ID: 935264171

View in Genome Browser
Species Human (GRCh38)
Location 2:101380641-101380663
Sequence ATGGTTAAAAATGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935264168_935264171 -4 Left 935264168 2:101380622-101380644 CCAGAAGACACCACGTGGGATGG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 935264171 2:101380641-101380663 ATGGTTAAAAATGCTGTTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 240
935264167_935264171 -3 Left 935264167 2:101380621-101380643 CCCAGAAGACACCACGTGGGATG 0: 1
1: 0
2: 1
3: 7
4: 99
Right 935264171 2:101380641-101380663 ATGGTTAAAAATGCTGTTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 240
935264162_935264171 30 Left 935264162 2:101380588-101380610 CCAGCTGCACAGACTAACAGAGG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 935264171 2:101380641-101380663 ATGGTTAAAAATGCTGTTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935264171 Original CRISPR ATGGTTAAAAATGCTGTTGC AGG Intronic
904065965 1:27751283-27751305 AATGTTAAAAATGCTAATGCAGG - Intronic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
905431640 1:37928790-37928812 TTGCTTAAAAATGCTGTTTTTGG - Intronic
905431718 1:37929416-37929438 TTGCTTAAAAATGCTGTTTCTGG - Intronic
907626503 1:56035524-56035546 ATGGTAAAAAAGGGAGTTGCTGG - Intergenic
907663115 1:56411747-56411769 ATGATTAAAACCGCTGGTGCTGG - Intergenic
908502185 1:64754737-64754759 AGGTTGAAAAGTGCTGTTGCAGG + Intronic
908779082 1:67672008-67672030 ATGATTTACAATGCTGGTGCAGG - Intergenic
908809553 1:67965920-67965942 ATGGTTAAAAGCACAGTTGCTGG + Intergenic
909933896 1:81529123-81529145 ATGATGAAAAATGCTGTTTGAGG + Intronic
909975849 1:82045474-82045496 ATGATACAAAATGCTGTGGCTGG + Intergenic
910848845 1:91631317-91631339 ACTGTTAAAAATGCAATTGCAGG + Intergenic
911218067 1:95216995-95217017 ATGGTTTAAAAGTCTGTGGCAGG - Intronic
912557491 1:110526802-110526824 ATGGTAATAAATGCAGTTTCTGG + Intergenic
913034917 1:114955579-114955601 ATGGTTAATTAGGCTGTTTCAGG + Intronic
913134521 1:115874930-115874952 ATGGTTAAGAATGCAGTCTCCGG + Intergenic
915450360 1:156001001-156001023 GTGGGTAAAAATAATGTTGCCGG - Intronic
916854336 1:168734665-168734687 AAGGTTAAAAATGCTCATACTGG + Intergenic
917941705 1:179928654-179928676 ATGGTTAAGAATGCAGATTCTGG - Intergenic
918835957 1:189467073-189467095 TTGGTTAAAAATGTATTTGCTGG + Intergenic
920127501 1:203705084-203705106 AAAGTTAAAAATCCAGTTGCTGG + Intronic
920864224 1:209738154-209738176 TTTGTTAAAAAAGATGTTGCTGG - Intergenic
924492539 1:244553259-244553281 AATGTTAAAAATATTGTTGCTGG + Intronic
924731267 1:246713693-246713715 ATAGTTACAACTGATGTTGCAGG + Intergenic
1062778743 10:180841-180863 ATTGTTAAAAATTCTGTTAGTGG - Intronic
1063991675 10:11571384-11571406 ATGGTTAAAAATTATTTTGGGGG - Intronic
1064576577 10:16751998-16752020 ATTGTTAAATATGTTCTTGCTGG - Intronic
1067013538 10:42737679-42737701 ATTGTTAAATATGTTCTTGCTGG + Intergenic
1067310242 10:45106061-45106083 ATTGTTAAATATGTTCTTGCTGG - Intergenic
1069693315 10:70368921-70368943 CTGGTTAAAAATGCAGATTCAGG - Intronic
1072696173 10:97604619-97604641 ATGGTTAAACATACTGTGGGGGG - Intronic
1074805142 10:117042420-117042442 ATGGTTAAAAATGTTGGTGTGGG - Intronic
1076272854 10:129169835-129169857 ATGCTTAGAAAGGCTGTTTCAGG - Intergenic
1078228237 11:9413176-9413198 ATCGTTAAAAAGTCTGTTGGGGG - Intronic
1079131824 11:17751237-17751259 ATGGTTAAAAATGAGGTAGTGGG + Intronic
1080908255 11:36568606-36568628 ATGTTTAAAAATGCAATTTCTGG + Intronic
1081406788 11:42707641-42707663 TTGGAGAAAAATGGTGTTGCAGG + Intergenic
1084654541 11:70507527-70507549 ATGCTCAGAAAGGCTGTTGCAGG - Intronic
1085098282 11:73778435-73778457 ATGATTAAAGATGTTGTGGCTGG - Intergenic
1086516168 11:87615798-87615820 CTTGTTAAAAATGCAGTTTCTGG - Intergenic
1087661726 11:100996544-100996566 ATGCTTGCAAATGCTGTTTCTGG + Intergenic
1088944753 11:114499532-114499554 AAGCTTAAAAATGCAGTTACAGG - Intergenic
1088977141 11:114825855-114825877 TTTGTTCAAATTGCTGTTGCTGG + Intergenic
1092727004 12:11496775-11496797 ATGCTTAAAAATGGTTTTGATGG - Intronic
1092912784 12:13162817-13162839 CAGGTTATAAATTCTGTTGCTGG + Intergenic
1092995600 12:13947580-13947602 ATGTTGAAACATTCTGTTGCAGG - Intronic
1093545441 12:20340424-20340446 ATGTTTAAAAATGCTCTTCATGG - Intergenic
1095972338 12:47910860-47910882 ATTGTTAAAACTGTTGTTTCTGG + Intronic
1097437403 12:59568006-59568028 ATGGTTAAACAAGCAGTTGAAGG + Intergenic
1098917767 12:76275137-76275159 ATTGTTAAATATGCTGTTCCTGG - Intergenic
1104733244 12:131120687-131120709 ATGGATAAAAATACATTTGCAGG + Intronic
1105061488 12:133155539-133155561 ATCTTTAAAAATGCTCCTGCTGG - Exonic
1105818856 13:24062258-24062280 ATGGTTCAAAGTGCTGTTGGCGG + Intronic
1106267346 13:28122362-28122384 GTAGTTAACACTGCTGTTGCCGG - Intergenic
1109463677 13:62698372-62698394 ATAGTTTAAAATGCTTTTGCTGG - Intergenic
1109675033 13:65664101-65664123 ATGGTTTAAAAGTCTGTGGCAGG - Intergenic
1109811248 13:67515430-67515452 AAGGTTAAAAATGCTGGTGAGGG - Intergenic
1112812197 13:103231798-103231820 AAGGTTGAAAAGGCAGTTGCTGG - Intergenic
1112905337 13:104411813-104411835 ATGAATAAAAATGCTGTCTCAGG + Intergenic
1113373448 13:109742754-109742776 ATGTTTAAAAATGTTTTGGCCGG - Intergenic
1115041982 14:28941523-28941545 ATTGGTAAAAATGCAGTGGCTGG + Intergenic
1115950128 14:38711843-38711865 ATGGTTCAAAGTGCTCTTTCAGG - Intergenic
1115951777 14:38729341-38729363 AAGGTTAAAAATGCAATTTCTGG - Intergenic
1116425347 14:44783801-44783823 TTGTTTACAAATGCTGTTGTGGG - Intergenic
1122057586 14:99115082-99115104 ATGGGTAAATAGGCTGTGGCAGG + Intergenic
1128547844 15:68579525-68579547 AGGGTTAAAAATGCAGTCCCGGG - Intronic
1128964326 15:72042754-72042776 ATCTATAAAAAAGCTGTTGCAGG + Intronic
1129024700 15:72559569-72559591 ATACTTAAAAATACAGTTGCTGG - Intronic
1129075262 15:72989556-72989578 AATGTTAAAAACTCTGTTGCTGG - Intergenic
1130827912 15:87568336-87568358 TAGGTGGAAAATGCTGTTGCTGG + Intergenic
1131639323 15:94273262-94273284 ATGGTTAATTCTGCAGTTGCTGG - Intronic
1131682943 15:94742850-94742872 ATTTTTAAAAATCATGTTGCTGG - Intergenic
1131988719 15:98071099-98071121 ATGGTTAAAAATCTGGTTCCAGG - Intergenic
1132564716 16:616636-616658 AAGTTTAAAAATGCTGCTTCTGG - Intronic
1133448689 16:5885158-5885180 ATGGTTTACCACGCTGTTGCAGG + Intergenic
1136264735 16:29108340-29108362 ATTTTTAAAAATGGTGTTGAAGG + Intergenic
1136634187 16:31508723-31508745 AGGGTTAAAAATACAGTCGCTGG - Intronic
1139543161 16:67634098-67634120 ATAAATAAAAATGCTTTTGCTGG - Intronic
1141016116 16:80451454-80451476 TTGGTTAAAAATACAGTTTCAGG - Intergenic
1143640718 17:8195493-8195515 ATATTTTAAAATGCTGTTGGGGG - Intergenic
1144643451 17:16952477-16952499 ATGGTTGCAAATGGTTTTGCAGG + Exonic
1144648071 17:16988781-16988803 ATGGTTTCAGATGCTGCTGCAGG - Intergenic
1146424074 17:32719319-32719341 ATGTTTAAGGATGCTATTGCAGG - Intronic
1147369803 17:39984533-39984555 ATGGAAAACAATGCTGTTCCTGG - Intronic
1149148014 17:53521346-53521368 GAGATTAAAATTGCTGTTGCAGG - Intergenic
1151137097 17:71957375-71957397 ATGGTTTAAAAGGGTGTGGCAGG + Intergenic
1155245192 18:23901719-23901741 ATGGCTTAAAATGCCTTTGCTGG - Intronic
1157052367 18:44181463-44181485 ATGGTAATAAATGCTGTTACTGG - Intergenic
1158260129 18:55597416-55597438 ATGGTTAAAAAGGCTGAGGTGGG + Intronic
1158388985 18:57027558-57027580 ATGGCTAAAAATGCTGATCTGGG - Exonic
1159592511 18:70350758-70350780 ATTATTAAAAATGCTATTTCTGG + Intronic
1159706058 18:71690061-71690083 ATGGTTAAAATTTCTAGTGCTGG - Intergenic
1162794671 19:13080540-13080562 ATGGTTTAAAATGTTGAGGCTGG + Intronic
927192654 2:20527457-20527479 ATGGTTAAACATGCAGGTTCTGG - Intergenic
928070041 2:28205896-28205918 AATATTAAAAATTCTGTTGCTGG + Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
928804766 2:35137297-35137319 ATGTTTAAAAATAGTGTTGGTGG - Intergenic
929006293 2:37396635-37396657 TTTGTTAAAAATGCTGATTCTGG + Intergenic
929692922 2:44089505-44089527 ATGGTTTAAAAAGTTCTTGCTGG - Intergenic
930699226 2:54442547-54442569 ATAGTCAGAAATGCTGTTGGTGG - Intergenic
931991177 2:67791931-67791953 ATGGATAAAAATGATGGAGCAGG - Intergenic
932882274 2:75514259-75514281 AAGGTTAAAAATCCTATTTCTGG + Intronic
933249183 2:80009312-80009334 ATGCTTTAAAATGATGTTGGGGG - Intronic
933262634 2:80147442-80147464 ATGGATATAAATGCTGTTGTTGG + Intronic
933653674 2:84870092-84870114 TTGCTTAAAAATGCTTTTCCGGG - Intronic
935176363 2:100652873-100652895 CTGGTTAAAACTGCTGTTGCAGG - Intergenic
935230823 2:101094343-101094365 AGGGTTAAAGCTGCAGTTGCAGG + Intronic
935264171 2:101380641-101380663 ATGGTTAAAAATGCTGTTGCAGG + Intronic
938678824 2:133667752-133667774 ATGATTAAAAATGCTATTGAAGG - Intergenic
939134741 2:138279891-138279913 CTTGTTAAAAATGCTGGTTCTGG - Intergenic
939802963 2:146735790-146735812 TAGGTGAAAAATGCTGATGCAGG - Intergenic
943780112 2:191814090-191814112 GTGTTTCAAAATGCTGCTGCCGG - Intergenic
944929097 2:204497924-204497946 GTGGGTAAGAATGTTGTTGCTGG + Intergenic
945205791 2:207330835-207330857 AAGGTTATAAATGCTGCTGTAGG - Intergenic
945214784 2:207421728-207421750 ATTGTTGAAAATGCTGTGGGGGG - Intergenic
948556990 2:238819182-238819204 TCGGTGAAAAATGCTGTTGGTGG - Intergenic
948766315 2:240223100-240223122 ATGGCTGAAGATGCTGCTGCTGG - Intergenic
1170038107 20:12011521-12011543 AAGGTGAAAGATGCTGGTGCTGG - Intergenic
1170606022 20:17875608-17875630 ATGGTTTAAAATGCAGTGGGGGG + Intergenic
1170859972 20:20093785-20093807 ATTTTTAAAAATCCTGTTGCAGG + Intronic
1172206542 20:33166745-33166767 ATGGGTAAACACGCTGTTCCTGG - Intronic
1172344846 20:34190026-34190048 TGGGTTAGAAAGGCTGTTGCGGG - Intergenic
1174734781 20:52955673-52955695 ATGGTGATAAATGCTGTCACTGG + Intergenic
1175461008 20:59151919-59151941 ATGGTTGAACATGCTGGTGTGGG + Intergenic
1177274688 21:18894367-18894389 ATGGTAAATAAAGTTGTTGCTGG + Intergenic
1177536594 21:22436299-22436321 ATGTTTTAAAATGCTGCTGCAGG + Intergenic
1177941515 21:27417315-27417337 GTGGTTAAAAATAATGTTGAAGG - Intergenic
1180896357 22:19336507-19336529 CTGGTTAGAAAGGATGTTGCAGG - Intronic
1181779785 22:25184394-25184416 ATGGTAATGACTGCTGTTGCTGG + Intronic
1182553466 22:31115376-31115398 ATTGTTAAAAATGATGCAGCAGG + Intronic
949485187 3:4531341-4531363 TTGGTGAGAAATGTTGTTGCCGG - Intronic
951104820 3:18730511-18730533 CTGGGTATAAATGATGTTGCTGG - Intergenic
951658809 3:25039370-25039392 ATGGTGAAAAATGTTGTTCTGGG + Intergenic
952320509 3:32273256-32273278 ATGTTTAAAAATGTTTTAGCTGG - Intronic
952320563 3:32274011-32274033 ATGTTTAAAAATGTTTTAGCTGG + Intronic
953655572 3:44850594-44850616 ACGTTTAAAATTGCTGTTGTAGG - Intronic
954639080 3:52087391-52087413 GTGGTTAAAAAGACAGTTGCTGG - Intronic
955761697 3:62291685-62291707 ATTGTTCAAGATGATGTTGCTGG - Intronic
957572619 3:81967467-81967489 AGGGTTTAAAATGCTGGTCCTGG + Intergenic
957797125 3:85024063-85024085 AAGTTTAAAAATGCTATGGCTGG - Intronic
958070846 3:88609187-88609209 ATGTTTAATAATAATGTTGCTGG + Intergenic
958482513 3:94661100-94661122 TTGGATAAAAATTATGTTGCTGG - Intergenic
959275436 3:104271536-104271558 ATGGCTAAATAGGCAGTTGCTGG + Intergenic
960842758 3:121977315-121977337 ATGTTTATAAAAGCTGTTGGTGG - Intergenic
962301563 3:134248282-134248304 ATGCCCAGAAATGCTGTTGCTGG - Intronic
964459421 3:156906654-156906676 ATGGTTAAAAATGACATTACTGG - Intronic
964871394 3:161317189-161317211 AAGGTTAAACAGGCAGTTGCTGG - Intergenic
965036551 3:163446539-163446561 ATGTTTAAATGTGCTGTTGTGGG - Intergenic
965594439 3:170396557-170396579 ATGGTTAAAGTTGCTGTGGTTGG + Exonic
965640588 3:170825221-170825243 ATGGTTAAAAAGTATATTGCTGG + Intronic
966233437 3:177673991-177674013 TTAGATAAAACTGCTGTTGCTGG - Intergenic
967414489 3:189201339-189201361 ATTTTTAAAAATCCTATTGCAGG - Intronic
968496804 4:922784-922806 ATGTTTAAGAGTGCAGTTGCTGG - Intronic
971638659 4:29099304-29099326 ATGTTTACAAATCCTGTGGCTGG + Intergenic
971740772 4:30517677-30517699 AGTGTTAAAAATGCAGTTCCTGG - Intergenic
972674669 4:41248947-41248969 ATGATAAAAAATTCTATTGCTGG + Intergenic
973041991 4:45479847-45479869 ATAATTAATAATGCTGTTACTGG + Intergenic
973770045 4:54198053-54198075 ATGGATAAAAATGCCATTGGGGG - Intronic
974451150 4:62061973-62061995 ATGTTCAATAATGCAGTTGCTGG + Intronic
974498988 4:62673191-62673213 ATGTTTCAAAATGCGGTTTCAGG + Intergenic
975055275 4:69922751-69922773 TTGTTTAAAAATGCTGAGGCCGG - Intergenic
975164243 4:71159691-71159713 ATTCTTAAAAATGGAGTTGCTGG + Intergenic
976315265 4:83653303-83653325 ATGTTTAAAAAGGCTGATCCAGG + Intergenic
976919320 4:90418025-90418047 ATGGTTAAAAATATGGATGCTGG + Intronic
977981409 4:103327395-103327417 CTGGTTAAAAATGCCTTTGATGG - Intergenic
981613566 4:146622418-146622440 ATTGTTAAATATGCTGTTCCTGG - Intergenic
981813236 4:148799303-148799325 ATGGTTAGAAATACTGTAGTAGG + Intergenic
982992590 4:162297481-162297503 TGGGTTAAAAATGCTGGAGCGGG - Intergenic
986216316 5:5722453-5722475 ATGGGTAAAAATGTTCATGCTGG + Intergenic
986285968 5:6359245-6359267 ATGGTTAAAAACACTGAGGCTGG + Intergenic
986829972 5:11565780-11565802 ATGGTACAAAATCCTGTTGTTGG - Intronic
988152789 5:27408117-27408139 ATGTTTAAAAATATTGATGCTGG - Intergenic
988290807 5:29283271-29283293 ATTGTTATAAATGCCTTTGCAGG + Intergenic
989145309 5:38243614-38243636 ATGATTAAAAATGTGGATGCTGG - Intergenic
989236910 5:39158596-39158618 TTGGTCAAAAATGCTGGTTCTGG + Intronic
990519196 5:56561646-56561668 GTGTTTAAACATGCTGTGGCTGG - Intronic
991218585 5:64185233-64185255 ATGATGAAAAATGCTGCTACAGG - Intronic
991677679 5:69104640-69104662 ATATTTAAACATGCAGTTGCTGG + Exonic
992376340 5:76191536-76191558 ATGGTTTAAAATGGTGTTGGGGG + Intronic
993269577 5:85776887-85776909 ATGTGTAAAAATGCAATTGCTGG - Intergenic
993859507 5:93118239-93118261 ATATTTAATAATGTTGTTGCAGG + Intergenic
994056887 5:95427118-95427140 CTGGTTAAAAATGTGGTTTCTGG - Intronic
994139712 5:96328616-96328638 ATGGTCTGAAATGCTATTGCAGG - Intergenic
996244698 5:121247324-121247346 ATTGTGAGAAATGCTGATGCAGG - Intergenic
998086548 5:139330550-139330572 AGTTTTAAAAATGTTGTTGCTGG + Exonic
998165638 5:139841526-139841548 ATAGTTAGAAATGGTCTTGCTGG + Intronic
999172196 5:149604914-149604936 ATCTTTCAAAATGCTGTTGCTGG - Intronic
999856864 5:155604650-155604672 TGGCTTAAAAATGCTGTGGCTGG + Intergenic
1000680155 5:164173564-164173586 ATGTTTAAAACTGCTTTTTCAGG - Intergenic
1000687397 5:164269387-164269409 CTTTTTAAAAATGCTGATGCTGG + Intergenic
1000764387 5:165267905-165267927 GTGGTCACAAATGCTGTTGATGG + Intergenic
1000850463 5:166333662-166333684 CTGGGTAAAAATACTGTTGATGG - Intergenic
1003158027 6:3612771-3612793 ATGTTTCAAAATGCTGGTGGAGG + Intergenic
1003693805 6:8381774-8381796 ATGTTTAAAAATGCTGATACTGG + Intergenic
1005177811 6:23067864-23067886 TTGGATAAAAATGGTGTTGAGGG + Intergenic
1006908635 6:37549520-37549542 ATAGTTAAAGATGCTGCTCCAGG - Intergenic
1008781639 6:55113593-55113615 ATGGATAAAATTACTCTTGCAGG - Intronic
1010163880 6:72892662-72892684 ATGATAAAAATTGCTGTAGCAGG - Intronic
1010494992 6:76523247-76523269 ATGGTGAAAAATTCAGCTGCAGG - Intergenic
1012157184 6:95834061-95834083 ATGATGAATAATGATGTTGCTGG + Intergenic
1012453226 6:99375683-99375705 ATCTTGAAAAATGCTGGTGCTGG - Intronic
1014250213 6:119107863-119107885 ATTGTTGGAGATGCTGTTGCTGG + Intronic
1014520391 6:122435670-122435692 ATTGTTAAAAAGGATGATGCCGG + Intergenic
1015090474 6:129350755-129350777 ATGATTAATACAGCTGTTGCTGG - Intronic
1015605714 6:134952988-134953010 ATGGGTCAGAATGCTGTTACAGG - Intergenic
1016721970 6:147309100-147309122 ATGGTTAAAAGTGCTAGTTCTGG - Intronic
1017620002 6:156286866-156286888 ATGGTTATTACTGCTGTTCCAGG - Intergenic
1017761045 6:157568638-157568660 ATGCCTAAAAATGCTGTTGCTGG + Intronic
1017791378 6:157802570-157802592 AAGGTTAAAAATGTTATTACTGG - Intronic
1018323699 6:162640783-162640805 ATGGTTCATAATGCTGGTACAGG + Intronic
1018359241 6:163049731-163049753 ATAGTTAAAAATGGTATTTCAGG - Intronic
1019040282 6:169098205-169098227 TTGGTTAAAAGTGTTGTTGGGGG + Intergenic
1019847291 7:3517839-3517861 ATAGTTAAAATTGCTCTTTCTGG + Intronic
1021236791 7:18152508-18152530 CTTGTTTAAAATGCTGTTTCTGG + Intronic
1024694756 7:51844715-51844737 ATTTTTAAAAATACTGTTCCTGG + Intergenic
1025050551 7:55730573-55730595 ATTGGTAGAAATGCTATTGCTGG - Intergenic
1027584579 7:80042459-80042481 ATAGTTCAAAATGCTGCTACTGG + Intergenic
1027809801 7:82881074-82881096 ATGGCTAAAAGTGTAGTTGCAGG + Intronic
1027812354 7:82920272-82920294 ATGATTAAAGATGATGTAGCTGG + Intronic
1031502684 7:122539627-122539649 TTGGTTACAAAGGCTGTTGATGG - Intronic
1032721337 7:134552881-134552903 ATGGTAAAAGATCCTGTTGGAGG - Intronic
1033266044 7:139888091-139888113 TTGGTTAAAAATGCGCTTACTGG - Intronic
1033810245 7:145003521-145003543 ATGGTAAAATATGCTGTTTATGG + Intergenic
1035957495 8:4097789-4097811 ATGATTACAAATGCTGTGGGTGG + Intronic
1038313386 8:26463001-26463023 ATGGTTAAAAATGGTTATCCAGG - Intronic
1038777359 8:30543096-30543118 GTGGTTTAACATACTGTTGCTGG - Intronic
1038898245 8:31812169-31812191 ATGTTTAAAAATCTTGATGCTGG + Intronic
1039248412 8:35634616-35634638 AAGGTTACAAATACTGATGCAGG + Intronic
1041542601 8:59002928-59002950 ATGCTTATAAATGCTGGTGAAGG + Intronic
1042767642 8:72343410-72343432 ATTGTCAATAATGCTGTTGTTGG + Intergenic
1043635873 8:82381090-82381112 TTGGTTCAAAATGTTGTTGTTGG - Intergenic
1044988377 8:97774695-97774717 ATGATTAAAAACGCTGTGCCAGG + Intergenic
1045007281 8:97927665-97927687 AAGGTTCAAAATGTTGTTGGAGG - Intronic
1045170373 8:99659982-99660004 ATGATTAAAAAGTCTGTTGCTGG - Intronic
1045396874 8:101769674-101769696 CTGGTGAAAGATGCCGTTGCAGG - Intronic
1045475970 8:102552830-102552852 ATGGTTGAAAGTGCTGTCCCTGG + Intronic
1046623413 8:116551928-116551950 GTGGTTAAAAATGCAGATCCTGG - Intergenic
1047063670 8:121256010-121256032 ATGATAAAAGATGCTGTTTCAGG - Intergenic
1047488498 8:125354597-125354619 GTGGTTAAAAATGCTCTGACTGG + Intronic
1047649463 8:126904230-126904252 ATTGTTTAAAATGCCTTTGCTGG + Intergenic
1051356578 9:16244706-16244728 ATAGTTAAAAATGCGGTCCCTGG + Intronic
1051521639 9:17995803-17995825 CTGGATAAAAATGCTGGTGCTGG + Intergenic
1053163114 9:35827332-35827354 ATGGATTAAAATGCTGTGGATGG - Intronic
1055540556 9:77300433-77300455 ATAATTGAAAATGCAGTTGCTGG + Intronic
1055683939 9:78749854-78749876 ATTTTTAAAAATGCTTTTTCTGG + Intergenic
1056822288 9:89852049-89852071 CTGCTGAAAAATGCTGTTGTGGG + Intergenic
1056880860 9:90392331-90392353 ATAGTGAAACATCCTGTTGCTGG - Intergenic
1057578870 9:96267768-96267790 ATGTTGAAAAATGTTGTTTCTGG - Intronic
1057981156 9:99665229-99665251 ATGGTGATAGATGCTGTGGCAGG + Intergenic
1186335450 X:8582268-8582290 ATGGCTAAAGATGGTTTTGCTGG + Intronic
1187298088 X:18021980-18022002 ATGCTTAAAAATGCAGTGACGGG - Intergenic
1190107028 X:47568419-47568441 ATGATTAGAAATGCTGCTGTAGG + Intronic
1190652299 X:52578970-52578992 TTTTTTTAAAATGCTGTTGCTGG + Intergenic
1192319902 X:70082229-70082251 CTGGTTAAAAATGCTGTCACGGG - Intergenic
1192487042 X:71536713-71536735 ATGGTTATGTATGCTGTGGCAGG + Intronic
1192720447 X:73691196-73691218 ATGGTTAAAAAAACTCTTGGTGG + Intergenic
1196714413 X:118797764-118797786 AGGGCTCAAAGTGCTGTTGCTGG + Intergenic
1197237712 X:124086893-124086915 ATGTGTAAACATGCTGTTGTAGG + Intronic
1198853618 X:140992645-140992667 ATGGTAAAAAAGGAAGTTGCTGG + Intergenic
1199495693 X:148449826-148449848 ATGTTTAAAAATGATATAGCCGG - Intergenic
1201428101 Y:13876026-13876048 ATGGCTAAAGATGCTTTTGCTGG - Intergenic
1202096247 Y:21250867-21250889 ATATTTAAGTATGCTGTTGCTGG + Intergenic