ID: 935254734

View in Genome Browser
Species Human (GRCh38)
Location 2:101299721-101299743
Sequence CCATTACCACACAAAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935254734_935254739 22 Left 935254734 2:101299721-101299743 CCACGTTCTTTGTGTGGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 935254739 2:101299766-101299788 GTCTCACTTGAAGCAGGCAAAGG 0: 1
1: 0
2: 1
3: 4
4: 125
935254734_935254738 16 Left 935254734 2:101299721-101299743 CCACGTTCTTTGTGTGGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 935254738 2:101299760-101299782 ATTTATGTCTCACTTGAAGCAGG 0: 1
1: 1
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935254734 Original CRISPR CCATTACCACACAAAGAACG TGG (reversed) Intronic
911675295 1:100651911-100651933 CTATCACCACAGAAAGAAAGAGG - Intergenic
916401647 1:164455234-164455256 CAATAACAATACAAAGAACGTGG + Intergenic
917736183 1:177922504-177922526 CCAGAACCACACATAGAAAGTGG - Intergenic
1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG + Intergenic
1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG + Intergenic
1068718096 10:60210702-60210724 CCATTCCCACACACACAATGGGG + Intronic
1069430333 10:68329385-68329407 CCATAACCACACAAAATATGCGG + Intronic
1073667473 10:105550045-105550067 CCATAACAGCACAAAGAAGGTGG + Intergenic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG + Intergenic
1096570052 12:52517507-52517529 CCATGACGACACTAAGAATGGGG - Intronic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1110259430 13:73468514-73468536 CCATTAGCACACAAAAATTGAGG + Intergenic
1110487354 13:76062184-76062206 CCATTACTACACAAATACCTTGG - Intergenic
1113886334 13:113660535-113660557 CACTCATCACACAAAGAACGAGG + Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1120239164 14:81929665-81929687 GCAATACCACAGAAAGAACTTGG - Intergenic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1121079388 14:91095480-91095502 CCCTTACCAAAGAAAGAACATGG - Intronic
1134863338 16:17581192-17581214 CCATTTCCACAGAAAAAAAGAGG - Intergenic
1135422081 16:22312124-22312146 TCATCACCACAAAAAGAACCAGG - Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146284742 17:31566841-31566863 CCATCACCAGACACAGAAGGAGG - Intergenic
1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG + Exonic
1159524223 18:69567469-69567491 CCATTACCAAAAAAAAAATGAGG + Intronic
1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG + Intergenic
928897742 2:36284216-36284238 CCATTTCCCTGCAAAGAACGTGG + Intergenic
929178729 2:39009598-39009620 CCAATAATACACAAAGAAGGTGG + Intronic
931748615 2:65311967-65311989 CCGCTACCACAGAAAGATCGTGG + Exonic
934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
940588994 2:155696824-155696846 ACATTCCAACACAAAGAACAGGG + Intergenic
948982516 2:241501603-241501625 CGATAACCACACAAAGGAGGTGG - Exonic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1173433799 20:43014888-43014910 GCATTTCCACACAAAGTATGGGG + Intronic
1173802440 20:45902776-45902798 CCTTTGCCACACAAAGAAACAGG + Intronic
1176773634 21:13108113-13108135 CTATATCCAAACAAAGAACGTGG + Intergenic
1177621990 21:23607935-23607957 CCTTTACCTCCCAAAGAATGTGG + Intergenic
1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG + Intronic
1179326648 21:40352987-40353009 CTATTATCACCCAAAGTACGGGG - Intronic
1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG + Intronic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
961033656 3:123627437-123627459 CCATTACAACTCAAAGAAGTAGG + Intronic
964922553 3:161914929-161914951 CCATTACCACAGAATGAAGATGG + Intergenic
965148378 3:164937099-164937121 CCTTTACTAGTCAAAGAACGAGG + Intergenic
969151818 4:5176201-5176223 CCTTTCCCAGACAAAGAAAGGGG - Intronic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
975351214 4:73349601-73349623 CCATTAACATACCAAGAACCAGG + Intergenic
978949839 4:114544892-114544914 CCACTACAATACAAAGAATGAGG + Intergenic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
990053504 5:51539054-51539076 CCAAAACCAGACAAAGAACATGG - Intergenic
992120865 5:73590684-73590706 GCATTACCACACAAAGACTTTGG - Intergenic
993476535 5:88373269-88373291 CCATTACCACCCAAAGCCCTTGG - Intergenic
1000246009 5:159449071-159449093 CCATTACCACCCAAGGAGAGAGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006205562 6:32338672-32338694 CCAGTAACACTCAAAGAAAGAGG - Intronic
1017781177 6:157716497-157716519 CCAGTGCCACAGGAAGAACGTGG - Intronic
1019581437 7:1765488-1765510 CCATTGTCACACAAAGCACGAGG - Intergenic
1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG + Intronic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1033658354 7:143388029-143388051 CCAGCACCACACAAATAACAGGG - Intronic
1035897811 8:3423702-3423724 ACATTTCCACACAAAGACCTGGG - Intronic
1036383059 8:8251717-8251739 ACATTCCCACACAAAGAATAAGG - Intergenic
1036669510 8:10772060-10772082 CTAATCCCACAAAAAGAACGTGG - Intronic
1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG + Intergenic
1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG + Intronic
1042748007 8:72128232-72128254 ACATGAACACACAAAGAATGAGG - Intergenic
1042770949 8:72381981-72382003 CTAGTACCACACAAAGAAAAGGG - Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044443420 8:92246195-92246217 CCATTACCAAAAAAAAAAGGTGG - Intergenic
1053926972 9:43071188-43071210 TCATTTCCACACAAAGAAGATGG - Intergenic
1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG + Intergenic
1054388314 9:64585098-64585120 TCATTTCCACACAAAGAAGATGG - Intergenic
1188468553 X:30510898-30510920 CCTTAACAACACAAAGAACAAGG + Intergenic
1191226857 X:58053273-58053295 CCAGTACCACACTAAGCACAGGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1193647898 X:84090845-84090867 CCATTACTACAGAAACAAAGTGG + Intronic
1195292967 X:103446881-103446903 CCATCACTACACAGAGACCGAGG - Intergenic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic