ID: 935251975

View in Genome Browser
Species Human (GRCh38)
Location 2:101271049-101271071
Sequence CGTTCCTGACGGAGGCTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935251975_935251982 -4 Left 935251975 2:101271049-101271071 CCGTCCAGCCTCCGTCAGGAACG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 935251982 2:101271068-101271090 AACGTGCGGGTCAGGCAGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935251975 Original CRISPR CGTTCCTGACGGAGGCTGGA CGG (reversed) Intergenic
900089020 1:911223-911245 CGCCCCAGAGGGAGGCTGGAAGG - Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903077245 1:20780814-20780836 AGTTCCTGATGGTGGCAGGAGGG - Intronic
903839433 1:26227783-26227805 CTTTCCTGCAGGAGCCTGGATGG + Intergenic
905702182 1:40025802-40025824 CCTGGCTGACTGAGGCTGGAAGG - Intergenic
910439644 1:87239527-87239549 CATTCCTGAAGTCGGCTGGAGGG - Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
911504665 1:98733721-98733743 CGTTCCTAACGCAGACTAGATGG + Intronic
924214754 1:241809523-241809545 CGTTCCTGCTGGAGGCTCCAGGG - Intergenic
1066317144 10:34259352-34259374 AGTTCCTTCCGGAGGCTCGAGGG + Intronic
1072711474 10:97718375-97718397 TGTCCCTGATGGAGGCTGGAGGG + Intergenic
1076377580 10:130001985-130002007 CGGTCCTAACGGAGGCTCAAGGG + Intergenic
1077581068 11:3417707-3417729 CTTTCCTGACTGATGCAGGATGG - Intergenic
1086941280 11:92800972-92800994 CGATCCTGACAATGGCTGGATGG + Exonic
1088903956 11:114139984-114140006 CGTTCTTGACCGAGGACGGAAGG - Intronic
1090326162 11:125887930-125887952 CGTTCCTGAGGGAGGCGGCCGGG + Intronic
1090989986 11:131808400-131808422 CTTTGCTGAAGGTGGCTGGAAGG - Intronic
1091847211 12:3666577-3666599 AGTTCCTGTGGGAGGCTGGCAGG - Intronic
1092767889 12:11869723-11869745 CTCTCCTGCCGGGGGCTGGATGG - Exonic
1096094102 12:48923392-48923414 CTTCCCTGATGGAGGCTGAAAGG + Intronic
1101898061 12:108770407-108770429 GCCTCCTGATGGAGGCTGGAAGG - Intergenic
1103058637 12:117841334-117841356 CGGTCCTGAGGGAGGATGGGAGG - Intronic
1103972967 12:124683543-124683565 GCTGCCTGGCGGAGGCTGGAAGG - Intergenic
1104254773 12:127126396-127126418 TGTTCCTGTCGGAGGCTCCAGGG + Intergenic
1104288020 12:127443177-127443199 CGTTTCTGCCGGAGGCTCTAGGG - Intergenic
1106083870 13:26523167-26523189 CGTTCCTGACAGTGGCTCCACGG + Intergenic
1106457126 13:29937303-29937325 CTTTCCTGATGGAGCCTGGCAGG - Intergenic
1108808253 13:54186646-54186668 CATTCCTGGTGGGGGCTGGAGGG - Intergenic
1118325681 14:64778895-64778917 TGTGCCTGATGGAGGCTGAATGG + Intronic
1121091983 14:91189211-91189233 CTTTGTGGACGGAGGCTGGAGGG + Intronic
1124115487 15:26838989-26839011 GTTTTCTGAAGGAGGCTGGAGGG - Intronic
1124632174 15:31344239-31344261 CCCTCCTGACACAGGCTGGAGGG - Intronic
1128450592 15:67803946-67803968 CTTTACTGATGGAGGCTGCAGGG - Intronic
1130051107 15:80484729-80484751 CGTTGCTGACTCTGGCTGGAAGG + Intronic
1132893738 16:2217581-2217603 AGGTCCTGGCGGAGGCTGGGAGG + Intergenic
1134308737 16:13057128-13057150 CCTTCCTGCCTGGGGCTGGAGGG + Intronic
1134905848 16:17978874-17978896 CGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1139563674 16:67759454-67759476 GGTGCCTGACTGAGGCTGGTAGG - Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1143405970 17:6677436-6677458 GGAACCTGACTGAGGCTGGAGGG - Intergenic
1147849485 17:43430764-43430786 CTTCCCTGACAGAGGCAGGAAGG + Intergenic
1148847701 17:50538889-50538911 CGTCCCTGTGGGAGGCTGGGGGG - Exonic
1153322300 18:3785287-3785309 AGTTGCTTACGGATGCTGGAGGG + Intronic
1155221634 18:23690283-23690305 CGTGGGTGACGGAGGCGGGAAGG - Intronic
1160483513 18:79265065-79265087 GGGGCCTGTCGGAGGCTGGAGGG - Intronic
1161054960 19:2186237-2186259 CGTTCCTGCCTGAGGCTGCTGGG + Intronic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
927194555 2:20538684-20538706 CTTTCCTGATGGTGGCTGCAGGG + Intergenic
932908135 2:75776511-75776533 GGTTTCTGAAGTAGGCTGGAGGG + Intergenic
934502312 2:94870621-94870643 GCTGCCTGGCGGAGGCTGGATGG - Intergenic
935251975 2:101271049-101271071 CGTTCCTGACGGAGGCTGGACGG - Intergenic
937633519 2:124129821-124129843 TTTTCCTGACGGATGTTGGAGGG + Intronic
939958527 2:148546460-148546482 ACTTCCTGCCTGAGGCTGGAAGG - Intergenic
944684476 2:202105924-202105946 GGTTCCCGAGGGATGCTGGAGGG - Exonic
948371902 2:237494984-237495006 CATTCCAGCTGGAGGCTGGAGGG + Intronic
949036669 2:241818660-241818682 GGTTCCAGACGGGGGCAGGATGG + Intergenic
1169519458 20:6355532-6355554 TGTTCCTGCCAGAGGCTGTAGGG - Intergenic
1175105416 20:56611340-56611362 CTTTCCTGTGGGAGGCAGGAGGG + Intergenic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176623703 21:9074547-9074569 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1184172585 22:42768721-42768743 CATGCCTGAGGGTGGCTGGAGGG - Intergenic
1185327360 22:50233481-50233503 CTTACCTGACGGAGGCGGGAAGG - Exonic
949206045 3:1439911-1439933 CGTGCCTGGAGGAGCCTGGAGGG + Intergenic
950694828 3:14690815-14690837 CGTTCCTGAAGGTGGTGGGAGGG + Intronic
964623707 3:158739301-158739323 CTTTCCTGAGGGAGGCAAGATGG - Intronic
967472614 3:189880067-189880089 CATTCCTGAAGCAGGCTGAAAGG - Intronic
967894673 3:194386277-194386299 CATTCCTGCCGGAGGCTCCAGGG + Intergenic
971671006 4:29558133-29558155 CGTTCCTGATGGGAGCAGGAGGG - Intergenic
971689330 4:29812468-29812490 CATTCCTGCTGGAGGCTGTAGGG + Intergenic
976765151 4:88591857-88591879 CGGGCCTGGGGGAGGCTGGAGGG - Intronic
979945421 4:126825470-126825492 CGGTCCTGTCAGAGGGTGGAGGG + Intergenic
987023365 5:13898053-13898075 CTTTCCTGAGGAAAGCTGGAAGG - Intronic
988366445 5:30306463-30306485 TGTTCCCGATGGAGGATGGATGG - Intergenic
997612903 5:135227625-135227647 CCTTCCTGACAGTGGCAGGAGGG - Intronic
997715403 5:136038863-136038885 CATTCCTCACAGAGGCTGTAGGG - Intronic
1002382256 5:178839288-178839310 CCTGCCTGAGGCAGGCTGGAGGG - Intergenic
1002524638 5:179808101-179808123 GGTTCCTGGTGGAGGCTGCAGGG + Intronic
1004077636 6:12359308-12359330 AGTTCCTGGAGGAGGCAGGATGG - Intergenic
1008434341 6:51457452-51457474 CTTTCCAGAGGGAGGCTGGCTGG + Intergenic
1010378446 6:75201932-75201954 TGTCCCTGAGGGAGGCAGGATGG + Intronic
1011340885 6:86313167-86313189 TGTTCCTGGCAGAGGCTGCATGG + Intergenic
1017503023 6:155042920-155042942 AGTAACTGAGGGAGGCTGGAGGG - Intronic
1035812713 8:2505934-2505956 CTTTCCTGAAGGAGACTGCATGG + Intergenic
1041956843 8:63565761-63565783 TATTCCTGACGGAGGCTGGCAGG - Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1049454116 8:142678361-142678383 TGTTCCTGCCGGAAGCTGGTAGG - Intronic
1049796982 8:144501370-144501392 CATTCCTGACACAGGCAGGAGGG - Intronic
1050906494 9:11012345-11012367 GGTTCCTGACTAAGGCTTGATGG + Intergenic
1058947200 9:109868861-109868883 CATTCCTGAGGGAGGATGGAGGG + Intronic
1059853562 9:118369975-118369997 TGTTATTGACAGAGGCTGGAGGG + Intergenic
1060941110 9:127543343-127543365 CGATCAAGACAGAGGCTGGAAGG + Intronic
1061757374 9:132824433-132824455 TGTTCCTGAAGGAGGCACGATGG - Intronic
1062460054 9:136659259-136659281 CGGACCCGACGGGGGCTGGAGGG - Exonic
1203746888 Un_GL000218v1:44975-44997 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1188034242 X:25298849-25298871 TCTTCCTGACTCAGGCTGGATGG + Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1201160213 Y:11159989-11160011 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic