ID: 935239961

View in Genome Browser
Species Human (GRCh38)
Location 2:101169658-101169680
Sequence GACTCACGGTTCCACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935239961_935239966 16 Left 935239961 2:101169658-101169680 CCAGCCACGTGGAACCGTGAGTC 0: 11
1: 635
2: 4748
3: 7908
4: 8118
Right 935239966 2:101169697-101169719 TTTTATAAATTGCCCAGTCTTGG 0: 63
1: 1386
2: 5271
3: 5350
4: 3641
935239961_935239967 17 Left 935239961 2:101169658-101169680 CCAGCCACGTGGAACCGTGAGTC 0: 11
1: 635
2: 4748
3: 7908
4: 8118
Right 935239967 2:101169698-101169720 TTTATAAATTGCCCAGTCTTGGG 0: 125
1: 3745
2: 13076
3: 15273
4: 11785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935239961 Original CRISPR GACTCACGGTTCCACGTGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr