ID: 935251265

View in Genome Browser
Species Human (GRCh38)
Location 2:101263564-101263586
Sequence CTGTGTGCTTTGAATTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935251264_935251265 0 Left 935251264 2:101263541-101263563 CCTGGCATCTGTTTTATAGGCTT 0: 1
1: 0
2: 0
3: 19
4: 152
Right 935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 221
935251262_935251265 8 Left 935251262 2:101263533-101263555 CCACTCTACCTGGCATCTGTTTT 0: 1
1: 0
2: 2
3: 54
4: 754
Right 935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935251265 Original CRISPR CTGTGTGCTTTGAATTATGA AGG Intronic
901567041 1:10125515-10125537 CTGTGCTCTTTAAATTATTAAGG + Intronic
902262672 1:15238547-15238569 CTTTGTCCTTTGACTTATGGTGG - Intergenic
905330507 1:37192190-37192212 CTATTTATTTTGAATTATGATGG + Intergenic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
908425963 1:64007610-64007632 ATGTTTGCTTTGATTCATGATGG + Intronic
910376227 1:86574890-86574912 CTGTGTCCTTAAAACTATGATGG + Intronic
911037162 1:93563113-93563135 CTGTGGAGTTTGATTTATGATGG + Intronic
913489871 1:119368922-119368944 CTGTGTGCTTGGAACTGAGAAGG + Intronic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
914865521 1:151424791-151424813 CTGTGTACTTTGGAATGTGATGG - Intronic
915038849 1:152950790-152950812 CTGTCTCCTCTGAATTCTGAGGG - Intergenic
916150986 1:161790217-161790239 CTGTGTGTTCTGACTTAAGAGGG + Intronic
917457339 1:175196337-175196359 CTGTGGCCTTTGCTTTATGAAGG + Intergenic
918805396 1:189034579-189034601 GAATGTGCTTTGAAATATGAAGG - Intergenic
918859169 1:189799313-189799335 GTGTTTGTTTTGAAATATGAGGG + Intergenic
921195905 1:212757544-212757566 CAGTGAGCTTTCAATCATGATGG + Intronic
921359535 1:214317842-214317864 CTGTGTGCATAGTATTATCAGGG + Intronic
922592988 1:226792598-226792620 CCCTGTGCTGTGGATTATGATGG + Intergenic
922664505 1:227456979-227457001 CTGGGTGCTGGGAATAATGAAGG - Intergenic
1063052149 10:2463645-2463667 GTGTATGCTTTGAATTAGAATGG - Intergenic
1063350876 10:5353606-5353628 CTGTGTGCTTTGAAATCAGGAGG - Intergenic
1065166860 10:22988604-22988626 CTGAGTGCAGTGAATGATGATGG + Intronic
1068831169 10:61496644-61496666 CTAAGTGCTTTGAATAATGGAGG - Intergenic
1069279345 10:66635064-66635086 CTGTGTGATGTAAATTATAATGG + Intronic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1071129783 10:82377560-82377582 CTGTTGGCTTTGAATTTGGAAGG - Intronic
1072456439 10:95580396-95580418 CTGTGTGCTTTTATTTTTAAGGG - Intergenic
1073965220 10:108981138-108981160 CAGTGTGCATTGAATCATGAGGG - Intergenic
1077842294 11:5988158-5988180 CAGTGGACTTTGAATTTTGAAGG - Intergenic
1078076204 11:8163245-8163267 CTGAGTGTTTTTCATTATGAAGG - Intronic
1078597192 11:12697674-12697696 CTCTGTGCTTTAAATTGAGAGGG + Intronic
1078911971 11:15740795-15740817 CTGTGTGATTTGAAGAATGGTGG + Intergenic
1079397947 11:20082245-20082267 CTCTGTGCTTTAAATTTTGGGGG - Intronic
1081139624 11:39482842-39482864 TTGATTGCTTTGAATTATGAAGG - Intergenic
1081677841 11:44981258-44981280 CTGTGTGCTTTGGCGTCTGATGG - Intergenic
1081690090 11:45072089-45072111 GTGTGTGAGTTGAATTATGGTGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082645439 11:55719326-55719348 TAGTGTGTTTTTAATTATGAAGG - Intergenic
1085148093 11:74222203-74222225 TTGGGTCCTTTGAATTTTGATGG + Intronic
1085432390 11:76464166-76464188 CTATGTGCTTGGCATTATGCTGG + Intronic
1088105193 11:106198993-106199015 CTGGGTGCTATGAATTTTTATGG + Intergenic
1088498881 11:110461961-110461983 CTGTGTGGTTTTAATTATCTAGG + Intronic
1089121131 11:116136160-116136182 CTGTGTTCTTTGCATTTTAATGG - Intergenic
1090232517 11:125118811-125118833 CTGTGTGCTTTGAATTGTTCTGG + Intergenic
1091761772 12:3092324-3092346 CTGTGTGCTTTGATTCCTCAAGG + Intronic
1094621866 12:32087533-32087555 CTGTGTGTTTTGCAATATGCGGG - Intergenic
1095326324 12:40897818-40897840 CTAAGTGCTTTGGTTTATGAAGG - Intronic
1096196806 12:49653859-49653881 CTGTGTGCCTTGACTTCTGGGGG + Exonic
1097631211 12:62065078-62065100 CTGTGTGATTTTAATCTTGAGGG - Intronic
1098104885 12:67059173-67059195 CTGTTTTCTCTGAATCATGATGG - Intergenic
1100298763 12:93287625-93287647 CTGTTTGCTTTGAATTCTAGGGG + Intergenic
1101804473 12:108051427-108051449 CTGTGTCCTGTAAATTCTGAGGG - Intergenic
1105401705 13:20102004-20102026 CTGTGTGATTTGGATTAATAGGG + Intergenic
1105548087 13:21366279-21366301 CTATGTGGTTTGAATGATGGTGG + Intergenic
1105658490 13:22466823-22466845 CTTTCTTCTTTGAATTAGGAAGG + Intergenic
1106189019 13:27434300-27434322 CTGTGTGCTTTAAAGTAAAAGGG + Intronic
1106936846 13:34731722-34731744 CTGTATCCTTTTCATTATGAGGG + Intergenic
1106955457 13:34933453-34933475 CACTGTGGTATGAATTATGAGGG + Intergenic
1109236828 13:59831767-59831789 CAGTGTTCTTTGGAATATGAAGG + Intronic
1110579571 13:77105213-77105235 ATGTGTGCTTCCAATTAAGATGG - Intronic
1113058767 13:106298723-106298745 CTGTGGGCTTTCATTTCTGAGGG + Intergenic
1113189270 13:107725339-107725361 TGATGTGCTGTGAATTATGAGGG + Intronic
1113272369 13:108687340-108687362 CTGTGTGATTATAATTATGTAGG - Intronic
1114255189 14:20995762-20995784 CTATGTCCTTTGAATTAAGCTGG - Intronic
1116826789 14:49680718-49680740 CTGTGTACATTGATTTAAGATGG - Intronic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117115945 14:52512348-52512370 CTTTGTGCTTCAAATTAGGAAGG + Intronic
1117230688 14:53715064-53715086 CTGTGTCCTTTGGCTTGTGAGGG - Intergenic
1118509275 14:66452864-66452886 CTCTGTGCTTTGATTAATGTGGG - Intergenic
1119371304 14:74146543-74146565 CTGTGGGCTTTCTACTATGAAGG - Intronic
1119688484 14:76652321-76652343 CTGTGTACTGTGAATTATGTTGG + Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1125151064 15:36532794-36532816 CTGTGTGCTTTAAGTAACGAAGG - Intergenic
1125321074 15:38489340-38489362 CTGTGAGTTTTCTATTATGAAGG - Exonic
1126202374 15:46001670-46001692 CAGTGTGCTTTGACACATGAGGG + Intergenic
1127132367 15:55880849-55880871 CTGTGTGCTGGGTATTATGCAGG - Intronic
1130811960 15:87389211-87389233 CTGTGTGATTCGATTTATGCAGG + Intergenic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1134090294 16:11387996-11388018 CTGTGAGATTTGAATGATCAGGG + Intronic
1138784354 16:59828830-59828852 CTGTGTGCTTAGGATGATGAAGG + Intergenic
1138871322 16:60890963-60890985 CTCTTGGCTTTGAATTATGAAGG - Intergenic
1139236725 16:65347385-65347407 CTGTGTGCCTAGAATTGTGCTGG + Intergenic
1140468656 16:75202325-75202347 CTGAGTGCTTTTTATCATGAAGG - Intergenic
1140872428 16:79119724-79119746 CTGTTTGGTTTGAATCATGATGG + Intronic
1142052994 16:87972394-87972416 CAGTTTGTTTTGAATTATCAGGG + Intronic
1142656582 17:1398932-1398954 CTGGGTTTTTTGAGTTATGAAGG - Intronic
1143071567 17:4299664-4299686 TTGTGTGCTTTAAATTTTTAGGG - Intronic
1144370417 17:14584899-14584921 CTGAGTACTTTGAACTAAGAGGG - Intergenic
1146812083 17:35911836-35911858 CTGTGATCCTTGAATTATGGAGG - Intergenic
1149271354 17:54981543-54981565 ATCTGTGCTTTATATTATGATGG + Intronic
1150224345 17:63515292-63515314 CTGTATTCTTTGAATGATGGAGG - Intronic
1152992824 18:378336-378358 CTGTCTACTTTTATTTATGACGG - Intronic
1153244692 18:3062140-3062162 CTGTTTGCAATAAATTATGAAGG - Intergenic
1153336029 18:3925639-3925661 CTGTGTGCCCGGAAGTATGAAGG - Intronic
1153704341 18:7729692-7729714 CTGTGTGCTTTGAAATGATAAGG - Intronic
1153782223 18:8504768-8504790 CTGTGTGTTTTGCTTTATGTTGG - Intergenic
1156992628 18:43427790-43427812 TTGTGTGTTTTGATTCATGATGG + Intergenic
1157177654 18:45465981-45466003 CTGAGTGCTTTAAATAATGCTGG + Intronic
1158645253 18:59240360-59240382 CTGTGTACTTGGGACTATGATGG - Intergenic
1164290109 19:23860196-23860218 ATGATTGCTTAGAATTATGATGG - Intergenic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1166538522 19:43591209-43591231 CAGTGGGCTTTGAATCTTGATGG - Exonic
928707744 2:33968918-33968940 CAGTGCTCTTTGACTTATGATGG + Intergenic
930433138 2:51306033-51306055 CTGTATGCTTAGAACTATGCTGG - Intergenic
931181275 2:59903399-59903421 TTGTGTGCTTTGTATTGTGTTGG - Intergenic
931663987 2:64596993-64597015 GTGAGTGATTTGGATTATGAAGG - Intergenic
933076157 2:77929668-77929690 CTGAGTGCTTTTAATCATGAAGG + Intergenic
933796634 2:85925152-85925174 ATGTGTGGTGTGTATTATGAAGG - Intergenic
935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG + Intronic
937609085 2:123839362-123839384 CTGTGAGCTTTAAATCAAGAAGG + Intergenic
938457988 2:131479271-131479293 GTGTGTGCTGTGAATTTTTAAGG - Intronic
940042565 2:149375882-149375904 CTGTATGCTTTGCATATTGATGG - Intronic
941246012 2:163098525-163098547 CTGTTTTCTTTCTATTATGAGGG - Intergenic
941925426 2:170889518-170889540 CTGGGAGCTTAGAATTATCAAGG - Intergenic
943586831 2:189750721-189750743 CTATTTGCTTAGAATTCTGATGG + Intronic
943989720 2:194672209-194672231 CTGTTTGTTTTCAATTAGGAAGG - Intergenic
944424420 2:199564676-199564698 TTCTGGGCTTTGTATTATGATGG + Intergenic
945779139 2:214146243-214146265 CTGTGTAGTTTGAGTTTTGAGGG - Intronic
946105542 2:217366309-217366331 CTGTGTGCTGGGAATTCAGAAGG - Intronic
946588221 2:221214808-221214830 CTTGGTGCTTTGACTAATGATGG - Intergenic
946607800 2:221424914-221424936 CTGTGTGCTTTCCATCACGAAGG - Intronic
946753839 2:222922426-222922448 CTGAGTGCTTTTAAGTAGGACGG + Intronic
947188318 2:227473373-227473395 CTGTGTGATTCTAAATATGATGG + Intronic
947271428 2:228340606-228340628 CTATGCCCTTTGAATTATGAGGG + Intergenic
947370401 2:229439959-229439981 CTGAATGATTTGAATTTTGAGGG + Intronic
1168737697 20:157380-157402 CTGTGAGCTTTGCATCATGCAGG - Intergenic
1170545560 20:17433088-17433110 CTGTGTGCTTTGGTTTAAAAAGG - Intronic
1170599457 20:17829929-17829951 CTGAATGCTTTGAAATATCAGGG + Intergenic
1170687001 20:18578230-18578252 ATGTTTGCTTTGAAGTATGCTGG - Intronic
1173057498 20:39629716-39629738 CTATGTGCTTTAGATTATGTAGG + Intergenic
1174061172 20:47834035-47834057 CTGTGTCCGTTGAAGTTTGAGGG - Intergenic
1174070604 20:47896664-47896686 CTGTGTCCATTGAAGTTTGAGGG + Intergenic
1175726491 20:61322176-61322198 CTGTGTGCTTTGCACTCTGCTGG + Intronic
1178154370 21:29833806-29833828 GTGTGTGCTGTGAAATCTGAAGG - Intronic
1180015765 21:45082323-45082345 AAGTGTACTTTGAATTTTGAAGG - Intronic
1180657764 22:17437663-17437685 ATGTATGCTTTGACTTATCAAGG + Intronic
1182675170 22:32033674-32033696 CTATGTGCCTGGAATTTTGAAGG + Intergenic
1182683965 22:32106415-32106437 CTGAGTGCTGTCAAATATGAGGG - Intronic
1184355098 22:43974510-43974532 CTGTGTGCTCTGAGTTCTCATGG - Intronic
951837463 3:26999069-26999091 CTGTGTGCTTGGGATTCTTAGGG + Intergenic
953643453 3:44730634-44730656 CAGTGTTCTTTGCATTAGGAGGG + Intronic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
955069895 3:55563610-55563632 CTTTCTGCTTTGGATTCTGAAGG - Intronic
955566873 3:60256730-60256752 ATGTATGATTAGAATTATGATGG - Intronic
955628149 3:60942261-60942283 CTGTATACTTTTAATTATGCTGG - Intronic
957360497 3:79150391-79150413 ATGTGTGTTTTGAATTTTGCAGG + Intronic
957389870 3:79550378-79550400 CCATGTGCTTTGACTTATCATGG - Intronic
957750323 3:84406733-84406755 CTGTTTGCTTTGCATTTTGTAGG - Intergenic
961859786 3:129906658-129906680 CTCTGTGATTTCAATGATGATGG + Intergenic
964419924 3:156491036-156491058 CTTTTTGCTTAGAATTTTGAAGG - Intronic
964521258 3:157571011-157571033 CTCTGTGCTATGAATGAAGACGG + Intronic
965073307 3:163943259-163943281 CTGTGTGGTATGATTTCTGAGGG - Intergenic
965190952 3:165529089-165529111 CTGCATGATGTGAATTATGAAGG + Intergenic
967713282 3:192734117-192734139 CTGTGTATTTGGAATTTTGAGGG - Intronic
968946621 4:3668238-3668260 CTGTGTGGATTGCATTAGGATGG - Intergenic
970289797 4:14559839-14559861 TTGTGTCCTTTGAATTCTTATGG + Intergenic
970534166 4:17012124-17012146 ATGTGAGCTTTGAATAATAAGGG + Intergenic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
971463676 4:26930737-26930759 CAGTGTGTTTTGAATTATGTGGG + Intronic
971605815 4:28655696-28655718 CTGTGTGCTTTGTACTTTTAAGG + Intergenic
973260027 4:48153818-48153840 GTGTATGCCTTGCATTATGAAGG - Intronic
974765503 4:66339637-66339659 CTTTGTGCTCTGTGTTATGAGGG - Intergenic
976177655 4:82371706-82371728 CTTTGCGATTTGAATTATCAGGG + Intronic
978925930 4:114244168-114244190 CTGTGAGCTTTGAATTTTTGTGG + Intergenic
979785360 4:124711157-124711179 ATGAATGCTTTGAATTAAGAAGG - Exonic
979791416 4:124786356-124786378 CAGTTTGCTTTTAATAATGAAGG + Intergenic
979903064 4:126248018-126248040 CTGTGTTTTTTAAATTATGAAGG + Intergenic
984176427 4:176423988-176424010 TTGTTTGCTCAGAATTATGAGGG - Intergenic
986302757 5:6491138-6491160 CTGTGTGTTTTTAATAAAGATGG + Intronic
988897534 5:35693579-35693601 CTGTGTGCTCTGCAGAATGAAGG - Intronic
991445259 5:66692843-66692865 CAGTGTGCTTTGAAGTAGGTTGG + Intronic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
992404555 5:76444624-76444646 CTGAGTGCTTGGAATTATGAAGG + Intronic
998259987 5:140623027-140623049 CTTTCTGCTTTGAATTCTCAAGG + Intergenic
1000547162 5:162617667-162617689 CTATGTATTTTGAATTGTGAAGG + Intergenic
1000551628 5:162673117-162673139 CTGTGTGGTTTAAATTGTCAGGG - Intergenic
1000983149 5:167838498-167838520 CTGTCTGCTTGGAACTCTGAGGG + Intronic
1001862832 5:175073578-175073600 ATGTATGCTTACAATTATGAAGG - Intergenic
1002996411 6:2289607-2289629 CTCTGTTCTTTTAATTTTGATGG - Intergenic
1003419927 6:5948082-5948104 CTGAATGCTTTGAATTAATAAGG - Intergenic
1003683079 6:8275023-8275045 CTCTGTTCCTTGAACTATGATGG + Intergenic
1004642240 6:17526654-17526676 CTGTGTGTTCTGTTTTATGAAGG - Intronic
1005163157 6:22888758-22888780 CTGTGTGATTTGACTTTGGAAGG + Intergenic
1007018248 6:38491265-38491287 ATATGTGCTTTGAAGTATTAAGG + Intronic
1008364786 6:50665212-50665234 CTGTGTGCATTGATGTATTAGGG - Intergenic
1010817618 6:80377011-80377033 TAGTGTCCTTTGAATTATAAAGG + Intergenic
1010841820 6:80655280-80655302 GTGTGCTCTTTGACTTATGAGGG + Intergenic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1012771929 6:103449112-103449134 TTGTGTGGTTTGAATAATGATGG + Intergenic
1012840463 6:104323099-104323121 ATGTGTGCTTTGCAATATGCTGG - Intergenic
1013022904 6:106237272-106237294 TTGTGTGATTTGAATTTTAAAGG - Intronic
1016260545 6:142164526-142164548 CTGTGTGTTTTTAATTTTAATGG - Intronic
1017993770 6:159512774-159512796 CTCTGTGCTTTGTATTCTCAAGG - Intergenic
1018862845 6:167723480-167723502 ATGTGTACTGTGAATTATGCAGG - Intergenic
1020874877 7:13680657-13680679 GTGTGTACTTTGAACTTTGATGG + Intergenic
1021434519 7:20599187-20599209 CTGTGGGCTTTGGCTTCTGAGGG + Intergenic
1022351247 7:29567338-29567360 CTGCCTGCTTTTAAGTATGATGG - Intergenic
1022944765 7:35271437-35271459 CTGTGTGCTATGATTCATCAGGG - Intergenic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1027428266 7:78083483-78083505 CTGTGTGCACTGCATTATGTGGG + Intronic
1031550923 7:123110475-123110497 CTGTGAGCTTTGATTCAGGAAGG - Intergenic
1031904483 7:127446075-127446097 CTGTGAGCTTTAATTTAAGAAGG + Intergenic
1036742617 8:11378209-11378231 ATCTGTTCTTTGACTTATGATGG + Intergenic
1036926391 8:12909842-12909864 CCCTGTGCTTTGAATTTTGAGGG + Intergenic
1036926473 8:12911172-12911194 CTCTGGGCTTTGAATTTCGAGGG + Intergenic
1037332562 8:17757944-17757966 CTGTGTGATTTATATTCTGATGG + Intronic
1037650140 8:20829029-20829051 CTGTGTGTGTTGGATTATGTGGG + Intergenic
1038620082 8:29134228-29134250 CTCTGTGTTTTGAAATCTGAGGG + Intronic
1039026000 8:33258777-33258799 CTTTGTCCTCTGAATTTTGATGG + Intergenic
1039111074 8:34041080-34041102 GTGAGTTCTTTGAATAATGAAGG - Intergenic
1042752571 8:72174339-72174361 TGGTGTGCTTGGAGTTATGATGG - Intergenic
1044163056 8:88944960-88944982 CAATGTGATTTGAAGTATGAAGG + Intergenic
1044200932 8:89435473-89435495 GTGTGTATTTTGAAATATGAAGG - Intergenic
1045394242 8:101744744-101744766 CTGTGTGCCTGGAAGTATAAAGG - Intronic
1048226665 8:132594467-132594489 CTGTCTCCTTTGTATTATGCAGG - Intronic
1050687583 9:8189676-8189698 CTGTGAGCTTTAATTTAAGAAGG + Intergenic
1052353853 9:27484360-27484382 CTGTTTGCTTTCAGTTATAATGG + Intronic
1052579876 9:30341448-30341470 CTGGGTGTTTTGACTTAAGAAGG + Intergenic
1055120753 9:72658071-72658093 CTGTGTACTTTTAATTTTAATGG + Intronic
1055779902 9:79809227-79809249 CTGTGTGCTTAGAAGTGTGTTGG + Intergenic
1058770508 9:108226748-108226770 CAGTGTGCTTTGGATTTGGATGG + Intergenic
1186051081 X:5596384-5596406 CCATGTGCTTTGAATTTTGGGGG + Intergenic
1186981162 X:14959080-14959102 CTGTGTGTTGTGAAAGATGATGG - Intergenic
1187303963 X:18078215-18078237 CCGTGTGGTTTGGATTATGAAGG + Intergenic
1187814914 X:23220993-23221015 CTATGTGTCTTCAATTATGAAGG - Intergenic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1189835717 X:45019746-45019768 ATGTCTACTTTGAATTTTGAAGG - Intronic
1190517875 X:51243534-51243556 CTGTGTGCTCTGGGTTGTGAGGG + Intergenic
1193550947 X:82892234-82892256 CTGTGTGCTTTAATTCAAGAAGG + Intergenic
1193580112 X:83253381-83253403 CTGTGTGCTTTCAGAGATGAAGG - Intergenic
1194416281 X:93616360-93616382 GTGTGTGTTTTGACTTATGGAGG - Intergenic
1195833469 X:109086277-109086299 CTGTATTCTTTGATTTTTGAAGG + Intergenic
1196939122 X:120758535-120758557 CTCTGTGCTTTACATTAAGAAGG + Intergenic
1197576086 X:128213189-128213211 CTGTGTTCTGTGAAGAATGATGG - Intergenic
1199860750 X:151798734-151798756 CTGTGTGTCTGGAATTAGGAGGG + Intergenic
1200403827 Y:2788477-2788499 CTGTGACCTTTAAATTTTGAAGG - Intergenic
1200826406 Y:7648736-7648758 CTAAGTGCTTTGCATTATCATGG - Intergenic
1201700720 Y:16878680-16878702 CTCTGTGATTTCAATGATGATGG + Intergenic