ID: 935251978

View in Genome Browser
Species Human (GRCh38)
Location 2:101271055-101271077
Sequence AGCCTCCGTCAGGAACGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935251978 Original CRISPR AGCCTCCGTCAGGAACGTGC GGG Intergenic
900337994 1:2174289-2174311 AGCCTCGGTCAAGGACATGCTGG - Intronic
906556521 1:46718739-46718761 GGCCTCCGTCCTGAACGTGAAGG + Exonic
913339843 1:117747615-117747637 ACCCTCAGTCAGGAACCTGAAGG - Intergenic
917704628 1:177619698-177619720 AGCCCAAGTCAGGAACGTGCAGG + Intergenic
919367985 1:196689540-196689562 AGACTCCGTCAGGAAGTTACTGG + Exonic
920130356 1:203727420-203727442 AGCCTCCTTCAGGAACTTCAGGG - Exonic
922573358 1:226646532-226646554 AGCCCCTGTCAGGAACCTGGGGG + Intronic
1062828702 10:590463-590485 AACCTCAGTGAGGAACTTGCTGG + Intronic
1073478780 10:103772456-103772478 AGCCTGAGTCAGGCCCGTGCTGG - Intronic
1093477799 12:19574232-19574254 AGCTTCCCTCAGGAACCTGGGGG + Intronic
1113561567 13:111285804-111285826 CTCCTCCCTCAGGAGCGTGCAGG + Intronic
1113814112 13:113159744-113159766 GGCCTCAGTCAGGAAAGTGGAGG - Intronic
1124628268 15:31322606-31322628 AGCCTCTGTCTAGAATGTGCTGG - Intergenic
1128450595 15:67803952-67803974 AGCCTCCATCAGTAAAGTGGAGG + Intronic
1130461298 15:84159750-84159772 AGCCTCCGTCAGCACAGAGCGGG - Intergenic
1132994126 16:2814149-2814171 AGCCTCCTTCAGGGAGGTGGAGG + Intergenic
1143808263 17:9448335-9448357 AGCCTCAGTTAGGAGTGTGCGGG - Intronic
1147621477 17:41870891-41870913 AGCCGCCGTCTGGGATGTGCTGG - Intronic
1154014873 18:10607475-10607497 AGCCTCCCACAGAGACGTGCTGG - Intergenic
1154190619 18:12228103-12228125 AGCCTCCCACAGAGACGTGCTGG + Intergenic
1160865147 19:1253009-1253031 CGCCTGCGTCAGGAAGGAGCTGG + Intronic
1166124457 19:40705404-40705426 GGCCTCCGACAGGAAGGGGCTGG + Exonic
1166688522 19:44809725-44809747 CGCCTCCCTCAGGAAAGGGCTGG + Intronic
934712666 2:96526198-96526220 AGCCTAGGTCAGGGACCTGCGGG - Intergenic
935251978 2:101271055-101271077 AGCCTCCGTCAGGAACGTGCGGG + Intergenic
936500931 2:113065760-113065782 TGCCTCCTTCAGGAATGTACAGG + Intergenic
937077430 2:119117438-119117460 GGCCTCCCTCAGGCACCTGCAGG + Intergenic
938797469 2:134730509-134730531 AGCCTCCGACAGGACGGAGCAGG - Intergenic
948830539 2:240596449-240596471 CGCGTCCTTCAGGAAGGTGCTGG - Exonic
1169191193 20:3660147-3660169 AGCCTCCTGCAGGTAGGTGCAGG - Exonic
1182443582 22:30377703-30377725 AGCCTCCCTCAGGAACTCCCAGG - Intronic
1184923128 22:47619819-47619841 AGCCTCCCTCAGGAGGGTGTGGG - Intergenic
950537028 3:13584650-13584672 AGCCTCCCTCAAGAAAGAGCAGG + Intronic
951903496 3:27680411-27680433 AGCTGCCTTCATGAACGTGCTGG - Intergenic
969297880 4:6280279-6280301 AGCCACCGACAGGCAGGTGCCGG - Intronic
976686832 4:87823053-87823075 AGCCTCCTTCTGAAACGTCCAGG - Intronic
990333370 5:54748805-54748827 AGCCCCCTGCAGGAACATGCAGG - Intergenic
991636534 5:68711384-68711406 ACCCTCCTCCAGGAAAGTGCAGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1008043146 6:46823208-46823230 AGACTCCCTCAGGCACCTGCTGG + Intronic
1032480304 7:132240741-132240763 AGCCACAGTCAGGAAAGTCCAGG + Intronic
1034691186 7:153015138-153015160 AGTCTCCTTCAGGAAAGTGCTGG - Intergenic
1036560578 8:9897985-9898007 AGCCTCAGTCAGGCACATCCTGG + Intergenic
1039356689 8:36825368-36825390 AGCCTTTGTCAGGTACATGCAGG + Intronic
1040103673 8:43526674-43526696 AGCCTCCGCCTGGAAAGAGCAGG + Intergenic
1047319482 8:123766251-123766273 AGCCTCAGTCAGGGACGTAAAGG + Intergenic
1048670032 8:136708129-136708151 ATCCTATGTCAGGAACGTGGTGG - Intergenic
1061260001 9:129474952-129474974 AGCCTCCCTTGGGAAAGTGCAGG + Intergenic
1062568810 9:137175170-137175192 AGCCCCCGTCAGGCACCTGCAGG + Intronic
1188259255 X:28003112-28003134 AGACTCCTTCAGGAAGGTGCTGG + Intergenic
1194190223 X:90826014-90826036 AGACTACATCAGGAACTTGCAGG - Intergenic
1200938407 Y:8758488-8758510 AGCCTGCTGCAGGAATGTGCAGG - Intergenic