ID: 935259826

View in Genome Browser
Species Human (GRCh38)
Location 2:101344507-101344529
Sequence CTGCAATCCCATCCTGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935259821_935259826 17 Left 935259821 2:101344467-101344489 CCATTTGTATCTTGAGTGCAGGG 0: 1
1: 0
2: 5
3: 9
4: 130
Right 935259826 2:101344507-101344529 CTGCAATCCCATCCTGTTGTCGG 0: 1
1: 0
2: 1
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935259826 Original CRISPR CTGCAATCCCATCCTGTTGT CGG Intergenic
900118070 1:1036958-1036980 CTGCTCTCCCAGCCTGTTGCAGG - Intronic
900804419 1:4757905-4757927 CTGTAATCCCTACCTGTTGTGGG + Intronic
901243558 1:7710338-7710360 CTGTAATCCCAGCATGTTGGGGG + Intronic
901870238 1:12134586-12134608 CTTCAATCCCATCCTTTTGTAGG - Intronic
905063449 1:35159451-35159473 CTGTAATCCCAGCCTGTGGGAGG - Intergenic
906034789 1:42743509-42743531 CTGCAATCCCATCATACTCTTGG + Intergenic
906167049 1:43694257-43694279 CTGTAATCCCAGCCCTTTGTGGG + Intronic
906740804 1:48181973-48181995 CTGCACTCACTTCCTGCTGTTGG + Intergenic
912130915 1:106598750-106598772 CTGAAATCCCATATTGTTTTGGG + Intergenic
917090237 1:171345893-171345915 CTGCAATTCCCACATGTTGTGGG + Intergenic
918722091 1:187865925-187865947 CTGCAATCCTAGCCTTTTGGGGG - Intergenic
919126572 1:193401488-193401510 TTCCGATCCTATCCTGTTGTTGG - Intergenic
919646332 1:200098561-200098583 CTGGATTCCCATCCTGTTTCTGG + Intronic
921012542 1:211157201-211157223 CTGCAATCCCATCATTTTAAGGG + Intergenic
921135743 1:212257492-212257514 CTGCAATCCCAGCCTTTGGGAGG + Intergenic
921384924 1:214558805-214558827 CTGCAATCCCAGCATTTTGGGGG - Intergenic
922281740 1:224131993-224132015 CTGTAATCCCAGCATGTTGGGGG + Intronic
922481940 1:225945236-225945258 CTGAGATCCCTTCCTGATGTTGG + Intergenic
1064393831 10:14963839-14963861 CTGTAATCCCAGCCTTTTGGGGG + Intronic
1069690122 10:70346001-70346023 CTGTAATCCCATCATTTTGAGGG + Intronic
1072165088 10:92805414-92805436 CTGTAATCCCATCATTTTGGAGG - Intergenic
1072570704 10:96655244-96655266 CTGTAATCCCATCATTTTGTGGG + Intronic
1073197254 10:101702500-101702522 CTGTAATCCCAGCACGTTGTGGG + Intergenic
1073594093 10:104783474-104783496 CTGTAATCCCAGCATGTTGGGGG + Intronic
1075107861 10:119554049-119554071 CTGCAATCCCAACATTTTGTGGG - Intergenic
1079753272 11:24225187-24225209 CTGCTATCCCACCTTGTTGATGG - Intergenic
1080730063 11:34941284-34941306 CTACATTCCCATTCTGCTGTAGG + Intronic
1084497164 11:69511946-69511968 CATCATTGCCATCCTGTTGTGGG + Intergenic
1085250758 11:75142144-75142166 GTTCAAGCCCCTCCTGTTGTAGG + Intronic
1086006890 11:82048069-82048091 CTGTAATCCCCACCTGTTGGGGG + Intergenic
1086881216 11:92155861-92155883 CTGCAATGCCTTCCTCTTCTGGG - Intergenic
1091955160 12:4634692-4634714 ATGCAATCCCATCTTGTTTTAGG - Intronic
1093700105 12:22210644-22210666 CTGCAATCCCTTCTTCATGTTGG + Intronic
1094213602 12:27918368-27918390 CTGCAATCACATCAGTTTGTTGG - Intergenic
1095091808 12:38114446-38114468 CTGTAATCCCATCTACTTGTGGG - Intergenic
1095152550 12:38812586-38812608 CTGTAATCCCCACATGTTGTGGG - Intronic
1095199523 12:39366180-39366202 CTCCAATCTCCTCATGTTGTAGG - Intronic
1098543014 12:71680986-71681008 CTGTAATCCCAGCATGTTGTGGG + Intronic
1100321959 12:93503639-93503661 CTGTAATCCCATACTTTTGGAGG - Exonic
1102627886 12:114250749-114250771 CTGTAATCCCCACGTGTTGTGGG + Intergenic
1102669649 12:114606737-114606759 CTGCAATTCCCACGTGTTGTGGG - Intergenic
1103400280 12:120639373-120639395 CTGTAATCCCAGCCACTTGTAGG - Intergenic
1106371659 13:29140508-29140530 CTGGAATGTCTTCCTGTTGTAGG + Intronic
1108385818 13:49898509-49898531 CTGTAATCCCAGCATGTTGGAGG + Intergenic
1109084542 13:57952596-57952618 CTGTAATCCCAGCATGTTGGGGG - Intergenic
1109629881 13:65032721-65032743 CTGTAATCCCCACATGTTGTGGG - Intergenic
1112212833 13:97398143-97398165 CTGTAATCCCAGCCTTTTGGGGG + Intergenic
1112831317 13:103455718-103455740 CTGCAATCCCAGCATTTTGCGGG - Intergenic
1113512420 13:110866786-110866808 CAGCTAACCCCTCCTGTTGTGGG + Intergenic
1114432151 14:22670891-22670913 CTGCTCTCCTATCCTGCTGTGGG - Intergenic
1116789573 14:49326357-49326379 CTGTAATCCCAACCTGTTGAGGG + Intergenic
1116794677 14:49377086-49377108 CATCCATCTCATCCTGTTGTAGG + Intergenic
1117147501 14:52849807-52849829 CTGTAATCCCAGCATGCTGTGGG - Intergenic
1117758364 14:58999537-58999559 CTGTAATCCCCACCTGTTGAGGG + Intergenic
1119605220 14:76010049-76010071 CTGCAATCCCAGCCTTTGGGAGG - Intronic
1122937003 14:104964362-104964384 CTGGAACTCCATCCTGGTGTGGG + Intronic
1124856356 15:33392928-33392950 GTGCAATCCCATGCCCTTGTAGG - Intronic
1125382543 15:39102785-39102807 CTGCAATCCCCACCTGTGGGAGG + Intergenic
1126138866 15:45419756-45419778 CTGTAATCCCAGCATTTTGTTGG + Intronic
1127011768 15:54638802-54638824 CTGTAATCCCCACATGTTGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127663182 15:61119564-61119586 CTGCAATCCCAGCATTTTGGGGG - Intronic
1130607847 15:85333779-85333801 CTGGGATCCAAGCCTGTTGTGGG - Intergenic
1132090599 15:98945342-98945364 CTACCATCCCCTCCTGGTGTGGG + Intronic
1133136458 16:3715688-3715710 CTGCAATCCCAGCATTTTGGAGG + Intronic
1133693239 16:8236317-8236339 CTGTAATCCCCACGTGTTGTGGG - Intergenic
1134046427 16:11104382-11104404 CTGTAATCCCATCCTTTGGGAGG - Intronic
1135777750 16:25271875-25271897 CTGCAATCCCCACATGTTGAGGG + Intergenic
1136685349 16:31990820-31990842 CTGTAATCCCAGCATTTTGTGGG - Intergenic
1136883812 16:33919449-33919471 CTGTAATCCCAGCATTTTGTGGG + Intergenic
1137969014 16:52965254-52965276 CTGTAATCCCAGGCTGATGTGGG - Intergenic
1139434879 16:66930739-66930761 CTGTAATCCCAGCAGGTTGTGGG + Intergenic
1139563925 16:67761029-67761051 CTGCAGCCCCACCCTGGTGTCGG - Intronic
1139868442 16:70083137-70083159 CTGTAATCCCAGCATTTTGTGGG - Intergenic
1140171285 16:72607604-72607626 CTGCAATCCCAGCACTTTGTAGG + Intergenic
1141597598 16:85106886-85106908 CTGTAATCCCAGCATGTTGGAGG + Intronic
1203088198 16_KI270728v1_random:1196016-1196038 CTGTAATCCCAGCATTTTGTGGG - Intergenic
1142654665 17:1383509-1383531 CTGTAATCCCATCTTCTGGTAGG - Intronic
1142790286 17:2258836-2258858 CTGCAATTCCAGCATGTTGGGGG + Intronic
1143806585 17:9433573-9433595 CTCCAAACTCATCATGTTGTAGG + Intronic
1144930504 17:18855325-18855347 CTGCAATCCCAGCGTTTTGGAGG + Intronic
1148017934 17:44535718-44535740 CTGCAATCCCAGCTACTTGTGGG + Intergenic
1148624872 17:49061682-49061704 CTGCAGTCCCCTCGTGTTCTGGG - Intergenic
1150615648 17:66768784-66768806 TTGCAATCCCCACCTGTTGGGGG - Intronic
1151172471 17:72258830-72258852 CTGCAATCACAGCATGTTCTGGG + Intergenic
1157384416 18:47249021-47249043 CGGCATTCCCATCGTGTCGTTGG - Exonic
1158510350 18:58084950-58084972 CTGCAATCCTAGCATGTTGGGGG - Intronic
1158569263 18:58583093-58583115 CTGCAAAGCCATACTCTTGTGGG - Intronic
1159434639 18:68399987-68400009 CTGTACTCCCATACTTTTGTGGG + Intergenic
1160520930 18:79507518-79507540 CTGCAAACCCATCCACTTGAGGG - Intronic
1161567706 19:5012750-5012772 CTCCAACCCCATCCTGCTGATGG - Intronic
1162607933 19:11725835-11725857 CTGCAATCCCATCACTTTGCAGG + Intronic
1163055783 19:14716514-14716536 CTGCAATCCCAGCACATTGTGGG - Intronic
1163728795 19:18938232-18938254 CTACAATCCCATCCTGCAGATGG + Intronic
1165649368 19:37472159-37472181 CTGTAATCCCAGCCTTTGGTAGG - Intronic
1165763262 19:38335120-38335142 CAGCCATCCTATACTGTTGTGGG - Intergenic
1166519344 19:43469830-43469852 CTGTAATCCCAGCATTTTGTGGG + Intergenic
1166764503 19:45244883-45244905 CTCCAATCCCAACCTGATCTCGG + Intronic
1166792778 19:45407797-45407819 CTGTAATCCCATCCTTTGGGAGG + Intronic
1167961314 19:53106354-53106376 CTGCAATCCCAGCATTTTGGGGG + Intergenic
1168049471 19:53818037-53818059 CTGTAATCCCAGCATGTTGGAGG - Intronic
1168640938 19:58031081-58031103 CTGTAATCCCAGCATTTTGTGGG - Intergenic
927728615 2:25449440-25449462 CAGAAATCTCACCCTGTTGTTGG - Intronic
928296960 2:30091985-30092007 CTGCAAAGCCATCTTTTTGTGGG + Intergenic
929726302 2:44431660-44431682 CTGCAAAACAATCCTATTGTGGG - Intronic
933706821 2:85297566-85297588 CTGTAATCCCAGCATTTTGTGGG + Intronic
934738239 2:96701054-96701076 CTGTAATCCCAGCCTGTGGGAGG + Intergenic
935259826 2:101344507-101344529 CTGCAATCCCATCCTGTTGTCGG + Intergenic
938848741 2:135238620-135238642 CTGTAATCCCATCGCTTTGTGGG - Intronic
940575238 2:155495227-155495249 CTGCAATCCCAGCACTTTGTGGG + Intergenic
942746060 2:179234518-179234540 CTGCAATCCCAGCACTTTGTGGG + Intronic
943119722 2:183720000-183720022 CTGTAATCCCAGCATGTTGGGGG - Intergenic
946611735 2:221465769-221465791 CTGAAATCGCATCCAGTTGGTGG - Intronic
947620167 2:231584912-231584934 CTGCAATCCCAGCATGTGGGAGG - Intergenic
947806152 2:232969543-232969565 CTGCACTCCAATCCTGGTGATGG - Intronic
947978963 2:234392574-234392596 CTGCAATCCCAGCACTTTGTGGG + Intergenic
1170181177 20:13531785-13531807 CTGTAATCCCAGCCAGTTGGGGG - Intronic
1172285195 20:33735285-33735307 CTGCAATCCCATCACTTTGGAGG - Intronic
1172323913 20:34019454-34019476 CTCCCATCCCATCATGTTTTCGG - Intronic
1172424826 20:34848594-34848616 CAACAATCACATCCTGTGGTTGG - Intronic
1172549765 20:35789801-35789823 CTGCAATCCCACCACTTTGTGGG - Intronic
1173326358 20:42037283-42037305 CTGACAGCCCATCCTGTGGTTGG + Intergenic
1175407220 20:58743107-58743129 CTGCAATTTCCTTCTGTTGTTGG - Intergenic
1177180370 21:17738415-17738437 CTGCAATCACTTGCTGTTGCCGG - Intergenic
1178705779 21:34871687-34871709 CTGCAAGCCCATCCTGTGGGCGG + Intronic
1179525507 21:41973633-41973655 CTGCAATCCTTGCCTCTTGTTGG + Intergenic
1182412479 22:30198957-30198979 GTGCAAATCCATCCTGTTGAAGG + Intergenic
1182855312 22:33511892-33511914 CTACAGTCCCATCCACTTGTAGG - Intronic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
1183993006 22:41611253-41611275 CTGTAATCCCAGCCTGTACTTGG - Intronic
950057475 3:10038247-10038269 CTGCAATCCCAGCACTTTGTGGG - Intronic
950748099 3:15106971-15106993 TTTCAATCCTATACTGTTGTGGG - Intergenic
951211913 3:19984445-19984467 ATGCAACCCCATCTTGTTTTAGG + Exonic
951906492 3:27712771-27712793 CTGGAGTCCCATCGTCTTGTTGG + Intergenic
953359050 3:42278976-42278998 CTGTAATCCCCACCTGTTGAAGG + Intergenic
954575777 3:51675305-51675327 CTGCCAGCCCATCCAGCTGTGGG - Intronic
955076107 3:55614821-55614843 CTGAAATCCCATTTTGCTGTTGG - Intronic
957219427 3:77362962-77362984 CTGCAATTCCCACATGTTGTGGG - Intronic
959778280 3:110197481-110197503 CTGCAATCTCATACAGTTTTAGG - Intergenic
960391645 3:117084305-117084327 CTATAATCCCCACCTGTTGTGGG + Intronic
960415238 3:117377003-117377025 CTGGAATCCCCTGCTGTTCTTGG - Intergenic
960781301 3:121321516-121321538 CTGTAATCTCTTGCTGTTGTAGG + Intronic
960986201 3:123282645-123282667 CTGCATTGCCATCCTGACGTCGG - Exonic
962542150 3:136393669-136393691 CTGCAATCTCTACCTGCTGTGGG + Intronic
963377225 3:144483640-144483662 CTGTAATCCCAACATGTTGGGGG + Intergenic
965964472 3:174469685-174469707 CTGTAATCCCAGCATTTTGTGGG - Intronic
967634897 3:191790148-191790170 CTGCAATCCCCACATGTTGTGGG - Intergenic
967778294 3:193407366-193407388 CTGCACTCCCGTCCTGTGGAGGG - Exonic
968319379 3:197751381-197751403 CTGCAATCCCAGCCCTTTGAAGG + Intronic
968488672 4:877736-877758 CAGCAAGCCCATCCTGGTGAGGG - Exonic
969336752 4:6515134-6515156 CTGTATTAGCATCCTGTTGTGGG - Intronic
971271435 4:25150746-25150768 CTGCAATCCCAGCACTTTGTGGG + Intronic
972221602 4:36962317-36962339 CTGTAATCCCAGCCTCTTGTGGG - Intergenic
974240348 4:59238253-59238275 CTGCAATGGCAGTCTGTTGTGGG + Intergenic
974555974 4:63447481-63447503 CTTGAATTCCCTCCTGTTGTGGG - Intergenic
976434872 4:85005710-85005732 CTGCAATCCCAGCACGTTGGGGG + Intergenic
977872292 4:102106562-102106584 CTGTAATCCCAGCATTTTGTGGG + Intergenic
978073944 4:104505986-104506008 CTCCTATTCCATCCTGTTGCTGG - Intergenic
979936154 4:126698859-126698881 CTGTAATCCCAGCATTTTGTGGG - Intergenic
981983398 4:150825019-150825041 CTGCAATTCCAGCATTTTGTGGG - Intronic
982651819 4:158096382-158096404 CTCCAATCCCATTCTGCTGGAGG - Intergenic
982777221 4:159454190-159454212 CTGTAATCCCATCTTTTTGGGGG + Intergenic
983253716 4:165375284-165375306 CTACAATCCTTTCCTGGTGTAGG - Intronic
983429144 4:167625730-167625752 CTGCAATACCATACTCTTCTTGG + Intergenic
986154474 5:5160592-5160614 CTGCAACCCCAGGCTGTGGTGGG + Intronic
986893089 5:12332750-12332772 CTGCAAAGCCATCCTTTTGGGGG - Intergenic
989139739 5:38190645-38190667 CTCAAATCACATCCTGTTGTTGG - Intergenic
989683533 5:44058222-44058244 CTGCAATGCCAACCTGAGGTTGG - Intergenic
991326357 5:65437506-65437528 CTACAATTCCCACCTGTTGTGGG - Intronic
992641701 5:78773536-78773558 CTGCTTTCCCATCCTGTCCTGGG + Intergenic
992933820 5:81680085-81680107 CTGCCACCCCACCCTGTTCTTGG + Intronic
993441526 5:87962509-87962531 TTGCAATCTCCACCTGTTGTTGG - Intergenic
994664614 5:102692750-102692772 TTTCAAACCCATACTGTTGTCGG + Intergenic
996637649 5:125713415-125713437 TTGCCATCCCATGCTGGTGTGGG - Intergenic
998197745 5:140090041-140090063 CTGCAATCCTAGCATTTTGTGGG - Intergenic
999421536 5:151448480-151448502 CTGCAAACTCATCCTTCTGTAGG + Intronic
1000890583 5:166797029-166797051 TTTCAATCCCATACTGTTGTTGG + Intergenic
1001387679 5:171353390-171353412 CTGCAATCCCAGCTTCTTGTGGG - Intergenic
1001721785 5:173862796-173862818 CTGTAATCCCAGCCTTTTGGGGG + Intergenic
1002461555 5:179376225-179376247 CTGTAATCCCAGCCCTTTGTGGG + Intergenic
1002943556 6:1739448-1739470 CTGCAATAGCATCCTGCTATAGG + Intronic
1007046264 6:38777687-38777709 CTGTAATCTCAGCCTTTTGTGGG - Intronic
1012446558 6:99313033-99313055 CTACAATCCCAGCACGTTGTGGG + Intronic
1013184469 6:107745868-107745890 CTGCAGTCCCAGCCACTTGTGGG + Intronic
1017787241 6:157766611-157766633 TTGGAATCCCATCCTTCTGTGGG + Intronic
1019109656 6:169699722-169699744 CTGCAATCCCAGCACTTTGTGGG + Intronic
1021185453 7:17559175-17559197 CTGCACTCTCATCCTCTTGAGGG - Intergenic
1021427498 7:20519090-20519112 CTGTAATCCCATCATTTTGCGGG - Intergenic
1021438070 7:20644334-20644356 CTGCAATCCCAGCAGTTTGTGGG - Intronic
1021711702 7:23422346-23422368 CTGTAATCCCAGCCTTTTGGGGG + Intronic
1027050185 7:75016864-75016886 TTCAAATCCCATCCTGTTGAAGG + Intronic
1029382250 7:100221745-100221767 CTCCAATCCCACCATGTTCTAGG + Intronic
1029402412 7:100354194-100354216 CTGCAATCCCACCATGTCCTAGG + Intronic
1029617789 7:101670521-101670543 CCATAATCCCCTCCTGTTGTGGG - Intergenic
1030192334 7:106822073-106822095 CAGCAATACCATCCCTTTGTGGG + Intergenic
1030658105 7:112190583-112190605 CTGCAATCTCATCCCGTGCTGGG - Intronic
1031899727 7:127395351-127395373 CTGTAATCCCCACGTGTTGTGGG + Intronic
1032489167 7:132311067-132311089 CTGGAATCCCCTCCTGTTCTAGG - Intronic
1032790020 7:135235697-135235719 CTGTAATCCCAGCATGTTGGGGG - Intronic
1035840674 8:2809416-2809438 CTATAATCCCCACCTGTTGTGGG - Intergenic
1036816570 8:11906966-11906988 TTGCAATCCTAGCCTCTTGTAGG - Intergenic
1037666659 8:20975645-20975667 CTGCCTTCCCCTCCTGTTGGAGG + Intergenic
1037968301 8:23151020-23151042 GTCCATTCCCATCCTGTTTTGGG - Intronic
1038982711 8:32777001-32777023 TTTCAATCCTATACTGTTGTTGG - Intergenic
1039039357 8:33392724-33392746 CTGTAATCCCAGCACGTTGTGGG + Intronic
1040366484 8:46722636-46722658 CTATAATCCCAACATGTTGTAGG - Intergenic
1040874547 8:52137457-52137479 CTTCCATCACATCCTGGTGTTGG + Exonic
1043787963 8:84425731-84425753 CTGCAATTGCATGCTATTGTTGG - Intronic
1044273743 8:90276095-90276117 CCACAATTCCATCGTGTTGTGGG + Intergenic
1044563992 8:93643456-93643478 CTGTAATCCCAGCATGTTGGGGG - Intergenic
1047691068 8:127355159-127355181 CTGCAATCCCAGCATGGGGTGGG + Intergenic
1047762556 8:127964915-127964937 CTGTAATCCCATGCTGTGGGAGG - Intergenic
1048115051 8:131511587-131511609 CTGCAACCCATTCCTTTTGTGGG - Intergenic
1048750135 8:137663405-137663427 CTGAAATCACATCCAGTTGGGGG - Intergenic
1050559828 9:6823523-6823545 CTGCTATCTCACACTGTTGTTGG + Intronic
1051573025 9:18582434-18582456 CTGCAATTCCCACATGTTGTGGG + Intronic
1051645513 9:19264164-19264186 CTTCAATCTCATTTTGTTGTTGG + Intronic
1055416769 9:76092095-76092117 CTGAAATCCCATCCTGAGGGGGG - Intronic
1055687950 9:78798194-78798216 CTGTAATCCCAGCATATTGTGGG + Intergenic
1056704820 9:88943042-88943064 CTCCAATACCAACTTGTTGTCGG - Intergenic
1057173446 9:92977256-92977278 ATGCAGCCCCATCGTGTTGTGGG - Intronic
1057379852 9:94557851-94557873 CTGAAATCTCATCTTGTTTTAGG - Intergenic
1057480381 9:95440662-95440684 CTGCAAACCCATGCTGTTCCAGG + Intergenic
1057919016 9:99081454-99081476 CTGTAATCCCAGCATGTTGGGGG + Intergenic
1061782756 9:133005398-133005420 CAGCCATCCCATGGTGTTGTGGG - Intergenic
1190740422 X:53284832-53284854 CTAGAATCCCAGCCTGCTGTTGG + Intronic
1192336096 X:70221109-70221131 CTGCAATCCCAACATCTGGTAGG - Intergenic
1195207066 X:102611631-102611653 CTGTAATCCCCACCTGTTGAGGG + Intergenic
1199718755 X:150526827-150526849 CTGCATTCACATCCTCTCGTGGG - Intergenic
1201280954 Y:12341363-12341385 CTCCATTCCCAGCCTGTTCTAGG - Intergenic