ID: 935264856

View in Genome Browser
Species Human (GRCh38)
Location 2:101385553-101385575
Sequence ACAACAAGGTGCACTTTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935264856_935264859 -3 Left 935264856 2:101385553-101385575 CCTAACAAAGTGCACCTTGTTGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 935264859 2:101385573-101385595 TGTTACTTGCTCAGAATTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 202
935264856_935264858 -4 Left 935264856 2:101385553-101385575 CCTAACAAAGTGCACCTTGTTGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 935264858 2:101385572-101385594 TTGTTACTTGCTCAGAATTCAGG 0: 1
1: 0
2: 2
3: 14
4: 199
935264856_935264860 -2 Left 935264856 2:101385553-101385575 CCTAACAAAGTGCACCTTGTTGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 935264860 2:101385574-101385596 GTTACTTGCTCAGAATTCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935264856 Original CRISPR ACAACAAGGTGCACTTTGTT AGG (reversed) Intronic
900945867 1:5831047-5831069 TCCAGAAGGTGCCCTTTGTTAGG - Intergenic
904914191 1:33958081-33958103 ACAGCAAGGCGAACTTTGGTAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
911303641 1:96206622-96206644 ACAACAGGGTGGGCATTGTTTGG - Intergenic
914674025 1:149893885-149893907 AAAACAATGAGTACTTTGTTGGG + Intronic
917135295 1:171783314-171783336 ACAATAAAGTACACTTTGTGAGG - Intronic
918398220 1:184137621-184137643 ACTAGAAGGTGCCATTTGTTTGG - Intergenic
918574581 1:186041957-186041979 ACAACATGGTCCACATTGTCTGG - Intronic
921972993 1:221170871-221170893 ACCACATGGTCCACTTTGATTGG - Intergenic
922380248 1:225016054-225016076 ACAAAAAGGTCAACTTTTTTTGG + Intronic
1063726294 10:8641209-8641231 AAAACATAGTGTACTTTGTTGGG + Intergenic
1064944136 10:20769479-20769501 ACCACAAGGGGCTCTTTGTGAGG - Intergenic
1065808433 10:29417886-29417908 ACAAAAAGGAGCTCTTGGTTGGG - Intergenic
1069141662 10:64835118-64835140 ACAACAATGTACAATTTATTTGG - Intergenic
1069716755 10:70526108-70526130 ACAACAGGGGCCACCTTGTTGGG - Exonic
1070818816 10:79342859-79342881 ACAACAAGCTCCACTTTGCAGGG + Intergenic
1071110150 10:82146572-82146594 ACATCAGGGTGCACGCTGTTGGG - Intronic
1073149054 10:101299258-101299280 AAAGCAAGGGGCACTTTGTGGGG - Intergenic
1074157452 10:110811237-110811259 ACACCAAGGTGCATCTTGCTAGG - Intronic
1076405648 10:130210916-130210938 AAAACAAGGTGAAGTTTATTAGG + Intergenic
1078313240 11:10267356-10267378 ACTATAAAGTGCACTCTGTTAGG - Intronic
1081775466 11:45673447-45673469 ACAACCAGGTGCAGTTTGGTTGG - Intergenic
1086477004 11:87187550-87187572 ACAACAAACTACATTTTGTTAGG - Intronic
1087574414 11:99972396-99972418 TCAGCAAGAAGCACTTTGTTTGG + Intronic
1088845862 11:113666403-113666425 ATAACAAGGTGCAATTTATCAGG - Intergenic
1096374996 12:51101615-51101637 AAAACAGGGTGCCCATTGTTAGG - Intronic
1099528129 12:83741061-83741083 ACAACAAACTACACTTAGTTTGG - Intergenic
1100420611 12:94429482-94429504 AGCACAAGGTGCAGTCTGTTGGG - Intronic
1116099614 14:40416888-40416910 GCATCAAGATGCAGTTTGTTTGG - Intergenic
1122226201 14:100281580-100281602 ACTCCAAGCTGCACTTTCTTGGG + Exonic
1127597659 15:60502794-60502816 ACAACACCGTGTACTTTGATGGG - Exonic
1132422658 15:101686654-101686676 ACAATTAGGTGATCTTTGTTGGG + Intronic
1138216715 16:55211023-55211045 ACAACAAGCTGCTCTTTCCTTGG + Intergenic
1138757077 16:59500790-59500812 TCAACAAGCTGACCTTTGTTTGG + Intergenic
1140188272 16:72793593-72793615 AAAACAGAGTGCACTTTGTGTGG - Exonic
1140884898 16:79234598-79234620 ACAACATGTTGCTCTTTCTTTGG - Intergenic
1144512393 17:15888255-15888277 ACAACAGTGTTCATTTTGTTTGG + Intergenic
1146680101 17:34800973-34800995 GCAACAAGGTGAACTTATTTTGG - Intergenic
1149273362 17:55007476-55007498 ACAACAGGGTGCACATTAATTGG - Intronic
1153212670 18:2785272-2785294 ACAACAAACTGCTCTGTGTTAGG - Intronic
1153560319 18:6365983-6366005 CAAACAGGGTGCACTCTGTTAGG + Intronic
1156647944 18:39189378-39189400 AGAACAAGTTGTACTTTGTTTGG + Intergenic
1158535644 18:58305993-58306015 ACACCATGGTCCACTTTGCTGGG - Intronic
1160292064 18:77603948-77603970 ACACCCAGGGGCATTTTGTTTGG - Intergenic
1160500289 18:79398277-79398299 AGAACAGGGTGAGCTTTGTTTGG - Intronic
927048221 2:19301624-19301646 ACAACAATTTGCTCTTTATTAGG - Intergenic
933227247 2:79765118-79765140 AAAACAATGTGCACAATGTTTGG + Intronic
935264856 2:101385553-101385575 ACAACAAGGTGCACTTTGTTAGG - Intronic
936010336 2:108921407-108921429 CCAAGGATGTGCACTTTGTTTGG + Intronic
940152077 2:150613627-150613649 AAAACAAAATGCATTTTGTTGGG + Intergenic
941406082 2:165090646-165090668 GCAATAAGCTGGACTTTGTTGGG + Exonic
942776043 2:179583992-179584014 ACAACAAGTAGCAGGTTGTTTGG - Intronic
945257837 2:207817015-207817037 ACTGCAAGGTACACGTTGTTAGG - Intergenic
1171404255 20:24899218-24899240 CCAACAAGGGGCACTGTTTTGGG + Intergenic
1175251410 20:57612166-57612188 AGAACAAGGAGCTCATTGTTTGG - Intronic
1177463396 21:21442459-21442481 AAAACTAGGTGCATCTTGTTTGG + Intronic
1179725892 21:43341070-43341092 AGAAGAAGGTGCACTTCGTGGGG - Intergenic
1185406607 22:50655806-50655828 ACAAAATGGTGCAATTAGTTTGG - Intergenic
949439215 3:4062414-4062436 ACAATAAGCTGCACTTTGTAAGG - Intronic
950387749 3:12673376-12673398 ACAAGAAGGTGTACTTGGCTGGG + Intergenic
954055022 3:48015659-48015681 ACATCAAGCTGAACTTTGTCTGG + Intronic
959361521 3:105399790-105399812 ACAACAAGAGCCACTCTGTTTGG + Intronic
962718858 3:138153566-138153588 ATAAGAAGGTGAACTTTCTTAGG + Intergenic
962976943 3:140454219-140454241 ACAACATGGCCCACTATGTTGGG + Intronic
963756939 3:149244379-149244401 AGAACACGGTGAACTATGTTGGG + Intergenic
966288836 3:178330639-178330661 ACAACAAGGTGAAGATTTTTAGG + Intergenic
966630388 3:182067652-182067674 AGAACATGGTGCACTTTTGTTGG - Intergenic
969163687 4:5284878-5284900 ACCACAAGTGGCACTTTGTATGG - Intronic
969966470 4:11001935-11001957 ATAAAATGGTGCACTTTTTTAGG + Intergenic
970188476 4:13486647-13486669 ACAAAAAGTTGCACTATTTTAGG + Intergenic
979105094 4:116675124-116675146 ACAACAAAGAGTACTTTGCTCGG + Intergenic
984966718 4:185145773-185145795 ACAAAAATGTGCACGTTCTTGGG - Exonic
987066542 5:14295568-14295590 AGCACAAGATGCACTCTGTTAGG - Intronic
987621016 5:20338664-20338686 ACAACAAGGAGGAATATGTTTGG + Intronic
1001775214 5:174323804-174323826 ACATCAACGTCCACATTGTTGGG + Intergenic
1008739142 6:54584005-54584027 ACAGCAATGTGCACTGTGATGGG - Intergenic
1023917889 7:44604068-44604090 ACAACAAGGTGTGATCTGTTTGG - Intergenic
1028122529 7:87072239-87072261 ACAACCAGGTGTACTTTGCCTGG - Intergenic
1029255772 7:99268510-99268532 ACAGCAAGATGCAGTCTGTTTGG - Intergenic
1030535925 7:110766984-110767006 AAAACAAGGTCCTCCTTGTTTGG + Intronic
1030842290 7:114370521-114370543 ACAACAAGCAGCACTTTGCCAGG - Intronic
1033345674 7:140523930-140523952 ACAACAAGGTACAGATTGATTGG - Intronic
1043539884 8:81249441-81249463 ACCACTAGTGGCACTTTGTTGGG - Intergenic
1043551073 8:81373540-81373562 ACAACAACTTGTACTTTTTTAGG - Intergenic
1047380319 8:124355996-124356018 ACTACAATGGGCACTTTCTTAGG - Intronic
1048396866 8:134022231-134022253 ACCACAAGGGGCACTTAGTGGGG + Intergenic
1055114203 9:72589610-72589632 ACAATCAGGTGCAGTTTGTAAGG + Intronic
1055191475 9:73529997-73530019 ACAACAAGGAGCATTCTTTTGGG + Intergenic
1055247544 9:74265004-74265026 ATAACAAGGTACACTTTGGGAGG + Intergenic
1058901616 9:109447154-109447176 ATAACAAGGGGCATTTTGTTTGG + Intronic
1059057586 9:111000373-111000395 ACAACAGGCTCCACTTTGATCGG + Intronic
1195912482 X:109902572-109902594 ACAGCAAGGTGCCTTTTGGTGGG + Intergenic
1196101822 X:111854649-111854671 TCATCAATGTGCACTCTGTTTGG + Intronic
1196680548 X:118465585-118465607 ACAACAAGGTGCATCTTCCTGGG - Intergenic
1199707100 X:150437224-150437246 ACGGCAGGGTGCACTTTCTTTGG + Intronic