ID: 935254739

View in Genome Browser
Species Human (GRCh38)
Location 2:101299766-101299788
Sequence GTCTCACTTGAAGCAGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935254734_935254739 22 Left 935254734 2:101299721-101299743 CCACGTTCTTTGTGTGGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 935254739 2:101299766-101299788 GTCTCACTTGAAGCAGGCAAAGG 0: 1
1: 0
2: 1
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935254739 Original CRISPR GTCTCACTTGAAGCAGGCAA AGG Intronic
900004624 1:36552-36574 GTCTCAGGTGAAGCAGGACAGGG - Intergenic
900024346 1:207071-207093 GTCTCAGGTGAAGCAGGACAGGG - Intergenic
907305140 1:53509113-53509135 GGCTCACCTGTGGCAGGCAAGGG + Exonic
907643281 1:56214359-56214381 TTCTCACTGAAATCAGGCAAGGG - Intergenic
909896302 1:81074557-81074579 GACTAACTTGAACCAGTCAAGGG - Intergenic
915558434 1:156673091-156673113 GTCTCAAGGGTAGCAGGCAAGGG + Exonic
917431964 1:174979305-174979327 GTCTCCTTTGAAGCAGACACTGG + Intronic
919006681 1:191908376-191908398 GTCTCACTTGAAACAAGGGAAGG + Intergenic
923696393 1:236256226-236256248 CTCTCATTAGAAGGAGGCAAGGG + Intronic
1063128428 10:3155663-3155685 GTATCACGAGAAGCAGGCACAGG - Exonic
1067569997 10:47364797-47364819 GTCTCAGGTGAGGCAGGAAAGGG - Intergenic
1067977354 10:51041429-51041451 GTCACACCTGAAGCTGGCATAGG + Intronic
1069249676 10:66252972-66252994 GTCTCAGTTGAAGAGGGTAAGGG + Intronic
1069947620 10:71998749-71998771 GACTGAGTAGAAGCAGGCAAAGG - Intronic
1069990817 10:72314880-72314902 GAATCACTTGAACCAGGAAAGGG + Intergenic
1074252301 10:111763291-111763313 TTCTCAGGTGAAGCAGGCATGGG - Intergenic
1077071858 11:678123-678145 GAATCACTTGAACCAGGCAGAGG + Intronic
1077619991 11:3712613-3712635 GTCTGGCTTGCAGGAGGCAAAGG + Exonic
1085192697 11:74642054-74642076 GTCTCACACGTAGCAGACAAGGG + Exonic
1086224320 11:84489430-84489452 CTTTCACTGGAAGCAGGGAATGG - Intronic
1089093960 11:115902658-115902680 GTCTCTCTTGAAGCCAGGAAGGG - Intergenic
1090414193 11:126529316-126529338 GGATCAGTTGAAGCAGGCCATGG + Intronic
1091378043 12:38606-38628 GTCTCAGGTGAAGCAGGACAGGG - Intergenic
1092901741 12:13066426-13066448 GCCTCACTAGAGCCAGGCAAAGG - Intronic
1094121703 12:26981958-26981980 GTTTCACATGAATCAGGCTATGG - Intronic
1094447705 12:30549645-30549667 GTCTTACTAGAAGGAGGCATTGG + Intergenic
1099321383 12:81154547-81154569 GGCATAGTTGAAGCAGGCAAAGG - Intronic
1102194745 12:111017084-111017106 GAATCACTTGAATCAGGGAATGG - Intergenic
1106849481 13:33774359-33774381 TTCGCACTGGAGGCAGGCAATGG + Intergenic
1111518838 13:89372448-89372470 GCCACACTTGAGGCAGGCACTGG - Intergenic
1113263880 13:108594779-108594801 GTCACATATCAAGCAGGCAATGG - Intergenic
1113724126 13:112585682-112585704 GAATCACTTGAAGGAGGCAGAGG + Intronic
1115430234 14:33309102-33309124 ATCTCAATAGAAGCAGGCACTGG - Intronic
1115900668 14:38143960-38143982 GTTTCACTTTCAGCAGGAAAAGG - Intergenic
1116291413 14:43047305-43047327 GGATCACTTGAAAGAGGCAAGGG + Intergenic
1121637275 14:95462238-95462260 GTCTCTCTAGAAGCTGGCCATGG - Intronic
1126343422 15:47668559-47668581 GTTTCACTTCAAGAAGCCAAAGG + Intronic
1127256308 15:57296663-57296685 CTCTCACATGCAGAAGGCAATGG + Intronic
1131329696 15:91485577-91485599 GTCTGACTTGAAACAGGAGAGGG + Intergenic
1132448884 15:101954391-101954413 GTCTCAGGTGAAGCAGGACAGGG + Intergenic
1136494126 16:30631431-30631453 GTCTGACTTGAGGCATACAAGGG + Intergenic
1138045538 16:53720281-53720303 ATCTCAGATGAAGCAGGGAAGGG - Intronic
1140051135 16:71482121-71482143 GTCTCCCTCTTAGCAGGCAAAGG + Exonic
1141076451 16:81010109-81010131 GAATCACTTGAACCAGGCAGGGG + Intronic
1141144916 16:81522394-81522416 TTCTCACTTGAAGTAGCCAGAGG + Intronic
1141859618 16:86707561-86707583 ATCTCATTTGAAGAAAGCAAGGG + Intergenic
1146035224 17:29400304-29400326 GAATCACTTGAACCAGGCAGAGG + Intronic
1147109733 17:38253111-38253133 GACTCACTTGAACCCGGCAGGGG + Intergenic
1147161277 17:38570776-38570798 GTATCACTAGCAGCAGCCAAGGG + Intronic
1149014733 17:51894896-51894918 GACTGACTTGAAGCTGGAAAGGG + Intronic
1151201672 17:72472383-72472405 CTCTCCCTTGGAGGAGGCAAAGG - Intergenic
1155605920 18:27606029-27606051 CTCACACTGGAAGCAGGCAGAGG + Intergenic
1158604252 18:58881183-58881205 GAATCACTTGAAGGAGGCAGAGG - Intronic
1159354498 18:67320352-67320374 ATTTCACTGGAAGCAGACAAAGG + Intergenic
1159969486 18:74631637-74631659 GTCTCACATGCAGCAGCCTAAGG + Exonic
1160636376 19:78161-78183 GTCTCAGGTGAAGCAGGACAGGG - Intergenic
1162128653 19:8512380-8512402 GTCTCACTTGAAGTAGCGATTGG + Exonic
1164451579 19:28370568-28370590 GACTAACTTGAAGCATGGAATGG - Intergenic
1166656483 19:44615718-44615740 GTCACACTGGAAGGAGGAAAGGG + Intronic
927330793 2:21861193-21861215 GACTCACTTGAAGCAGAAAAGGG - Intergenic
927643230 2:24859194-24859216 GTCTCCTGTGAAGCAGACAATGG + Intronic
928539538 2:32271612-32271634 GAATCACTTGAAGGAGGCAGAGG - Intergenic
931858941 2:66333573-66333595 GAATCACTTGAACCAGGGAAGGG + Intergenic
932874837 2:75440575-75440597 GTCTCACTGGCAGCAAGCAGAGG - Intergenic
935254739 2:101299766-101299788 GTCTCACTTGAAGCAGGCAAAGG + Intronic
936565105 2:113576888-113576910 GTCTCAGGTGAAGCAGGACAGGG + Intergenic
937404357 2:121612803-121612825 ATCTCACTAAAGGCAGGCAAGGG - Intronic
939853736 2:147331396-147331418 GACTCATCTGAGGCAGGCAAGGG - Intergenic
941080904 2:161059495-161059517 GCCTCATCTGAGGCAGGCAATGG + Intergenic
943166485 2:184332866-184332888 GTCACACTTTAAGCAGTTAAGGG - Intergenic
946072313 2:217044961-217044983 ATCTAACTTGAAGCAAGCACTGG - Intergenic
946277520 2:218642640-218642662 TTCACACTGGGAGCAGGCAAAGG + Exonic
947873517 2:233453106-233453128 GTCTCAGATGAAGGAGACAAAGG - Intronic
948408623 2:237741946-237741968 GTCTCACTGGAACCAGGCAGAGG - Intronic
1169020099 20:2324520-2324542 GTCTCCCTTGCAGTAGGCAGTGG + Intronic
1169440216 20:5627605-5627627 GAATTACTTGAAGCAAGCAAAGG - Intergenic
1174345239 20:49924220-49924242 CTCTCCCTTGAAGCAAGCAAAGG + Intergenic
1175100521 20:56575764-56575786 GTCTCCCTTGGAGCCGGCACTGG + Intergenic
1180316928 22:11284110-11284132 GTCCCACTTGCAGAGGGCAAAGG - Intergenic
1180650652 22:17374014-17374036 GTCTCACTTGAGTAAGGTAAGGG + Intronic
1184369102 22:44071248-44071270 GTCACACATGAATCAAGCAAAGG - Intronic
950275069 3:11653876-11653898 GTGACACTTGTAGCAGGCAGAGG + Intronic
950635871 3:14314156-14314178 GCCCCCCTTGAAGCAGGCAGAGG + Intergenic
955634044 3:61006161-61006183 GTTTCACTTGAAAAAGGCCAAGG + Intronic
957104053 3:75863481-75863503 GTCTCTCTTGAGGAAGGTAAAGG + Intergenic
959752651 3:109856430-109856452 ATCTCACTTTAAGCAACCAAAGG + Intergenic
961457470 3:127031311-127031333 GGCTCCCCTGTAGCAGGCAATGG - Intronic
961868121 3:129968829-129968851 CTCTCACTTGCAGGTGGCAAGGG + Intergenic
961918170 3:130398806-130398828 GTCCCTCATGAATCAGGCAAAGG + Intronic
965868605 3:173238069-173238091 GTCTCACATGAACCAGGCTTGGG + Intergenic
968772726 4:2518208-2518230 GTCTCAATAGAAGCAGAAAAAGG - Intronic
973567516 4:52203103-52203125 GGATCACTTCAAGCAGGGAAGGG - Intergenic
973870440 4:55160724-55160746 GCCTCACTGGAAGCAGACACTGG + Intergenic
977529533 4:98183621-98183643 GTCTCACTTGAAGCAAGTTGTGG + Intergenic
978545948 4:109872965-109872987 GTCTCACTGGGAGCATGCAGAGG - Intergenic
984399108 4:179238787-179238809 GGATAACTTGAAGCAGGGAAGGG + Intergenic
986345862 5:6834547-6834569 GTCTCATGGGAAGCAGGTAACGG + Intergenic
986579335 5:9248664-9248686 TTCTCATATGAAGCAGGCAGAGG + Intronic
986955713 5:13147402-13147424 GCCTCAGTTGAAGCAAGCCAAGG - Intergenic
988131410 5:27111423-27111445 ATGCCACTTGAAGAAGGCAATGG + Intronic
989789574 5:45380842-45380864 ATCTCACTTTGAGCAAGCAACGG - Intronic
992221617 5:74579449-74579471 CTCTCACTTTAAGCAGGAAGTGG - Intergenic
992382733 5:76254909-76254931 GTCTCATTTGTACCAGGAAAAGG - Intronic
993283476 5:85958865-85958887 GTCTCAGTTCAAGAAGGCAGAGG + Intergenic
996111000 5:119566704-119566726 TTCTCACTTAAAGAAGGGAATGG + Intronic
1000184195 5:158843262-158843284 GTCTGACTTGAAGAAGCCAGAGG - Intronic
1001048958 5:168399071-168399093 GGATCACTTAAAGCTGGCAAAGG - Intronic
1002891260 6:1334606-1334628 GTCTCCATTGAAACAGGTAACGG - Intergenic
1004515742 6:16321042-16321064 ATCTAAGTTGAAGCAGGGAAGGG + Intronic
1005165265 6:22912370-22912392 GTCTTACTGGCAGCATGCAAAGG + Intergenic
1005223751 6:23618415-23618437 GTCTCTCCTGAAGCAGAGAATGG + Intergenic
1006651716 6:35557171-35557193 TTCTGACTTTAAGCAGGAAAAGG + Intergenic
1011641097 6:89417065-89417087 TCCTCTCTTGAAGCAAGCAAAGG + Intergenic
1016219114 6:141645169-141645191 CTCTGACTTGGATCAGGCAATGG + Intergenic
1023646272 7:42319015-42319037 GTCCCACTTGAAAAAAGCAAAGG + Intergenic
1026175548 7:67993593-67993615 GTGTCACTTGAAGTAGGTATTGG + Intergenic
1026974172 7:74486472-74486494 GTTTCCCTGGAAGCAGGCAATGG - Intronic
1027342483 7:77223944-77223966 GTGTCACTTGAAGGAGCCACAGG + Intronic
1034995862 7:155577061-155577083 GACTCACTTGACACAGGCCATGG - Intergenic
1039021999 8:33218228-33218250 GAATCACTTGAACCAGGGAAGGG + Intergenic
1049887319 9:36335-36357 GTCTCAGGTGAAGCAGGACAGGG - Intergenic
1050077805 9:1883117-1883139 GACTCACCTGCAGCAGTCAATGG + Intergenic
1052849364 9:33367304-33367326 GTCTGACATGAAGCAAGCCACGG + Intronic
1054877804 9:70114726-70114748 GTCTTCCTTGAAGCTGGGAAGGG - Intronic
1056261110 9:84849488-84849510 TTCTCAATTGAAGAATGCAATGG + Intronic
1056915330 9:90741138-90741160 GTCTGTCTTTAAGCAGACAAGGG + Intergenic
1057818511 9:98313851-98313873 GTGACCTTTGAAGCAGGCAATGG + Intronic
1057994670 9:99810122-99810144 GTCTCACTTAAAGCAGGCAGGGG + Intergenic
1058629021 9:106966992-106967014 GTATCACTTAGAGCATGCAAGGG + Intronic
1062668379 9:137691712-137691734 TTCTCACTAGCAGCACGCAAGGG + Intronic
1196886495 X:120251061-120251083 GCCTCACTTGAACCAGGAAGCGG + Intronic