ID: 935265999

View in Genome Browser
Species Human (GRCh38)
Location 2:101394808-101394830
Sequence CCGGACAGGGCCTCGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935265993_935265999 21 Left 935265993 2:101394764-101394786 CCTCTCTCTTTCTTCTTCTTTTT No data
Right 935265999 2:101394808-101394830 CCGGACAGGGCCTCGCTCTGTGG No data
935265994_935265999 -3 Left 935265994 2:101394788-101394810 CCTTCTTTTTTTTTTTTTTTCCG No data
Right 935265999 2:101394808-101394830 CCGGACAGGGCCTCGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935265999 Original CRISPR CCGGACAGGGCCTCGCTCTG TGG Intergenic
No off target data available for this crispr