ID: 935237084

View in Genome Browser
Species Human (GRCh38)
Location 2:101148542-101148564
Sequence ATGCATGTATGTAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935237081_935237084 25 Left 935237081 2:101148494-101148516 CCTGGAGATGTGAAGAGAGGGAG 0: 1
1: 0
2: 6
3: 46
4: 411
Right 935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG 0: 1
1: 0
2: 4
3: 18
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935237084 Original CRISPR ATGCATGTATGTAAGCAGGA GGG Intronic
902080092 1:13814827-13814849 AGGCAGGTAGGAAAGCAGGAGGG - Intronic
903118610 1:21198552-21198574 ATGCAGGTCTGGCAGCAGGAAGG + Intergenic
908682986 1:66682783-66682805 GTGTATGTAGGCAAGCAGGAGGG + Intronic
909346532 1:74594477-74594499 ATGAATCTATGTAAGTTGGAAGG - Intronic
912708638 1:111933639-111933661 ATGCATGTGGGAAAGCAGGCAGG + Intronic
914873489 1:151494807-151494829 CTGCCTATATGGAAGCAGGAGGG - Intergenic
915832844 1:159147028-159147050 ATGAATGTAGGGAAGAAGGAAGG - Intronic
916585738 1:166148357-166148379 AAGCATCTATATAAGCATGATGG + Intronic
916794287 1:168151398-168151420 AGGCCTGTAAGTAAGCAGAAGGG - Intergenic
917318752 1:173757441-173757463 ATGCATATATGTAAGGAGAGAGG - Intronic
918717591 1:187809660-187809682 ATGTATGTATGTAGGTAGGTAGG - Intergenic
918923757 1:190751734-190751756 ATGGATTTATGTAAGCAGTTTGG - Intergenic
918984639 1:191608389-191608411 TAGCATGTATGTAAGCAAAATGG + Intergenic
922091757 1:222402020-222402042 ATGCATGTATGTATGTATGAAGG - Intergenic
922092950 1:222414821-222414843 TTGCATGTACGTCTGCAGGAAGG + Intergenic
922182804 1:223248656-223248678 TTGCTTGTTTGTGAGCAGGATGG + Intronic
923073480 1:230588253-230588275 AGCCATGTAAGTAAGCAGGTAGG + Intergenic
1063735423 10:8748474-8748496 ATGTATGTATGTATGCTGGTGGG - Intergenic
1065387719 10:25149927-25149949 CTGCAGGTATGTTAGCAGGCTGG + Intergenic
1065669379 10:28098050-28098072 ATTTATGTATGTAAGCATTAAGG - Intronic
1065718329 10:28597527-28597549 ATGCTGATATGTAAGCAGGAAGG - Intronic
1066443630 10:35461877-35461899 ATGCATTTACGTATGCAGGCTGG - Intronic
1066674423 10:37873400-37873422 ATGCATGTATGTAAATAGGATGG - Intergenic
1067858545 10:49820037-49820059 AAGCATGGCTCTAAGCAGGAAGG - Intronic
1068059838 10:52053106-52053128 ATTCATGTGTGTGTGCAGGATGG + Intronic
1068319062 10:55386663-55386685 ATGCAAGTATTTATGTAGGATGG - Intronic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070364795 10:75726148-75726170 AGGCATGGATGAAAGCAGGAAGG + Intronic
1071072271 10:81708614-81708636 ATGCATGAGTGGAAGCCGGAGGG - Intergenic
1072180885 10:92978846-92978868 ACTCATGTCTGTAAGTAGGATGG - Intronic
1072535679 10:96360837-96360859 ATTCAGGTATGCAACCAGGATGG - Intergenic
1073011251 10:100361492-100361514 ATGTATGAATGTAAGGATGAGGG + Exonic
1075654910 10:124154882-124154904 GTGCATGTATGTGAGCATGTGGG - Intergenic
1075834596 10:125443006-125443028 ATGTATGAATGGAAGCAGGCCGG + Intergenic
1078031703 11:7758981-7759003 ATTTATGAATGTGAGCAGGATGG - Intergenic
1078785404 11:14486176-14486198 ATGTGTGTATGAAAGCAGGAAGG + Intronic
1079127611 11:17730210-17730232 GTGCATATATGTAAGGAGGCTGG - Intergenic
1080111587 11:28574183-28574205 ATGCAAATATCTCAGCAGGAAGG + Intergenic
1080553405 11:33393972-33393994 ATGCATATTTGTAGGCAGAATGG - Intergenic
1081013922 11:37851832-37851854 ATGCATGCAGGAAAGAAGGAAGG - Intergenic
1082008298 11:47433397-47433419 AGGCCTGTAAGTGAGCAGGAGGG - Intergenic
1082064193 11:47885546-47885568 TAGCATGTATGCTAGCAGGATGG + Intergenic
1085820257 11:79784869-79784891 ATGCATGTTTGTAAGGCGGTGGG + Intergenic
1086014470 11:82149836-82149858 AGACATGTATGCAAGCAGGCAGG - Intergenic
1086510423 11:87551699-87551721 AGGCATGTAGCTAACCAGGAAGG - Intergenic
1086903002 11:92388626-92388648 TTGCATGTATATAAGCAACAGGG + Intronic
1087317582 11:96622121-96622143 AAGCATGTCTATAACCAGGAAGG - Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1087881975 11:103427145-103427167 ATGTATGTATGTAGGCATGTTGG - Intronic
1088066221 11:105723124-105723146 ATGTTTGTATGTAATTAGGAGGG - Intronic
1088762555 11:112946153-112946175 ATAAATGTATGTAAGTAGAATGG + Intergenic
1090253436 11:125266496-125266518 ATGGATGTGTGGAGGCAGGAAGG + Intronic
1090593676 11:128297616-128297638 ATGCAAGTATTTATGCAAGATGG + Intergenic
1090804917 11:130196863-130196885 ATGCATTAATGAAAGCAGGCTGG + Intronic
1093350645 12:18096837-18096859 ATGCATGTATGTATGTATGCAGG + Intronic
1093605496 12:21083688-21083710 ATGCATGTGTGGGAGCAGGCAGG - Intronic
1095367747 12:41428185-41428207 ATGCATGCATATAAGCAGGCAGG + Intronic
1095376615 12:41536664-41536686 ATGTATGTGTGAAAGAAGGATGG + Intronic
1095510653 12:42948257-42948279 ATGCATGCATGCATGCAGCATGG - Intergenic
1095544563 12:43349887-43349909 ATGCATGTATGTATGAATGTAGG + Intergenic
1096056379 12:48655901-48655923 ATGTATGTGTGTAAGTAGGTGGG - Intronic
1097685822 12:62689936-62689958 ATCCACGTATGTTAGCAGCAAGG - Intronic
1097785839 12:63758086-63758108 ATTCATGTATGGAAGCTGGAAGG - Intergenic
1098170750 12:67744580-67744602 ATGAATGTATGAAAGCAGAAAGG + Intergenic
1100745424 12:97640479-97640501 AGGCATGTGAGAAAGCAGGAAGG - Intergenic
1102073511 12:110041678-110041700 ATCAATGTGTTTAAGCAGGATGG + Exonic
1104541899 12:129673400-129673422 ATACATGTATGAAAGTAGAATGG - Intronic
1104813907 12:131634938-131634960 ATGCATGGATGGAAGAAAGAAGG - Intergenic
1105764083 13:23541248-23541270 AAACATGTATGTAATAAGGAGGG - Intergenic
1108163047 13:47662788-47662810 ATGTATGTATGTAGGCAGGCAGG - Intergenic
1109215179 13:59581574-59581596 ATGTATGTATTTAAGCATCAGGG + Intergenic
1111147153 13:84197321-84197343 ATGCAAGTATGCAAGAAGGGAGG + Intergenic
1111760269 13:92454857-92454879 ATGCATTTTTTTAAGCAGAATGG - Intronic
1112168181 13:96942448-96942470 GTGAATGTTTGCAAGCAGGAAGG - Intergenic
1114329624 14:21623485-21623507 ATGTATGTATGTATGTATGATGG + Intergenic
1114753941 14:25237432-25237454 ATGCATGTATATGTGCATGAGGG + Intergenic
1116164612 14:41318647-41318669 ATGCATGTATGTGTGGAGTATGG - Intergenic
1116902447 14:50374705-50374727 ATACATGTATGTACACAGGTTGG + Intronic
1121173687 14:91874798-91874820 AAGTATGTATGTAGGCTGGAGGG - Intronic
1121377557 14:93428241-93428263 ATGCATGTTTGCAAGCAGGATGG + Intronic
1123831665 15:24145481-24145503 ATACCTGGATGTAAGCTGGACGG - Intergenic
1125688603 15:41578642-41578664 ATGCATGCACTTAAGCAGCAGGG - Exonic
1129569591 15:76666483-76666505 ATGCATGTATGAAAGAAGAAAGG - Intronic
1131198736 15:90378719-90378741 ATGCAAGTTTGAAAGCTGGAAGG + Intergenic
1131484135 15:92806576-92806598 ATGTATGTAGGTAGGCAGGTAGG + Intronic
1131484137 15:92806610-92806632 GTGTATGTATGTAAGTAGGTAGG + Intronic
1131624469 15:94103056-94103078 AGGCATGCATGCAAGTAGGACGG + Intergenic
1132200926 15:99954283-99954305 ATGCCTGAAAGAAAGCAGGAAGG - Intergenic
1132788301 16:1670455-1670477 GTGCATGTCTGTATGCACGAAGG + Intronic
1132893722 16:2217532-2217554 ATGCCTGTATGTGTGCAGGTAGG + Intergenic
1133393269 16:5426308-5426330 CAGGATGTCTGTAAGCAGGAGGG + Intergenic
1133769062 16:8857143-8857165 GTGCATGTGTGTGAGCAGCAGGG - Intronic
1137695811 16:50461272-50461294 ATGCATGTGTGGAAGCAGCCAGG - Intergenic
1140208128 16:72950017-72950039 ATGGATGGATGAAAGAAGGAAGG + Intronic
1142778455 17:2161042-2161064 ATGTATGTATGTAGGTAGGTAGG + Intronic
1144540595 17:16137691-16137713 TTGCATGTATGTAATCAGAAAGG - Intronic
1145184984 17:20786286-20786308 ATGTATGAATGTAAGGATGAGGG + Intergenic
1145780278 17:27558447-27558469 GCGCATGTATGTGAGCAGGTGGG - Intronic
1147139943 17:38455186-38455208 ATGCATGTATTATAGCATGAAGG + Intronic
1147220766 17:38928666-38928688 ATACATGGATGCAAGCAGCATGG + Intergenic
1147229190 17:39004773-39004795 ACGCATGTAGAGAAGCAGGATGG - Intergenic
1149552022 17:57547374-57547396 ATGCATGTTTGGAAGCAGGGTGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1153921107 18:9791127-9791149 TTGCATTTATGCAAGCAGGTTGG + Intronic
1156522536 18:37733986-37734008 ATGCATGGATGAAAGGATGATGG + Intergenic
1156811306 18:41255752-41255774 CTGCATCTTTGCAAGCAGGAGGG - Intergenic
1159554612 18:69932381-69932403 ATGCATCTAAGTAAGCATGTGGG + Intronic
1162203783 19:9040471-9040493 TTGTATGTTTGTAAGCAGGTGGG - Intergenic
1163703619 19:18799553-18799575 ATGAATGGATGTATGGAGGATGG + Intergenic
1164866380 19:31607537-31607559 TTGCATGCTTGTAAGCAGAAGGG - Intergenic
1165418075 19:35707231-35707253 ATGCATGTATATTATGAGGAGGG + Intronic
925063631 2:912449-912471 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063652 2:912604-912626 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063660 2:912665-912687 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063664 2:912696-912718 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063670 2:912727-912749 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063695 2:912882-912904 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063716 2:913006-913028 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063734 2:913130-913152 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063738 2:913161-913183 ATTCATGTATCTGAGGAGGAAGG + Intergenic
925063757 2:913285-913307 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063777 2:913409-913431 ATTCATGTATGTCAGGGGGAAGG + Intergenic
925063795 2:913533-913555 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063799 2:913564-913586 ATTCATGTATCTGAGGAGGAAGG + Intergenic
925063803 2:913595-913617 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063813 2:913657-913679 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925063821 2:913719-913741 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063825 2:913750-913772 ATTCATGTATCTGAGGAGGAAGG + Intergenic
925063829 2:913781-913803 ATTCATGTATGTGAGGTGGAAGG + Intergenic
925063850 2:913905-913927 ATTCATGTATGTGAGGGGGAAGG + Intergenic
925835201 2:7938280-7938302 ATGCAGATATGCAAACAGGAAGG - Intergenic
926004236 2:9359962-9359984 ATTGCTGTATGTAACCAGGAAGG - Intronic
926577416 2:14597436-14597458 ATGCCTGCAGGTAAGCTGGAAGG + Intergenic
928741472 2:34358677-34358699 ATGCATGTGTGTATACATGAAGG + Intergenic
929043437 2:37768859-37768881 ATGCCTGTCTATATGCAGGATGG + Intergenic
931593927 2:63919463-63919485 ATTCATGTATGTAAACAATACGG + Intronic
931722694 2:65078903-65078925 AGGCATGTATCTAAGCATGCTGG + Intronic
931844343 2:66187196-66187218 ATGCGTGTGTGTGACCAGGATGG + Intergenic
932227583 2:70054918-70054940 ATGTATGTATGTATGTATGATGG - Intergenic
934052915 2:88225285-88225307 ATGAATGAATGGAAGAAGGAGGG + Intergenic
934101836 2:88660599-88660621 ATGTATGTGTGTATGCAGGTGGG + Intergenic
934196499 2:89841284-89841306 ATGCATGTATGTGGGCATGGTGG + Intergenic
934959773 2:98661312-98661334 ATCCATGTATGTATCCAGTATGG - Intronic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
937407662 2:121645646-121645668 GTGAATCTAAGTAAGCAGGAAGG + Intronic
938276855 2:130034087-130034109 ATACATGATTGTAAGCAGTAGGG - Intergenic
938438530 2:131303309-131303331 ATACATGATTGTAAGCAGTAGGG + Intronic
939312178 2:140495183-140495205 ATGTATGTATGTATGGTGGAGGG + Intronic
944135834 2:196398163-196398185 ATGCATGCATGTGAGTAGGGAGG + Intronic
945896385 2:215487088-215487110 ATGCGGGTAAGTAAGCAGTAGGG + Intergenic
946243582 2:218372264-218372286 CTGCATGTATTAAAGCAGGAAGG - Intergenic
946484005 2:220083446-220083468 ATGCATGAAAGGAAGCTGGAAGG - Intergenic
948157546 2:235795608-235795630 ATTTGTGTATGGAAGCAGGAAGG + Intronic
948246416 2:236489585-236489607 ATGCATGGATGGAAGCAGAAGGG + Intronic
1168790452 20:572559-572581 ATGAATGAAGGTAAGAAGGAAGG - Intergenic
1169553263 20:6723244-6723266 ATGCCTATTTATAAGCAGGAAGG - Intergenic
1169819977 20:9699787-9699809 ATGCATGCATGTAGAGAGGAAGG - Intronic
1169932078 20:10844435-10844457 ATATATGTATGTATGTAGGAAGG - Intergenic
1170316461 20:15046557-15046579 ATGCATGTATGTATTAAGAAAGG + Intronic
1171119170 20:22553327-22553349 ATGCATGGATGGAAGGAGGCTGG + Intergenic
1172395667 20:34602623-34602645 ATGTATGTATGTAAGTAGAAGGG + Intronic
1172440682 20:34964342-34964364 ATGAATGCATGAAAGCAGAAGGG + Intergenic
1172834337 20:37863470-37863492 AGGCAGTTATGTAAGCAGGGAGG + Intronic
1174577289 20:51545577-51545599 ATGCATGGATGGAAGATGGATGG + Intronic
1174910158 20:54599399-54599421 AGGCATGTATGAAATCAGAAGGG + Intronic
1175572322 20:60033363-60033385 GTGCATGTATGCATGAAGGAAGG - Intronic
1176286558 21:5022003-5022025 ATGCATGAATGGAAGGAGGGAGG - Intergenic
1176911824 21:14575059-14575081 ATGCATGTGTGTTAGGAGAAGGG - Intronic
1178861059 21:36290129-36290151 AGGCTTGTATGTATGTAGGATGG + Intronic
1179384020 21:40924984-40925006 ATACATGAATGCAGGCAGGACGG - Intergenic
1179870623 21:44241472-44241494 ATGCATGAATGGAAGGAGGGAGG + Intergenic
1182046808 22:27281229-27281251 CTGCATGTATGCAAGAATGAAGG - Intergenic
1182245893 22:28957343-28957365 ATGCATGTATGTTACCCAGAGGG + Intronic
1183074744 22:35419788-35419810 GTGCATGTCTGTAAGCTGGCAGG + Intronic
1183827479 22:40399800-40399822 AGGCATGTCTGGAAGCAGGAGGG + Intronic
1183866267 22:40706645-40706667 ATCCAGGTATGTAATGAGGAGGG - Intergenic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184812354 22:46844727-46844749 ATGCCTGCAAGTGAGCAGGAGGG - Intronic
1184822496 22:46920073-46920095 ATGTATGTATGTATGAATGAAGG + Intronic
1185018769 22:48360987-48361009 ATGGATGGATGGAAGCTGGATGG + Intergenic
1185018867 22:48361823-48361845 ATGGATGAATGCATGCAGGAAGG + Intergenic
1203295590 22_KI270736v1_random:40301-40323 ATGCCTGTCTATATGCAGGACGG + Intergenic
949385197 3:3494133-3494155 GAGTATGTGTGTAAGCAGGAGGG + Intergenic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
954992482 3:54853519-54853541 ATGCTTGCAGGCAAGCAGGAGGG - Intronic
956149927 3:66230437-66230459 GTGCATGTATGTATGTAGGGGGG + Intronic
956893352 3:73635014-73635036 ATGAATGGCTGTAAGGAGGATGG + Intergenic
957508977 3:81162858-81162880 ATGTATGTATGTATGCATGTAGG - Intergenic
961473458 3:127132742-127132764 CTGCAGGCAAGTAAGCAGGATGG - Intergenic
962100494 3:132337037-132337059 ACGCATGTATGTATGGAGAAAGG - Intronic
962123402 3:132588211-132588233 ATGTATGTATGTATGCATGTAGG + Intronic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
962867684 3:139461128-139461150 GAGCATGAATGTGAGCAGGAGGG + Intronic
963318584 3:143787437-143787459 ATGCATGTATGTAGTAAGCAGGG - Intronic
965346796 3:167561208-167561230 ATGAATGAATGTATGCATGATGG - Intronic
965491340 3:169340078-169340100 GTGCATGTATGTAAGAATGTGGG - Intronic
971425012 4:26507489-26507511 ATGGATGGATGGAAGAAGGATGG + Intergenic
973084954 4:46046868-46046890 ATACACGTTTTTAAGCAGGATGG - Intronic
973238868 4:47935425-47935447 ATGCATGTAGAGAACCAGGAAGG - Intronic
973314161 4:48742100-48742122 ATGCATGTGTGGGAGCAGGAAGG + Intronic
973713780 4:53655102-53655124 ATGAATTTATGTTAACAGGAGGG + Intronic
974795440 4:66742884-66742906 ATTCATGGATTTAAGTAGGAGGG + Intergenic
975253580 4:72208979-72209001 ATGCATGTTTCCATGCAGGATGG - Intergenic
976547717 4:86356915-86356937 ATGCATGTGTGGTAGGAGGAAGG + Intronic
977732219 4:100367461-100367483 ATGCATGTATGTATGTGGGTAGG + Intergenic
979708021 4:123744807-123744829 ATACAGGCATGTGAGCAGGAAGG + Intergenic
980921449 4:139090397-139090419 ATGCATGTATTTAAGTATTAAGG + Intronic
981326793 4:143457447-143457469 ATGCAACAATGTAAGCAGCAAGG - Intronic
982298276 4:153852584-153852606 ATGTATGTATGTAATCAACATGG + Intergenic
982913547 4:161176059-161176081 ATACATTTATGTAAGCTAGATGG + Intergenic
984698431 4:182801819-182801841 GTGCATGCATGTGTGCAGGAGGG - Exonic
984749253 4:183256060-183256082 ATGATTGGATGTTAGCAGGAAGG + Intronic
986142547 5:5044972-5044994 ATACATGTATGCAAGATGGATGG - Intergenic
987559447 5:19500247-19500269 ATGCATGTATGTATACAGTTTGG + Intronic
988154539 5:27433097-27433119 ATGTATGTTGGTAAGCAGGTAGG - Intergenic
988412487 5:30904929-30904951 ATGAATGGAAGGAAGCAGGATGG + Intergenic
991678150 5:69109443-69109465 ATGTATGTATGTATGCATGTAGG + Intronic
991905199 5:71502862-71502884 ATGTATGTATGTAAGTATGTGGG - Intronic
992364671 5:76079574-76079596 ATGAATGTATTGAAACAGGATGG + Intergenic
994146698 5:96403042-96403064 GTGCATGTGTGGAGGCAGGAAGG + Intronic
996059975 5:119022479-119022501 ATGCGTGTAAGTAAAGAGGAAGG + Intergenic
996336792 5:122392542-122392564 ATGGGTGTATGTAGGTAGGATGG + Intronic
1002040321 5:176508802-176508824 CTGCATGGTTGTCAGCAGGAAGG - Exonic
1003692841 6:8371826-8371848 ATGCACATATGAAAGCAGGCAGG + Intergenic
1004916951 6:20341246-20341268 ATGCGTGTAGTCAAGCAGGAGGG + Intergenic
1007842927 6:44731385-44731407 ATGCATGTGTGCCAGCAGCAGGG + Intergenic
1008255937 6:49299652-49299674 GTGAATGTATGTAAGCCAGATGG + Intergenic
1008814867 6:55553275-55553297 ATGTATGTATGTAACTAGCAGGG + Intronic
1009210716 6:60860000-60860022 ATGCATGTATATATGTAGGGGGG + Intergenic
1010054700 6:71551693-71551715 AGCCATGTGTGGAAGCAGGATGG + Intergenic
1010390088 6:75327003-75327025 ATGGATTGATGTCAGCAGGAGGG - Intronic
1012272156 6:97226707-97226729 ATATATGTATGTAGGTAGGAAGG + Intronic
1012761904 6:103313314-103313336 ATACATTTTTGTAAGCATGAAGG - Intergenic
1012843333 6:104357900-104357922 CAGCATGTATGTAAGCAGGAAGG - Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1013305748 6:108845827-108845849 ATGCATGTATAATAGCAGCATGG + Intergenic
1013995147 6:116299606-116299628 ATGTATGTATGTAGGTAGGTAGG + Intronic
1014066903 6:117137614-117137636 ACGGATGTATGTAAGATGGAGGG - Intergenic
1016411621 6:143789130-143789152 ATCCAGGTATGAAAGCAGGTAGG - Intronic
1017325689 6:153139316-153139338 ATGTATGCATGTGAGTAGGAAGG + Intergenic
1017686141 6:156915215-156915237 ATGCATGTATGTGAGCAAACAGG + Intronic
1018244103 6:161805433-161805455 GTGCATGTGTGTACTCAGGAAGG - Intronic
1018443368 6:163833962-163833984 TTGCATTTATGTAAGCATCAAGG + Intergenic
1022168170 7:27793939-27793961 ATGCATGTAGTAAAGTAGGAAGG + Intronic
1022583486 7:31581501-31581523 ATGCTTATATGCAAACAGGAGGG - Intronic
1022830921 7:34065899-34065921 ATGCATGTATGTGTGCATGGAGG - Intronic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1026728503 7:72891233-72891255 GTTCATGTATGTGTGCAGGAAGG - Intronic
1030986607 7:116248852-116248874 ATCCATATATTTAAGCAAGAAGG - Intronic
1031024213 7:116662712-116662734 ATGCAAATATTTAAGAAGGAAGG + Intergenic
1033111158 7:138578570-138578592 ACGCACGAATGGAAGCAGGACGG + Intronic
1033238671 7:139658964-139658986 ATGGATGTCTTAAAGCAGGAGGG + Intronic
1035045988 7:155965920-155965942 ATGACTGCATCTAAGCAGGAGGG - Exonic
1036961653 8:13250715-13250737 AAGCATGTATTTAAGCAGAGTGG + Intronic
1037458043 8:19083197-19083219 TTGCATGTGTGTGAGCATGAGGG - Intronic
1037764610 8:21764705-21764727 ATTGAAGGATGTAAGCAGGAAGG - Intronic
1038682869 8:29685795-29685817 ATGCATGTATATAACCACGTAGG + Intergenic
1039411123 8:37356068-37356090 ATGCATGTATGCATGCATTATGG + Intergenic
1041785584 8:61629187-61629209 ATGCAGGTATGTGAGCATCATGG - Intronic
1042012372 8:64261681-64261703 ATGCATTTTTATAAGCAAGAAGG + Intergenic
1042508599 8:69588192-69588214 ATGCAGGTCTGTAAGAGGGAGGG - Intronic
1044022201 8:87118395-87118417 GTTCATGTATGTAAATAGGAGGG + Intronic
1045141439 8:99289053-99289075 ATGAATGAATGAAAGAAGGAAGG + Intronic
1047453884 8:124991377-124991399 ATGTATGTATCTATGCATGAAGG - Intergenic
1047724205 8:127670254-127670276 AGGCTTGGATGTAACCAGGAGGG - Intergenic
1048112037 8:131478812-131478834 ATTCATGTCTCTGAGCAGGATGG + Intergenic
1048955897 8:139535768-139535790 ATGTATGTATGGAAGTATGATGG - Intergenic
1049044168 8:140136423-140136445 ATGCATGTATGTGCTCAGTAAGG - Intronic
1049305550 8:141901504-141901526 GTGCATGTATGTGAGCATGTTGG + Intergenic
1051133760 9:13894159-13894181 TGGCATGTGTGTAAGCAGGAAGG + Intergenic
1057422787 9:94925979-94926001 ATGCCTGTGTGTAAGACGGAGGG - Intronic
1061307564 9:129740906-129740928 TGGAATGTATGTCAGCAGGAAGG - Intronic
1185771682 X:2769637-2769659 GTGCATATATGTCAGCAAGAGGG + Intronic
1187045609 X:15645757-15645779 ATACATGGATGTACTCAGGATGG + Intronic
1187673831 X:21695911-21695933 TTGCAAGTATGTATACAGGAAGG + Intergenic
1188553443 X:31385446-31385468 ATCCATGTTTGTGAACAGGATGG - Intronic
1189720035 X:43906407-43906429 ATGCATGGATGTCTGCAGCAAGG - Intergenic
1190132203 X:47758954-47758976 ATGCATCTATATTAGGAGGATGG + Intergenic
1190473868 X:50809133-50809155 ATTCATGTAGGTAACCAGGCTGG + Intronic
1194971358 X:100347646-100347668 ATGCCTGTATGTAAACAGTCTGG + Intronic
1195029989 X:100917485-100917507 GTGCATGCCTGTAAGGAGGAAGG + Intronic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1195801107 X:108711822-108711844 ATGCATGTTTGTATGCTTGATGG + Intergenic
1195890059 X:109683965-109683987 ATGCATTTGTGTAAGCATTAAGG - Intronic
1197394450 X:125909295-125909317 ATGAATATATGTAACCAAGAAGG + Intergenic
1198421942 X:136477089-136477111 ATACTTGAATGTAAACAGGAAGG + Intergenic
1201298896 Y:12489397-12489419 GTGCATATATGTCAGCAAGAGGG - Intergenic