ID: 935239034

View in Genome Browser
Species Human (GRCh38)
Location 2:101162199-101162221
Sequence ATGAGGGAGCAGAACTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935239023_935239034 30 Left 935239023 2:101162146-101162168 CCAGGCCAGGCACTCCTCTCTGG 0: 1
1: 0
2: 1
3: 43
4: 343
Right 935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG 0: 1
1: 0
2: 0
3: 28
4: 282
935239025_935239034 25 Left 935239025 2:101162151-101162173 CCAGGCACTCCTCTCTGGAGAAA 0: 1
1: 0
2: 2
3: 32
4: 252
Right 935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG 0: 1
1: 0
2: 0
3: 28
4: 282
935239027_935239034 16 Left 935239027 2:101162160-101162182 CCTCTCTGGAGAAACAAGGACAA 0: 1
1: 0
2: 4
3: 26
4: 238
Right 935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG 0: 1
1: 0
2: 0
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935239034 Original CRISPR ATGAGGGAGCAGAACTAGGC AGG Intronic
902439294 1:16418836-16418858 ATGAGAAATAAGAACTAGGCCGG - Intronic
902901174 1:19517206-19517228 ATCAGAAAGCAGAACTAGGCTGG + Intergenic
903559759 1:24218465-24218487 CTGAGGGAGCAGCAGTAGACAGG - Intergenic
905130881 1:35756267-35756289 AAAAGGGAACAGAAATAGGCAGG + Intronic
905468330 1:38172875-38172897 GTCAAGGAGCAGAATTAGGCTGG + Intergenic
905846762 1:41241033-41241055 ATAAGGGAAAAGAACTAGGAAGG + Intronic
905905806 1:41617783-41617805 ATGTGGGAGTAGAATTTGGCTGG - Intronic
905909775 1:41645875-41645897 ATGAGGGAACAGACCTAGAAAGG - Intronic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907299476 1:53477614-53477636 TTGAGGAAGCTGAACTAAGCAGG - Intergenic
907316461 1:53575759-53575781 ATGCAGGAGCAGCACTGGGCTGG + Intronic
908151838 1:61310615-61310637 ATGAGGCTGAAGAACCAGGCAGG - Intronic
908411798 1:63873457-63873479 AGGAGTGAGCAGGCCTAGGCTGG + Intronic
909474393 1:76065672-76065694 ATGTGGGACCAGAAAGAGGCGGG + Intergenic
910330235 1:86065080-86065102 ATGAGGCAGCAGCTCTAGGAGGG + Intronic
910443171 1:87273631-87273653 AAGAAATAGCAGAACTAGGCTGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912303086 1:108536717-108536739 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
912424068 1:109570759-109570781 ATGAGGGTGAAGAGGTAGGCAGG + Intronic
912669237 1:111608800-111608822 CTGAGGCAGGAGAACCAGGCAGG + Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914442370 1:147718693-147718715 ATGTGGTGTCAGAACTAGGCTGG - Intergenic
915876444 1:159616219-159616241 AAGAGCGAGCAGAAGTAGGGTGG + Intergenic
917102760 1:171462034-171462056 AAGAGAGAAAAGAACTAGGCTGG + Intergenic
917521429 1:175751127-175751149 AGGGAGGAGCAGAACCAGGCTGG - Intergenic
918067440 1:181110856-181110878 ATGAGGCAGTAAAAGTAGGCAGG - Intergenic
920197982 1:204242178-204242200 ATGAGCAAACAGAACCAGGCGGG + Intronic
921289598 1:213645190-213645212 ATGACGGAGCAGAAAGAGGTGGG + Intergenic
1063856551 10:10260688-10260710 GGGAGGGAACAGAAATAGGCTGG - Intergenic
1064241445 10:13633207-13633229 CTGAGAGACCAGAGCTAGGCAGG + Intronic
1065068782 10:22001210-22001232 ATGAGGGACCAGAACAAAGTAGG - Intronic
1068081410 10:52322389-52322411 ATGTGGAAGCTGAAATAGGCCGG + Intergenic
1068272154 10:54742393-54742415 ATGAGGGGTAACAACTAGGCTGG - Intronic
1068976258 10:63013377-63013399 ATGAGGTTGGAGAGCTAGGCTGG + Intergenic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1069784110 10:70977119-70977141 ATGAGGGAGAAGTCCTAGGTGGG + Intergenic
1070723652 10:78773548-78773570 GTGAGGGAGGAGACCCAGGCAGG - Intergenic
1071945166 10:90635578-90635600 ATGAGTGAGCACACCAAGGCAGG - Intergenic
1072609222 10:97005391-97005413 CGGAGGGAGCAGGACAAGGCAGG - Intronic
1073008996 10:100345955-100345977 ATGAGAGCTCAGAACCAGGCAGG - Intergenic
1075095638 10:119468971-119468993 AGGAGGGAACAGAGCTAGGGGGG + Intergenic
1075552277 10:123401224-123401246 AGGAGGGAGCACACCTATGCGGG - Intergenic
1076553980 10:131310583-131310605 ATGGTGCAGCAGAGCTAGGCGGG - Intronic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1078253555 11:9638291-9638313 ATGAGGGAGAACACCTGGGCTGG - Intergenic
1079745679 11:24125830-24125852 ATGAGGGAGCAGAAAGATGAAGG + Intergenic
1079837359 11:25350916-25350938 ATAAGGGAGCTGCACTGGGCTGG + Intergenic
1080696374 11:34606295-34606317 ATGAGGCTGCAGAAATAGGTAGG + Intergenic
1081342736 11:41947782-41947804 ATGGGGGTGCAGACCTAGCCCGG + Intergenic
1081491480 11:43572807-43572829 ATCAGGGAGCAGAACTATTTTGG - Intronic
1081852599 11:46284235-46284257 ATGATGGAGCAGAGCATGGCAGG + Intronic
1083263659 11:61536368-61536390 GTGAGGGAGCAGAAGCAGGCTGG - Intronic
1083808659 11:65089923-65089945 GTGAGAGATGAGAACTAGGCTGG + Intronic
1085688739 11:78648844-78648866 ATGAGGGAGAGGAAATAGGGAGG - Intergenic
1086296314 11:85372261-85372283 CTGAGGGAGCTGACCAAGGCTGG + Intronic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1088521780 11:110709741-110709763 ATGAGGTGGCAGAAGTAGACAGG + Intronic
1088689265 11:112311411-112311433 GTGAGGGAGCAGAATGAGCCAGG + Intergenic
1090020799 11:123126599-123126621 ATAAGAAAACAGAACTAGGCTGG + Intronic
1090785616 11:130044780-130044802 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1092453386 12:8624453-8624475 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1093104168 12:15065917-15065939 CTGAGGGAGCAGAGTTAGACAGG + Intergenic
1093624033 12:21325538-21325560 ATGAGGGAGCTGAAATTGCCTGG - Intronic
1094193061 12:27716516-27716538 ATAAGAGAGCAGAAATAGGGGGG - Intronic
1095696649 12:45151492-45151514 ATGAGAGAACAGAACTAAGGGGG - Intergenic
1097310859 12:58117635-58117657 AGGAGGGAGCAGGAGTGGGCAGG + Intergenic
1098774030 12:74588832-74588854 CTGAGGGAGGAGAATCAGGCAGG + Intergenic
1099909684 12:88814487-88814509 ATGATGGAGCAGAAATATACAGG - Intergenic
1100334471 12:93616627-93616649 AACAGAGAGCAGAATTAGGCAGG + Intergenic
1100606758 12:96158201-96158223 TTGAGGCAGGAGAACCAGGCAGG - Intergenic
1100855193 12:98751595-98751617 CTGAGGGAGGTGAACTAGGGAGG + Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1106125042 13:26894317-26894339 CTGAGGTAGCAGAAGTAGGTCGG + Intergenic
1106620815 13:31368766-31368788 CTGAGGGACAAGAACCAGGCAGG + Intergenic
1107720122 13:43239394-43239416 AGGAGGCAGAAGAACTATGCTGG + Intronic
1109702494 13:66045714-66045736 CTGAAGGATCAGAACTTGGCAGG - Intergenic
1110369239 13:74721062-74721084 ATGTGGGAACAGATCTAGTCAGG - Intergenic
1110574564 13:77040876-77040898 ATGAGGGAGCAGGAGTGGGCAGG + Intergenic
1112504220 13:99965932-99965954 ATTAGGAAGAAGAATTAGGCTGG - Intronic
1114666545 14:24380662-24380684 AGGAGAGAGAAGAACGAGGCTGG + Intergenic
1115305597 14:31930528-31930550 ATCAGGAAGTAGAACCAGGCTGG - Intergenic
1117705208 14:58459087-58459109 TTGAGTGAGCGGAACTAGGCAGG + Intronic
1121196973 14:92082322-92082344 ATGAGGAAGCAGATCTCCGCAGG - Exonic
1121248401 14:92481541-92481563 AAGAGGGGGCAGAACAAGGTTGG - Intronic
1121381786 14:93477162-93477184 TTGATGGAGCAGAAATAGCCCGG + Intronic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1123485294 15:20730406-20730428 AAGGTGGAGCAGATCTAGGCGGG - Intergenic
1123541782 15:21299455-21299477 AAGGTGGAGCAGATCTAGGCGGG - Intergenic
1124066809 15:26352547-26352569 ATGAGGGAGGAGAATAAGGTTGG - Intergenic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125778568 15:42242334-42242356 AAGAGGGACCAGAGCCAGGCTGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1127259370 15:57317038-57317060 AGGAGAGAGCAGAAGTGGGCAGG - Intergenic
1127969747 15:63949072-63949094 ATGAGGCACCAGAGCTAGGTTGG - Intronic
1131105318 15:89729872-89729894 TTTAGGGACCAGATCTAGGCAGG + Intronic
1202950097 15_KI270727v1_random:26597-26619 AAGGTGGAGCAGATCTAGGCGGG - Intergenic
1132640541 16:976278-976300 ATGAGGGCCCAGAACGAGGCTGG + Intronic
1132849758 16:2019723-2019745 CTGAGGGGGCGGAACGAGGCGGG + Exonic
1132921975 16:2400662-2400684 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1132931807 16:2462505-2462527 ATGAGGGAGGAGCTCTCGGCAGG + Exonic
1133414454 16:5595454-5595476 ATGAGGGAGCAGAACTTGCAGGG + Intergenic
1134310408 16:13070977-13070999 AAGAGAGAGAAGAACCAGGCAGG - Intronic
1134405698 16:13956692-13956714 ATGAGGGAGCAGAGCAAAGTGGG + Intergenic
1135394061 16:22117496-22117518 TGGTGGGAGCAGAGCTAGGCTGG - Intronic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1136229540 16:28878440-28878462 ATGAGGGAGCAGGGGGAGGCCGG - Exonic
1138608751 16:58106247-58106269 ATGAGAGAGCAGTACCAGGCAGG - Intergenic
1138635288 16:58333290-58333312 ATGGGGGAGTGGAACCAGGCAGG - Intronic
1139558866 16:67729254-67729276 AGGAGGAAGCAGAGCAAGGCAGG + Intronic
1139644697 16:68319865-68319887 ATGAGCACCCAGAACTAGGCAGG - Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141636344 16:85315940-85315962 AGGTGGGAGCAGGACCAGGCTGG + Intergenic
1143115390 17:4578925-4578947 GTGAGGCAGGAGAACCAGGCAGG + Intergenic
1144067375 17:11636767-11636789 AGGAGGAAGCAGAACTTGGTAGG + Exonic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146798297 17:35798448-35798470 TTCAGGGACCAGAGCTAGGCTGG - Intronic
1149403314 17:56321355-56321377 ATTAGGGAACGGAAGTAGGCTGG + Intronic
1149639400 17:58193189-58193211 ATGAGTGAGATGAACTTGGCTGG - Intronic
1149695389 17:58612290-58612312 ATCAAGAAGCAGGACTAGGCTGG + Intronic
1151324035 17:73368092-73368114 GGCAGGGAGCAGAAGTAGGCTGG + Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151542870 17:74773751-74773773 ATGAGGGTCCAGAACCAGACAGG + Intronic
1151759791 17:76094110-76094132 GTGAGGGAGGAGGCCTAGGCAGG + Intronic
1152123377 17:78432470-78432492 AGCAGGGAGCAGAACTGGGCCGG - Intronic
1153523824 18:5977092-5977114 ATGAGGGAGCAGGACTGAGGTGG - Intronic
1153592853 18:6692319-6692341 AGGAGGAACCAGGACTAGGCAGG + Intergenic
1154291705 18:13113954-13113976 ATGAGAGAGAGGAACCAGGCAGG + Intronic
1155925550 18:31651728-31651750 ATGAGGGAGAAGCACAAGGGAGG - Intronic
1158472688 18:57751728-57751750 GTGAGGGAGCAGAAGGTGGCTGG - Intronic
1160626397 18:80210453-80210475 GGGAGGGAGCAGAACCAGTCTGG + Intronic
1161577053 19:5060099-5060121 ATGTGGGAGCTGATCTTGGCCGG + Intronic
1163388725 19:17016462-17016484 ATAAGAAAGCAGATCTAGGCTGG + Intronic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1165478596 19:36047524-36047546 ATGACAGAGCAGAAAGAGGCCGG + Intronic
1165854259 19:38870354-38870376 ACGGGGGACCAGAGCTAGGCAGG - Intronic
1166677720 19:44749409-44749431 ATGAGGAAGCTGAGCTGGGCTGG + Intronic
1167419797 19:49396077-49396099 ATGATGGAGCAGAGGTAGGCGGG - Intronic
1168326194 19:55539664-55539686 CTGTGGGAGCAGAACTGGGAAGG + Intergenic
1168520690 19:57048109-57048131 ATTAGGAAGAAGAACAAGGCAGG - Intergenic
1168668500 19:58222928-58222950 ATGAGGGGGAAGAAGTAGGCTGG + Intergenic
1168706855 19:58475378-58475400 TTTGGGGAGCAGAACTAGCCAGG - Intronic
925407734 2:3616658-3616680 CTGAGGCAGGAGAACCAGGCAGG + Intronic
926357736 2:12056802-12056824 ATGTGGGGGCTGAACTAGGGTGG + Intergenic
929300659 2:40300319-40300341 ATGAGAAAGCAGATCTAGACAGG + Intronic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
932422655 2:71610806-71610828 AGGAGGCAGGAGAACCAGGCTGG + Intronic
933374343 2:81460396-81460418 ATGAGGGAGGATAACTGGGAAGG - Intergenic
934197539 2:89851823-89851845 ATGAGGGAGGACAACTGGGTGGG + Intergenic
934514587 2:94978107-94978129 ATGAGGCAGCAGAGCCAGCCAGG - Intergenic
934566059 2:95341967-95341989 ATGATGGAGGAGATCTAGGAAGG + Intronic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937398148 2:121556948-121556970 ATTTGGTAGCAGAACTAGGATGG - Intronic
938571077 2:132562402-132562424 ATGAGGCTGAAGAATTAGGCAGG - Intronic
939362846 2:141196058-141196080 ATGAGGTAGCAAAGATAGGCAGG + Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
940612713 2:156010531-156010553 ATGAGGGAGGAGTTCTAGACAGG - Intergenic
940626138 2:156177429-156177451 ATAAGGGACCAGAAGTAGCCTGG + Intergenic
941024962 2:160448391-160448413 CTGAGGCAGGAGAATTAGGCAGG - Intronic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
942866345 2:180680015-180680037 AGGAGGAAGCAGGTCTAGGCAGG - Intergenic
942943272 2:181644946-181644968 ATGAGGATGCAGAGATAGGCAGG + Intronic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
945327826 2:208503223-208503245 TTGAGGGAGAAGAACAAAGCTGG - Intronic
945506849 2:210652242-210652264 ATGATGGTGCAGAAGTAGTCAGG + Intronic
947810894 2:233003348-233003370 AGGAAGGATCAGAAATAGGCTGG - Intronic
948448256 2:238050664-238050686 TGGAGGGAGCAGAACATGGCTGG + Intronic
1169084499 20:2818367-2818389 AGCAGGGATCAGAACTGGGCAGG - Intronic
1172279797 20:33700873-33700895 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1172735671 20:37125316-37125338 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1173186138 20:40841813-40841835 CTGAAGGAGCAGCACTAGGCAGG - Intergenic
1173468190 20:43301198-43301220 AGGAGAGAGCAGAACCATGCTGG - Intergenic
1173917963 20:46723692-46723714 ATGAGGCAGGAGAAATAGGCAGG - Intronic
1174518066 20:51108630-51108652 ATGAGTGAGCAGATCCAGGCAGG - Intergenic
1174659017 20:52194445-52194467 ATGAGGGAGCCGACCAGGGCTGG - Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176276278 20:64271682-64271704 CTTAGGGAGCAGCACTGGGCTGG + Intronic
1176893551 21:14348341-14348363 GAGAGGGAGCAGAAGAAGGCTGG + Intergenic
1177485613 21:21751508-21751530 ATGAAGGAGAAAAATTAGGCAGG + Intergenic
1177963201 21:27694981-27695003 ATGAGGCTGTAGACCTAGGCAGG + Intergenic
1178470026 21:32884300-32884322 ATGAGGATGCAGCACTAGGGAGG - Intergenic
1179908221 21:44435069-44435091 ATGGGGGAGCAGGACAGGGCAGG - Intronic
1180039336 21:45268090-45268112 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1181458472 22:23072494-23072516 ATGAGGGAGCTGACTTAGGGGGG - Intronic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182544202 22:31064166-31064188 AGGAAGAAGCAGAACTGGGCAGG + Intronic
1182551665 22:31104105-31104127 GCGGGGGAGCAGAGCTAGGCAGG - Intronic
949570142 3:5284623-5284645 ATGAGGCAGGAGAATCAGGCAGG + Intergenic
950118321 3:10465314-10465336 AGAAGGGAGCAGAGCTTGGCAGG - Intronic
950120402 3:10478649-10478671 ATGATGGAGAAGAAAGAGGCAGG - Intronic
950613262 3:14139454-14139476 ATGAGGGAGCAGAGGAAGGCAGG + Intronic
950665805 3:14494334-14494356 CTGAGGGAGCAAAAATAGCCAGG + Intronic
951175066 3:19589645-19589667 TTTAGGGAGCAGAATTAGACAGG + Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
952952731 3:38538012-38538034 ATGAGGGAGAATAACCAGTCAGG - Intronic
953858779 3:46524169-46524191 ATGAGACAGCAGAATTTGGCTGG + Intronic
953872798 3:46642077-46642099 GTGAGGGAGCAGAAGAAGGTGGG + Intergenic
954060243 3:48061289-48061311 CTGAGGGAGGAGAATCAGGCAGG - Intronic
954696763 3:52431581-52431603 AGGAGGGGCCAGAAATAGGCTGG + Intergenic
956586348 3:70869285-70869307 AAGAGGCAGCAGAAATTGGCAGG - Intergenic
957338231 3:78859696-78859718 ATGAGGGAGAGGAACTGGGTGGG + Intronic
960709983 3:120518496-120518518 AGAAGGAAGCAGAACTGGGCAGG + Intergenic
961737677 3:129012432-129012454 AGGAGCGAGTAGAACCAGGCAGG - Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
965266133 3:166546312-166546334 AGGAAGGAGCAGAAGTTGGCAGG + Intergenic
966967077 3:185004379-185004401 CTGAGGCAGGAGAACCAGGCAGG + Intronic
967905874 3:194499560-194499582 CTGAGGATGCAGAACTAGGGAGG - Intergenic
970470504 4:16374014-16374036 AAGAGGGAGTAGAAGTAGACAGG + Intergenic
970770632 4:19607927-19607949 ATGAGAGGGCAGAAATAGTCAGG + Intergenic
970997103 4:22280132-22280154 AGCAGGGAGCAGAAATAGGCTGG + Intergenic
972270858 4:37509862-37509884 CTGAGGCAGCAGAATCAGGCAGG + Intronic
972939595 4:44181342-44181364 CTGAGGCAGGAGAACCAGGCAGG - Intronic
978613614 4:110571645-110571667 AAGAGGGAGCAGCAATAGGCAGG - Intergenic
981000396 4:139823564-139823586 AGGAGGCAGCAGAACAAGGGTGG + Intronic
982091928 4:151887663-151887685 AATGGGAAGCAGAACTAGGCTGG - Intergenic
984575828 4:181447027-181447049 ATGAGGGAGCAGAAGTTGCCTGG + Intergenic
985523950 5:392235-392257 ATGAGGGCGCAGGGCGAGGCAGG + Intronic
986234397 5:5893757-5893779 TTTAGGGAGCAGAACTAGTTAGG + Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
990561977 5:56992368-56992390 GTGAGGGAGCAGGAGTAGGTTGG + Intergenic
990772532 5:59265231-59265253 CTAAGGAAGCACAACTAGGCAGG - Intronic
991910263 5:71552719-71552741 CTGAGGCAGGAGAACCAGGCAGG + Intronic
992250722 5:74873466-74873488 ATGAAGCTGCAGAAATAGGCAGG + Intergenic
993262376 5:85675521-85675543 ATGAGGCTGCAGAAGCAGGCAGG - Intergenic
996032771 5:118724454-118724476 TTGAGGTAGCTGAACTTGGCTGG + Intergenic
996747929 5:126861664-126861686 AGGAGAGAGCAGACCTAGCCAGG + Intergenic
997791977 5:136769702-136769724 GTGGGGCAGCAGAGCTAGGCTGG + Intergenic
998077273 5:139246802-139246824 ATGAGGGTACAGAACTTGCCTGG - Intronic
998209397 5:140182976-140182998 ATGATGGAGCAAAGCCAGGCTGG + Intronic
999044012 5:148448290-148448312 ATGAGGGAGGGGACCTAGGGAGG - Intergenic
999108370 5:149093704-149093726 GTGGGGGAGCAGAGCAAGGCTGG - Intergenic
1000150135 5:158492174-158492196 GTGAGGGAGAAGAAGCAGGCAGG - Intergenic
1000409840 5:160926685-160926707 AGGAGGAAGCATCACTAGGCTGG + Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1002157915 5:177297245-177297267 ATGAAAGGGGAGAACTAGGCAGG - Exonic
1003058675 6:2844850-2844872 AAGAGGGATAAGAACAAGGCCGG - Intergenic
1003266701 6:4572095-4572117 ATGATGTAGCAGCCCTAGGCAGG + Intergenic
1004467207 6:15897306-15897328 AAGTGAGAGCAGAACTAGACAGG - Intergenic
1004622902 6:17346935-17346957 TTGAGGGAGAAAAACTAGGCTGG - Intergenic
1006406950 6:33851006-33851028 GTGAGGGAGGAGAGCTGGGCTGG + Intergenic
1009917837 6:70018123-70018145 ATGAGGGAGCAGAAAAAGATAGG + Intronic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1013219992 6:108070016-108070038 ATGACGGAACAGAGCAAGGCTGG - Intronic
1015526299 6:134177428-134177450 AGGTGGGAGCAGAGCTAGGCTGG - Intronic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1017318061 6:153055482-153055504 ATGGTGGAGAAGAACAAGGCAGG + Intronic
1017812818 6:157996455-157996477 ATGAGGGTGGAGAAAGAGGCAGG - Intronic
1020472359 7:8553409-8553431 ATGATGGAGCAGAAATTGGCTGG + Intronic
1022845622 7:34206945-34206967 CTGAGGGAACAGAATTAGCCAGG + Intergenic
1023996429 7:45161700-45161722 AGGAGGAAGAAGAACTGGGCTGG + Intronic
1028923809 7:96335940-96335962 ATGACGAAGCATATCTAGGCCGG - Intergenic
1028979304 7:96949638-96949660 ATGAGGGAGTAGGAGGAGGCTGG - Intergenic
1029408176 7:100390334-100390356 CTGAGAGAGAAGAACTAGGGGGG - Intronic
1030510679 7:110479202-110479224 ATGAGGTTGGAGAAGTAGGCAGG - Intergenic
1030828280 7:114188282-114188304 ATGAAGAAGAAAAACTAGGCAGG - Intronic
1031982154 7:128135288-128135310 ATGAGGGCGAAGCACTAGGTAGG - Intergenic
1032727746 7:134606710-134606732 ATGATGGAGGAGTACTAGGGAGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1034645667 7:152644324-152644346 AAGAGGGGGCAGAATGAGGCAGG - Intergenic
1035245403 7:157559622-157559644 AGCAGGGAGCAGAATCAGGCAGG + Intronic
1037722312 8:21455319-21455341 ACGAGTGAACAGAAGTAGGCTGG - Intergenic
1038152014 8:24950453-24950475 ATGAGGTTAGAGAACTAGGCAGG + Intergenic
1039828620 8:41195314-41195336 CTGAGGGAGCACATCCAGGCTGG - Intergenic
1040480817 8:47824866-47824888 AGGAGGGAGCAGTCCTTGGCTGG - Intronic
1041600497 8:59711824-59711846 AAGAGGGAGCAGGAGTAGGTGGG + Intergenic
1043012145 8:74894221-74894243 GTGAGGAAGCAGAGGTAGGCAGG - Intergenic
1045217238 8:100160688-100160710 AGTAGGGAGAAGAAGTAGGCAGG + Intronic
1047575532 8:126149965-126149987 AAGATGGAGCTGAACTGGGCAGG - Intergenic
1047981867 8:130191836-130191858 ATGAGGGAGCAGAGAGGGGCGGG + Intronic
1048182058 8:132204476-132204498 ATGGGGGACCAGAATGAGGCTGG - Intronic
1048208238 8:132432689-132432711 GTGAGGGGGAAGAAGTAGGCAGG - Intronic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049767639 8:144362392-144362414 AGGAGGGAGCAGAAGTGGGGAGG - Intergenic
1049852926 8:144843733-144843755 ATGAGGAAGCAGCACAAGGAGGG + Intronic
1050271480 9:3950430-3950452 ATGAGGCTGGAGAAGTAGGCGGG - Intronic
1050337087 9:4599977-4599999 GTGAGGGAGCAGGAATAGGAAGG - Intronic
1050431558 9:5567679-5567701 ATGAGTGAGTAGCACTATGCTGG - Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1053433328 9:38058399-38058421 ATGAGGGAGAAGAGCCAGGATGG - Intronic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1055852321 9:80646555-80646577 AGGAGGGAGAAGAAAAAGGCAGG - Intergenic
1056590653 9:87963695-87963717 ATGAGGCTGCAGGAGTAGGCAGG - Intergenic
1056832871 9:89930916-89930938 ATGAGGGAGGGAAACTATGCTGG + Intergenic
1059398431 9:114053552-114053574 ATGAGGGAGAAAAACTTGCCAGG - Exonic
1060190367 9:121588648-121588670 AGAAGGGAGCAGGACTGGGCAGG + Intronic
1060258524 9:122053608-122053630 ATAAGGAAGCTGACCTAGGCTGG + Intronic
1061231915 9:129320317-129320339 ATGAGGCAGCAGACCTGGGAGGG + Intergenic
1186444710 X:9617314-9617336 CTCAGGGAGCAGAACAGGGCAGG + Intronic
1187019902 X:15370100-15370122 GTGACGGACCAGACCTAGGCAGG - Intronic
1188976338 X:36680839-36680861 ATGAGTGAGCATACCTAGGTGGG - Intergenic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1192427806 X:71092848-71092870 ATGTTGGAGCAGAAGAAGGCAGG + Intergenic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1196032200 X:111103096-111103118 ATGAGGGAGCAGTAGCAGGTGGG + Intronic
1196108194 X:111918334-111918356 GTGAGGGAGGAGAAGTTGGCAGG + Intronic
1196918180 X:120560839-120560861 AGGAGTGAGCAGAACGAGGGGGG + Intronic
1197169347 X:123413866-123413888 TTGAGAGAGCAGAACTAGGAAGG + Intronic
1197634904 X:128903976-128903998 ATGAACAAGCTGAACTAGGCTGG - Intergenic
1198155451 X:133955413-133955435 AGGAGGGAGCTGAAGGAGGCCGG - Intronic
1199326919 X:146510191-146510213 AGGTGGGAGCAGAAATAGGTGGG - Intergenic
1199570249 X:149260439-149260461 ATGAGGGAGCTGACCTGGGTTGG - Intergenic
1200090299 X:153632860-153632882 AGAAGGGAGCAGGGCTAGGCCGG + Intergenic
1200146749 X:153930325-153930347 GTGAGGCAGCAGGGCTAGGCAGG + Intronic