ID: 935259826

View in Genome Browser
Species Human (GRCh38)
Location 2:101344507-101344529
Sequence CTGCAATCCCATCCTGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935259821_935259826 17 Left 935259821 2:101344467-101344489 CCATTTGTATCTTGAGTGCAGGG No data
Right 935259826 2:101344507-101344529 CTGCAATCCCATCCTGTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935259826 Original CRISPR CTGCAATCCCATCCTGTTGT CGG Intergenic