ID: 935259760

View in Genome Browser
Species Human (GRCh38)
Location 2:101344096-101344118
Sequence CAGGGCAGGCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2040
Summary {0: 1, 1: 1, 2: 26, 3: 246, 4: 1766}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935259748_935259760 0 Left 935259748 2:101344073-101344095 CCCTGCCCTGGAAAACCATCCAG 0: 1
1: 0
2: 2
3: 34
4: 245
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259744_935259760 19 Left 935259744 2:101344054-101344076 CCACATCCAGGCCGGGGAACCCT 0: 1
1: 0
2: 1
3: 11
4: 122
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259745_935259760 13 Left 935259745 2:101344060-101344082 CCAGGCCGGGGAACCCTGCCCTG 0: 1
1: 0
2: 1
3: 43
4: 340
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259749_935259760 -1 Left 935259749 2:101344074-101344096 CCTGCCCTGGAAAACCATCCAGC 0: 1
1: 0
2: 2
3: 24
4: 214
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259743_935259760 20 Left 935259743 2:101344053-101344075 CCCACATCCAGGCCGGGGAACCC 0: 1
1: 0
2: 1
3: 12
4: 132
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259747_935259760 8 Left 935259747 2:101344065-101344087 CCGGGGAACCCTGCCCTGGAAAA 0: 1
1: 0
2: 3
3: 35
4: 242
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259742_935259760 24 Left 935259742 2:101344049-101344071 CCTGCCCACATCCAGGCCGGGGA 0: 1
1: 0
2: 3
3: 22
4: 224
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259738_935259760 30 Left 935259738 2:101344043-101344065 CCGGCTCCTGCCCACATCCAGGC 0: 1
1: 1
2: 3
3: 72
4: 617
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259751_935259760 -5 Left 935259751 2:101344078-101344100 CCCTGGAAAACCATCCAGCAGGG 0: 1
1: 0
2: 0
3: 28
4: 179
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766
935259753_935259760 -6 Left 935259753 2:101344079-101344101 CCTGGAAAACCATCCAGCAGGGC 0: 1
1: 0
2: 0
3: 15
4: 194
Right 935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG 0: 1
1: 1
2: 26
3: 246
4: 1766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935259760 Original CRISPR CAGGGCAGGCAGGAGGAGGA AGG Intergenic
Too many off-targets to display for this crispr