ID: 935254738

View in Genome Browser
Species Human (GRCh38)
Location 2:101299760-101299782
Sequence ATTTATGTCTCACTTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935254734_935254738 16 Left 935254734 2:101299721-101299743 CCACGTTCTTTGTGTGGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 935254738 2:101299760-101299782 ATTTATGTCTCACTTGAAGCAGG 0: 1
1: 1
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935254738 Original CRISPR ATTTATGTCTCACTTGAAGC AGG Intronic
903095268 1:20966178-20966200 AATTATGTCTAACTCAAAGCAGG + Intronic
908626064 1:66043966-66043988 ATTTATGTCTCACTTGGTTATGG + Intronic
909964757 1:81895019-81895041 ATTTATTTCTCACTTTAAGTGGG - Intronic
910010713 1:82458238-82458260 TCTTATGTCTCACTTCAGGCAGG - Intergenic
910489270 1:87750551-87750573 ATTTATGGCTAAATTGAAGCTGG + Intergenic
910619222 1:89235093-89235115 ATTTATGTTTCTCTTTAAGCTGG + Intergenic
912607706 1:111009014-111009036 ATTTATGTCCCCCTCTAAGCTGG - Intergenic
915006196 1:152639322-152639344 TTTTATGTCTCACTTGTAAGTGG - Intergenic
919654375 1:200183030-200183052 ATTTCTCTGTCACTTGAGGCTGG - Intergenic
920239266 1:204532644-204532666 ATTTTTGTCTTACTTGAATTAGG + Intronic
920729972 1:208474214-208474236 ATTTTTCTTTCAATTGAAGCAGG - Intergenic
921054547 1:211534271-211534293 GATTAGGTCTCACTTGAAGATGG + Intergenic
921911641 1:220555334-220555356 ATTTATGTCTCAGTTTATTCTGG + Intronic
924051803 1:240086679-240086701 TTTTATGTTTCATTTGTAGCAGG + Intronic
1064509015 10:16068659-16068681 ATTTATGTAGCACTTGAACTTGG - Intergenic
1064588938 10:16868696-16868718 ATTTATTTCTCACATGCAGTGGG + Intronic
1064796036 10:19012342-19012364 ATTTATTTATTACTTTAAGCAGG + Intergenic
1065621440 10:27586272-27586294 ATTTATGGCTCGCTTTGAGCTGG - Intergenic
1066704346 10:38161554-38161576 ATTTATGTTTCATTTCCAGCTGG + Intergenic
1068410241 10:56645492-56645514 ATTTATGTTTCACTCTAAACTGG + Intergenic
1071340067 10:84637904-84637926 ATTTATGTTCCTCTTTAAGCTGG - Intergenic
1073791898 10:106949005-106949027 ATATTTGTGTCACTTGGAGCTGG - Intronic
1074817982 10:117157668-117157690 AATTTTGTCTCACTCAAAGCTGG + Intergenic
1074946633 10:118286339-118286361 AATTCTGTGTCTCTTGAAGCCGG - Intergenic
1080020498 11:27554603-27554625 ATTTATGTAGCACTTGAGGTGGG + Intergenic
1080247926 11:30200417-30200439 CTTTATGTCTTACTGGAAACTGG + Intergenic
1080401047 11:31935739-31935761 ATTTATGTATCGCTTCATGCAGG - Intronic
1080431027 11:32200021-32200043 AATTCTGTCTCACTCGGAGCTGG + Intergenic
1082105198 11:48214260-48214282 GTTTATGTCCTACTTGAAGATGG + Intergenic
1087121894 11:94583814-94583836 ATTGCTGTCTCACTGGTAGCAGG + Intronic
1093409462 12:18846706-18846728 ATTTACGTTTCACTTGAAGTAGG + Intergenic
1093482199 12:19615818-19615840 ATTTGTGTTACAATTGAAGCTGG + Intronic
1098708739 12:73726305-73726327 ATTAATGTCACACTTGAATCTGG + Intergenic
1099842824 12:87987837-87987859 GCTAATGTCTCACTTGAAGAGGG + Exonic
1100183192 12:92107576-92107598 ATTTATTTCTCATTTGCTGCAGG + Intronic
1100194190 12:92225452-92225474 ATAAATTTTTCACTTGAAGCTGG + Intergenic
1101435681 12:104662160-104662182 CTTGATGTCACACCTGAAGCAGG + Intronic
1105245207 13:18643970-18643992 ATTTATGTCTCACCTGAGTGAGG - Intergenic
1106053084 13:26209823-26209845 GTTAATGTCTCATTTGAAGATGG - Intronic
1106304717 13:28499136-28499158 ATTTGTGGATCATTTGAAGCGGG - Intergenic
1108496291 13:51028525-51028547 ACTGATGTCTGATTTGAAGCAGG - Intergenic
1109242564 13:59907870-59907892 ATTTATGTCTCTGTTGAAATTGG - Intronic
1109556676 13:63985224-63985246 AATTATGTCTCACTTAACGATGG + Intergenic
1117279637 14:54225751-54225773 GTATAGGTTTCACTTGAAGCAGG + Intergenic
1118956643 14:70488945-70488967 TGCTATGTCTCACCTGAAGCTGG - Intergenic
1120005459 14:79351835-79351857 ATTGGTGTCTCACTAAAAGCTGG + Intronic
1121418891 14:93798478-93798500 ATTTAGATGTCACTTGAATCTGG + Intergenic
1122496219 14:102157608-102157630 ATATTTGTCTCAATTGCAGCAGG + Intronic
1124381615 15:29172473-29172495 AATGATGTCTGACTTGGAGCAGG + Intronic
1124502157 15:30238171-30238193 TTTTATGTCTCGTTTGAATCTGG + Intergenic
1124741406 15:32300481-32300503 TTTTATGTCTCGTTTGAATCTGG - Intergenic
1126413397 15:48394678-48394700 GTTTAAGTCTCACTTCAACCAGG + Intergenic
1128882370 15:71255612-71255634 AATTCTGTCCCACATGAAGCAGG - Intronic
1131737924 15:95353845-95353867 ATTTATATCTCATTCTAAGCAGG + Intergenic
1138206918 16:55132123-55132145 ATTTGTCTCTCAGTTGAGGCAGG + Intergenic
1138365004 16:56468141-56468163 TTCTATGTTTCACTTGAAGAAGG - Intronic
1140612584 16:76619128-76619150 ATTCATGTCTCACTCCAATCTGG - Intronic
1140864868 16:79051152-79051174 ATATATGTGTGACTTGAAGTTGG + Intronic
1145773800 17:27512323-27512345 ATTTATGTTCCACTGGAAACTGG - Intronic
1149028954 17:52062612-52062634 ATTTGTGCCTCACCTGGAGCTGG - Intronic
1150364984 17:64574281-64574303 CTTTATGTCTCACTGGGAGCTGG + Intronic
1154505647 18:15038212-15038234 ATTGATGTCTCAGTTCAAGTAGG - Intergenic
1156870704 18:41941928-41941950 TTTTATGTATCATTTGAACCTGG - Intergenic
1156878360 18:42044334-42044356 ATTTATGTCTAACTTCACGAAGG + Intronic
1158036169 18:53033315-53033337 CGTTAAGTCTCACTTGAAGCTGG - Intronic
1158177595 18:54674888-54674910 ATTTATGAATCACTTGAACCCGG + Intergenic
1159521924 18:69537153-69537175 TTTTATGTCTTACTTGAATAGGG - Intronic
926804179 2:16689275-16689297 ATTTATTTCCCACTTGAAAAAGG + Intergenic
930195652 2:48507331-48507353 ACTTACGTCTCAGTTGCAGCTGG + Exonic
930875728 2:56213462-56213484 ATTTGTGTGTAACTTGGAGCAGG + Intronic
934578838 2:95421790-95421812 ATTTATGGCTCAAATGAAGTCGG + Intergenic
934600609 2:95654913-95654935 ATTTATGGCTCAAATGAAGTCGG - Intergenic
935254738 2:101299760-101299782 ATTTATGTCTCACTTGAAGCAGG + Intronic
937527767 2:122791742-122791764 TTTTACATCTCACTTGAAACAGG - Intergenic
938504837 2:131868480-131868502 ATTGATGTCTCAGTTCAAGTAGG - Intergenic
938986403 2:136580657-136580679 TTTTGTGTCTCACATGTAGCAGG - Intergenic
940376029 2:152959932-152959954 GTTGATGTTTCACTTGAATCAGG - Intergenic
946187501 2:217989294-217989316 TTTTAAGTCCCACTGGAAGCTGG + Intronic
947205957 2:227661368-227661390 ATTTATTTCTCACTGGAGACAGG - Intergenic
947227666 2:227855923-227855945 ATTTATTTCTTTCTTGAAGCAGG - Intergenic
947347035 2:229202594-229202616 ATTTATGCCTTACCTGAGGCTGG - Intronic
1170745409 20:19094379-19094401 GTGTGTGTCTTACTTGAAGCAGG - Intergenic
1173108131 20:40157746-40157768 ATTTATATCTCACTTGAAGCAGG + Intergenic
1175019714 20:55832011-55832033 ATTCATGTATCCTTTGAAGCTGG + Intergenic
1176285689 21:5018231-5018253 ATTTATGTGTCAGCTCAAGCAGG - Intergenic
1176344299 21:5727767-5727789 ATTTATGTTTCTCTCTAAGCTGG + Intergenic
1176351113 21:5848351-5848373 ATTTATGTTTCTCTCTAAGCTGG + Intergenic
1176500528 21:7596689-7596711 ATTTATGTTTCTCTCTAAGCTGG - Intergenic
1176538620 21:8125836-8125858 ATTTATGTTTCTCTCTAAGCTGG + Intergenic
1176792214 21:13330904-13330926 ATTGATGTCTCAGTTCAAGTAGG + Intergenic
1177856119 21:26402431-26402453 ATTTATGTCACAGTTGAAGAAGG + Intergenic
1178033618 21:28556034-28556056 ATTTATGTTCCTCTTGAAACTGG - Intergenic
1179871492 21:44245244-44245266 ATTTATGTGTCAGCTCAAGCAGG + Intergenic
1180131487 21:45829789-45829811 ACATTTGTCCCACTTGAAGCGGG + Intronic
1203243566 22_KI270733v1_random:42191-42213 ATTTATGTTTCTCTCTAAGCTGG + Intergenic
950822177 3:15772449-15772471 ATTTATGTCTCTGTTGATGGGGG - Intronic
951678621 3:25271030-25271052 ATTTGTATTTCACTAGAAGCTGG - Intronic
955501094 3:59583721-59583743 ATTAATTTCTCTCTTGAAACTGG + Intergenic
957292046 3:78290485-78290507 AGTTATGCCTCACTTAAAGGTGG - Intergenic
957369289 3:79271323-79271345 AGTGTTGTATCACTTGAAGCTGG - Intronic
958186974 3:90134561-90134583 ATTTTTCTTCCACTTGAAGCTGG + Intergenic
964316736 3:155452778-155452800 ATTTATGTGGCACTTGAGGTGGG - Intronic
965457929 3:168927518-168927540 ACTTAACTCTCACTTAAAGCAGG + Intergenic
967308582 3:188084489-188084511 TTTTCTGTCTCACTCGAAGTGGG - Intergenic
970300509 4:14676825-14676847 ATTTATTTCTCACATCAATCAGG + Intergenic
972440809 4:39089596-39089618 ATTGATGTCACACTTGAAAAAGG + Intronic
973897418 4:55427964-55427986 AGTTATGTGCCACATGAAGCAGG + Exonic
973927611 4:55755345-55755367 ATTTATGTTTATATTGAAGCAGG - Intergenic
975066480 4:70071711-70071733 AATTATGTTTCTCTTGAATCAGG + Intergenic
975243149 4:72086387-72086409 ATTTCTGTCTCACTGTAAGCAGG + Intronic
976044727 4:80931496-80931518 AGTTCTGTCAAACTTGAAGCAGG + Intronic
976575368 4:86663723-86663745 ATTTAGGTCTCATTTGTAGTTGG + Intronic
980041297 4:127943678-127943700 ATTTATGGCTCACTTTTAACTGG - Intronic
981890229 4:149727694-149727716 GTTTATGTGTCAGCTGAAGCTGG + Intergenic
982882715 4:160740544-160740566 ATTTATCTCTTTCATGAAGCTGG + Intergenic
983118922 4:163856086-163856108 AATCATGTCTTCCTTGAAGCTGG + Intronic
983732802 4:171017932-171017954 TTTTGTGGCTCACTTGAATCAGG - Intergenic
983926591 4:173409503-173409525 ACTCATGTCCCATTTGAAGCTGG + Intergenic
984907333 4:184640970-184640992 ATTTTTGTCACTCTTGAAACAGG - Intronic
985547340 5:516239-516261 ATTTGGGTCTCATTTGAAGTGGG + Intronic
988492342 5:31715495-31715517 ATTTATGACATACTAGAAGCTGG + Intronic
992221618 5:74579455-74579477 TTTTAGCTCTCACTTTAAGCAGG - Intergenic
992560600 5:77949162-77949184 ACTTAAGACTCACTTTAAGCTGG + Intergenic
993475230 5:88356406-88356428 ATGTATGAATCACTTGAACCCGG - Intergenic
999723893 5:154419136-154419158 CTTAATGTCTCATTTCAAGCAGG + Exonic
1000663810 5:163969921-163969943 ATTTGTATTTCACTTGATGCTGG - Intergenic
1004367060 6:15021606-15021628 ATTTATGTCACTCTTAAAGGAGG - Intergenic
1004802432 6:19164497-19164519 ATTTATGTCTCTGATGAAACAGG + Intergenic
1005845096 6:29771000-29771022 GTGTAGGCCTCACTTGAAGCTGG - Intergenic
1006256596 6:32837639-32837661 ATTAATGTCTCACCTGAAAGAGG + Exonic
1007522205 6:42459484-42459506 ATTTGGGACTAACTTGAAGCTGG - Intergenic
1008821064 6:55630774-55630796 AGTCATGTCTCACATGGAGCGGG - Intergenic
1011759892 6:90552048-90552070 AATAATGACTCACTTGATGCGGG - Exonic
1011848727 6:91600038-91600060 AGTTATGTCTCACTTAATGATGG + Intergenic
1012350028 6:98238929-98238951 GTTTATTTCTCACTGAAAGCTGG - Intergenic
1013323959 6:109025361-109025383 ATTTATTTCTAACTGGAACCTGG - Intronic
1013817394 6:114115137-114115159 ATTTCTGTCTCACATGAAAAAGG + Intronic
1015587512 6:134790517-134790539 ATTTATGTTTCTCTTTAAACTGG - Intergenic
1020800411 7:12725896-12725918 TTTTCTTTCTGACTTGAAGCAGG + Intergenic
1020931117 7:14395916-14395938 TTTTATGTCTCACTTCAATAAGG + Intronic
1020990791 7:15193525-15193547 AGTTAAATCTCACTTGAAGTTGG + Intergenic
1022883785 7:34620726-34620748 AGTAATGTCTCACTGGAACCTGG + Intergenic
1024484909 7:49906979-49907001 ATTGATGGGTCACTTGAAACTGG - Intronic
1024808411 7:53177136-53177158 ATTTAACTCTCAGTTGAAGGAGG + Intergenic
1027464621 7:78500182-78500204 ATTTAATTCTCACGTGAAGTTGG - Intronic
1029866326 7:103634513-103634535 ATTTAAGTCTTACTTGAAGCTGG - Intronic
1029887810 7:103891387-103891409 ATTAATGTCTCCTGTGAAGCAGG + Intronic
1031326261 7:120402443-120402465 TTTTTTTTCTCAGTTGAAGCAGG + Intronic
1035877062 8:3202452-3202474 AGTTATGTTTCACTTGGAGGAGG - Intronic
1039275174 8:35927103-35927125 ATTAATGTCTCAGGTGAAGTGGG + Intergenic
1044270397 8:90235951-90235973 AGTGAGGTCTCAGTTGAAGCTGG + Intergenic
1044286663 8:90418452-90418474 ATTTATTTCTCACTTGGATGAGG - Intergenic
1045930647 8:107621987-107622009 ATTTATTAATCACTTGAATCAGG + Intergenic
1047630830 8:126706253-126706275 ATTTATCTCTCATTTGAGACAGG - Intergenic
1048947107 8:139459547-139459569 AGTTATCTCTTTCTTGAAGCAGG - Intergenic
1052104165 9:24491731-24491753 AATTATCTCTCACTTGAATTTGG + Intergenic
1052296301 9:26899308-26899330 AATTAGGTCTCACCTGTAGCAGG - Intergenic
1052492220 9:29184533-29184555 ATATATGTCTCTCTAGAAGGGGG + Intergenic
1058392402 9:104510859-104510881 TTTTAAGCCTCACTTGCAGCTGG + Intergenic
1059087506 9:111320261-111320283 ATTCATGTTCCACTTGAAGATGG + Intergenic
1060061712 9:120466587-120466609 ATTTGTGTCTCAAATGAAGTTGG + Intronic
1062712596 9:137984794-137984816 AGTTATGTCCCACTTGACTCTGG + Intronic
1203459892 Un_GL000220v1:25274-25296 ATTTATGTTTCTCTCTAAGCTGG + Intergenic
1187461970 X:19495306-19495328 ATTTAAGTGACACTTCAAGCTGG - Intronic
1187665421 X:21603725-21603747 ATGAATGTCTGTCTTGAAGCTGG - Intronic
1188740367 X:33771005-33771027 ATTTATGTCTCACTTTAGTTTGG - Intergenic
1189679697 X:43503069-43503091 ATTTATGTATCTCTAGAAGTAGG + Intergenic
1190743111 X:53303471-53303493 ATTTAGGTGTCACTTGAACTTGG - Intronic
1191094214 X:56658006-56658028 ATTTATGTTTCTCTCGAAACTGG + Intergenic
1193235395 X:79100503-79100525 AATGATGTCACACTTCAAGCAGG - Intergenic
1195749756 X:108152178-108152200 ATTTATGTCACATTTAAAGGTGG + Intronic
1197029969 X:121802018-121802040 ATTTATGTTTCTCTTTAAACTGG + Intergenic
1198685007 X:139219711-139219733 TTCTTTGTCTCACCTGAAGCAGG - Intronic