: 1
1: 0
2: 1
3: 28
4: 338
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233859_935233868 23 Left 935233859 2:101121617-101121639 CCTTCAAGAAAAGGCCCCAGCTG 0: 1
1: 0
2: 4
3: 22
4: 161
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233858_935233868 26 Left 935233858 2:101121614-101121636 CCACCTTCAAGAAAAGGCCCCAG 0: 1
1: 0
2: 4
3: 23
4: 229
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233865_935233868 -10 Left 935233865 2:101121650-101121672 CCTGCTGGTGTTTCTGTTTCAAC 0: 1
1: 0
2: 0
3: 13
4: 234
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233864_935233868 -6 Left 935233864 2:101121646-101121668 CCATCCTGCTGGTGTTTCTGTTT 0: 1
1: 0
2: 7
3: 51
4: 524
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434
935233861_935233868 8 Left 935233861 2:101121632-101121654 CCCAGCTGCTAATACCATCCTGC 0: 1
1: 0
2: 1
3: 19
4: 179
Right 935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG 0: 1
1: 3
2: 63
3: 602
4: 2434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935233868 Original CRISPR CTGTTTCAACATATGGATTT GGG Intronic
Too many off-targets to display for this crispr