ID: 935266999

View in Genome Browser
Species Human (GRCh38)
Location 2:101403238-101403260
Sequence AAGTGGGTAAGGAGGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935266986_935266999 22 Left 935266986 2:101403193-101403215 CCTTGCCCCTCTTGCAGACCCTG 0: 1
1: 0
2: 1
3: 38
4: 430
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
935266992_935266999 3 Left 935266992 2:101403212-101403234 CCTGTGGCTGCAGCTCTTTGTGT 0: 1
1: 0
2: 2
3: 22
4: 278
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
935266991_935266999 4 Left 935266991 2:101403211-101403233 CCCTGTGGCTGCAGCTCTTTGTG 0: 1
1: 0
2: 2
3: 24
4: 254
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
935266990_935266999 15 Left 935266990 2:101403200-101403222 CCTCTTGCAGACCCTGTGGCTGC 0: 1
1: 0
2: 1
3: 24
4: 257
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
935266988_935266999 17 Left 935266988 2:101403198-101403220 CCCCTCTTGCAGACCCTGTGGCT 0: 1
1: 0
2: 2
3: 29
4: 212
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238
935266989_935266999 16 Left 935266989 2:101403199-101403221 CCCTCTTGCAGACCCTGTGGCTG 0: 1
1: 0
2: 1
3: 26
4: 213
Right 935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935266999 Original CRISPR AAGTGGGTAAGGAGGCCAGC TGG Intronic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
903220023 1:21864328-21864350 AAGTGGGGAAGGAGGGGCGCCGG - Intronic
903327614 1:22579995-22580017 AGGTGGGGATGGAGTCCAGCTGG + Intronic
904237023 1:29122750-29122772 AGGCGGGAAAGGAGGCCAGGCGG - Intronic
905319288 1:37104592-37104614 AAGTAACTAGGGAGGCCAGCAGG + Intergenic
905863459 1:41364838-41364860 AAGTGGGGAAGTAGGCTTGCTGG - Intronic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
907497092 1:54852401-54852423 AAGTGGGTGAGGACGCCAGGAGG + Intronic
907715111 1:56919351-56919373 AAGTGCTGAAGGAGGCCAGGTGG + Intergenic
907973055 1:59403585-59403607 AGGTGGGTATGGGGGCCACCTGG + Intronic
909658399 1:78055804-78055826 CAGTGGATAAGGAGTCCTGCAGG + Intronic
910338338 1:86157186-86157208 AAGTGGGAAAGGAGACCATCCGG - Intergenic
910773440 1:90851740-90851762 CAGGGGAAAAGGAGGCCAGCGGG - Intergenic
913439768 1:118885118-118885140 AAGTGGGAAAGGACCCCAGCTGG + Exonic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915557942 1:156670447-156670469 AAGGGAGTCAGGAGGCTAGCTGG - Exonic
919340597 1:196301702-196301724 AAGTGTGTAAGCAGCCAAGCTGG + Intronic
920445647 1:206014147-206014169 AGGTGGGAAATGGGGCCAGCAGG + Intronic
921796510 1:219350930-219350952 AAGAGGGTGAGGAGCCCAGTGGG + Intergenic
924928119 1:248703269-248703291 TAGTGAGCAAGGAGGACAGCTGG - Intergenic
1064033009 10:11894807-11894829 AAGCGGGGGAGGAGGCCCGCTGG + Intergenic
1065023403 10:21518755-21518777 GAGTGGGGAAGGAGACCGGCTGG + Exonic
1067573528 10:47388953-47388975 AAGTGAGCAAGGAAGCCAGTAGG - Intergenic
1068961369 10:62869833-62869855 AAGTGGGGAAGGATGGCAACTGG - Intronic
1069564297 10:69452854-69452876 AAGGGGCTAAGGAGGACACCAGG - Intronic
1070595803 10:77832371-77832393 AAGTAGGTCAGGAGCCCAGTGGG - Intronic
1070917648 10:80165139-80165161 GAGGGGGTCAGGAGGCCATCAGG - Intronic
1073218290 10:101849101-101849123 AAGTGGGTACAGAGGCCTGCAGG + Intronic
1073726998 10:106244276-106244298 AAGAGGGGAAGTTGGCCAGCAGG - Intergenic
1073989171 10:109243615-109243637 AAGCGGGGAAGGTGGCCAGAGGG - Intergenic
1075048867 10:119166918-119166940 AAGTGGGGAAGCAGGCCAGCGGG - Intergenic
1076474517 10:130743075-130743097 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1076474537 10:130743135-130743157 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1076474545 10:130743155-130743177 AGGTGGGGAAGGAGGCGGGCAGG - Intergenic
1076503793 10:130958158-130958180 CAGCCGGTAAGCAGGCCAGCGGG - Intergenic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077917498 11:6621139-6621161 ATATGGGCAAAGAGGCCAGCAGG - Intergenic
1078545303 11:12242578-12242600 AAGTGGGTGAGGGAGGCAGCCGG - Intronic
1081525516 11:43925056-43925078 GAGAGGGAAAGGAGGACAGCTGG + Intergenic
1083098491 11:60278743-60278765 AAGAGGGTAAGGAAGATAGCAGG - Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085263946 11:75225290-75225312 AGGTGGGCAATGAGGCCAGGTGG - Intergenic
1085593428 11:77786933-77786955 AACTGGGTAAAGAGGCAAACAGG + Intronic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1088999943 11:115043555-115043577 GAATGGAGAAGGAGGCCAGCAGG - Intergenic
1090042549 11:123303409-123303431 GAGTGAGAAAGGAGGCCAGGAGG + Intergenic
1090288031 11:125517183-125517205 AAGGAGGAAAGGAGGGCAGCTGG - Intergenic
1092196251 12:6551330-6551352 AGGTGGGCAATGAGGCCAGCCGG - Intronic
1092330598 12:7583595-7583617 AAGTGGGCAAGTAGGCCTGCAGG - Intergenic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1094702342 12:32881918-32881940 CTGTGGGAAAGGAGGCTAGCAGG + Intronic
1096413838 12:51395681-51395703 AGGTTAGTAGGGAGGCCAGCTGG + Intronic
1097344759 12:58478421-58478443 AAGAGGGTAAGGAAGCTAGGTGG + Intergenic
1098874751 12:75855326-75855348 TAGTGGGTTAGGCAGCCAGCAGG - Intergenic
1099763801 12:86956116-86956138 ATGTGGGGAAGGAGGGCATCAGG - Intergenic
1100400501 12:94225188-94225210 AAGTTGGGATGGAGGCCTGCAGG + Intronic
1104065184 12:125299932-125299954 GAGTGAGGAAGGAAGCCAGCAGG - Intronic
1104434243 12:128743127-128743149 AAGTGAGGAAAGAGACCAGCAGG + Intergenic
1106342489 13:28843841-28843863 AACTGGGTAAGCATGCCAGTAGG + Intronic
1107477298 13:40750961-40750983 AAGTGGGTAAAGAGGTAAGCTGG - Intronic
1107808594 13:44178078-44178100 AAGTGGGGAGGAAGGACAGCTGG + Intergenic
1111888711 13:94054752-94054774 AAGTGGGTTAGGAGACCTGTGGG + Intronic
1112157261 13:96831657-96831679 AAGAGATTAAGGAGGCCAGCAGG + Intronic
1113675404 13:112203290-112203312 GACTGGACAAGGAGGCCAGCAGG - Intergenic
1114525162 14:23363579-23363601 GAGTGGGGAAGGAGGCCCTCTGG - Intronic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1120832390 14:89008869-89008891 GAGTGGATAAGGAGGTGAGCAGG + Intergenic
1121221391 14:92288235-92288257 AAGTGGCCAGGGAGGCAAGCTGG - Intergenic
1122029332 14:98901194-98901216 AAGAGGGAAAGGAGGCAGGCAGG - Intergenic
1122393863 14:101408942-101408964 AATTTAGCAAGGAGGCCAGCAGG - Intergenic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1124139360 15:27063867-27063889 AAGTGGGTGAGCAGGCCGGGTGG - Intronic
1126450578 15:48804109-48804131 AAGTGGGGACTGTGGCCAGCTGG + Intronic
1130056898 15:80533815-80533837 AAGTGGGCCAGGAGGCCCCCAGG - Intronic
1131013791 15:89041117-89041139 AACTGTGTAAGGAGGCCAAGAGG + Intergenic
1132032923 15:98453033-98453055 AAGTGAGTCACAAGGCCAGCTGG - Intronic
1132517491 16:372594-372616 ATGTGGGTAAGGAGCCGGGCTGG - Exonic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1134490365 16:14691556-14691578 ATGTAGGAAACGAGGCCAGCCGG + Intronic
1134495746 16:14730673-14730695 ATGTAGGAAACGAGGCCAGCCGG + Intronic
1134501292 16:14770984-14771006 ATGTAGGAAACGAGGCCAGCCGG + Intronic
1134579289 16:15358050-15358072 ATGTAGGAAACGAGGCCAGCCGG - Intergenic
1134723293 16:16399504-16399526 ATGTAGGAAACGAGGCCAGCCGG + Intergenic
1134944135 16:18312366-18312388 ATGTAGGAAACGAGGCCAGCCGG - Intergenic
1136516729 16:30773029-30773051 TAGGGGGTTAGGAGGCCTGCGGG + Intronic
1137612345 16:49827180-49827202 AAGTGGGTGATGAGGTCAGATGG - Intronic
1138010381 16:53373584-53373606 ATGTGGGAAACGAGGCCAGGGGG + Intergenic
1138414145 16:56861604-56861626 AAGTGGGTAGGGAGGCCTGTGGG + Intergenic
1143266175 17:5639672-5639694 ACGCCGGTAAGGAGACCAGCTGG - Intergenic
1143647024 17:8237268-8237290 ATGTAGGAAAGGAGGACAGCTGG - Intronic
1145231217 17:21174765-21174787 AATGGGGTGAGGAAGCCAGCAGG + Intronic
1145969903 17:28950619-28950641 AAGGGGGTGGGGAGGCCTGCCGG + Intronic
1146641832 17:34547582-34547604 AGGTGGAACAGGAGGCCAGCAGG + Intergenic
1149319118 17:55466968-55466990 AAGGGGGAAATGAGGCCATCAGG + Intergenic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1152192483 17:78897107-78897129 GAGGGGGTGAGGAGGCCGGCGGG - Intronic
1153239337 18:3016242-3016264 TAGAGGGTAGGGAGACCAGCTGG - Intergenic
1153781656 18:8500228-8500250 CAGTGTGTAAACAGGCCAGCAGG - Intergenic
1154399915 18:14026388-14026410 AAGTGGGGAGGGAGTCCTGCTGG + Intergenic
1157784485 18:50469605-50469627 AAGTGGGAGAGGAGAGCAGCAGG + Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159616351 18:70584414-70584436 AAGTGGGCAAGTAGGCCTGTTGG - Intergenic
1161590776 19:5128239-5128261 AATTGGGGAAGGAGGCGAGGAGG - Intronic
1162069397 19:8144757-8144779 AATGCGGGAAGGAGGCCAGCTGG + Intronic
1166555294 19:43695613-43695635 AAATTGTTAAGAAGGCCAGCCGG + Intergenic
927968363 2:27286890-27286912 AAGTGGTTGAGGAGGCAGGCTGG - Intronic
929930464 2:46251652-46251674 GAGTAGGAAAGGAGGCCAGTTGG + Intergenic
932627034 2:73305730-73305752 AAGTGGGTGTGTTGGCCAGCAGG + Intergenic
933074822 2:77909945-77909967 AATTGGGTTAGGAGACCAGTGGG - Intergenic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
934888158 2:98042468-98042490 TAGTGCCAAAGGAGGCCAGCTGG + Intergenic
935122804 2:100197195-100197217 AAGTGGGCAGAGAGGCCTGCAGG - Intergenic
935266999 2:101403238-101403260 AAGTGGGTAAGGAGGCCAGCTGG + Intronic
937266906 2:120622444-120622466 GAGTGGGGAAGCAGGACAGCTGG - Intergenic
937338384 2:121075881-121075903 AGGTGGGCAGGGAGGCGAGCTGG - Intergenic
942707573 2:178793855-178793877 AAGAGGATAAGGAGGAAAGCTGG + Intronic
946422236 2:219571377-219571399 CCGAGGGTAAGGAGGCGAGCCGG - Intronic
946626004 2:221613028-221613050 CAGTGAGAGAGGAGGCCAGCAGG + Intergenic
948827465 2:240579564-240579586 AAGCGGGTATGGAGGGCACCTGG + Exonic
949050011 2:241892584-241892606 AATTGGGTCATGAGGCAAGCAGG + Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169110974 20:3033518-3033540 AAGTGGGTTAGGATGAGAGCAGG - Intronic
1173865486 20:46309732-46309754 AATTGGGGAAGGAGGCGAGGAGG - Intergenic
1173881494 20:46416317-46416339 AAGTGAGAAAAGAGGCCAGAGGG - Intronic
1174067777 20:47878235-47878257 AAGTGGCTGAGGTGACCAGCAGG + Intergenic
1174135552 20:48376364-48376386 AGCTGGAGAAGGAGGCCAGCGGG + Intergenic
1174203953 20:48826348-48826370 AAGTGAGAAAAGTGGCCAGCGGG - Intronic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1180668776 22:17536499-17536521 AAGAGGGGAAAGATGCCAGCTGG - Intronic
1181917419 22:26292278-26292300 AAGTTGGTTTAGAGGCCAGCCGG + Intronic
1182113277 22:27739578-27739600 AGGTGGGTAGGGAGTCCAGCGGG - Intergenic
1182266082 22:29116426-29116448 AAATGGGTTAGAAGGGCAGCAGG + Intronic
1182414173 22:30210396-30210418 AAATGGGTGCGGAGGACAGCAGG + Intergenic
1182461458 22:30486632-30486654 AAGCAGGTGAGGAGGGCAGCAGG - Intergenic
1183476874 22:38040438-38040460 AAGTGGCTACAGAGGTCAGCAGG + Intronic
1183492840 22:38125997-38126019 AGGTGGTTAAGGAAGCCAGTAGG + Intronic
1184879655 22:47296911-47296933 AAGTGGGAAAGGCCGCCTGCTGG + Intergenic
1185055851 22:48577874-48577896 AAGTGGGTCAGCAAGGCAGCAGG - Intronic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
949456810 3:4247550-4247572 GAGGGGGTAAGAAGCCCAGCTGG + Intronic
950453820 3:13080650-13080672 CTGTGGGTAAGGATGCCTGCTGG - Intergenic
952332483 3:32376988-32377010 AGCTGGGTGATGAGGCCAGCAGG + Intergenic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
956411877 3:68987813-68987835 AAGGGGGAAAGGAGGACAGGAGG + Intronic
956780426 3:72599071-72599093 GGGTGGGTAAGGAGACCAGGGGG + Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
958532960 3:95357642-95357664 AAGTGTCAAAGGAGGCCACCTGG + Intergenic
958668563 3:97172357-97172379 AAATGAGTGAGAAGGCCAGCTGG + Intronic
961228691 3:125280142-125280164 AAGTGGGTATGGGGTCCATCTGG + Intronic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
961366166 3:126401150-126401172 AAGGGGGAATGGAGGCCACCGGG + Intronic
961694998 3:128698431-128698453 GAGCGGGTGAGGAGCCCAGCGGG - Intergenic
963770886 3:149384972-149384994 ATCTGTGGAAGGAGGCCAGCAGG - Intergenic
963916326 3:150861927-150861949 AAGTGGGTCTGCAAGCCAGCTGG + Intergenic
967741547 3:193008586-193008608 AAGTGTGTAAGGGTGCAAGCAGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
971764211 4:30808472-30808494 AAGAGGGAAAGGATGCCAGATGG - Intronic
974945341 4:68520502-68520524 AAATTGGGAAGGAGGCCATCTGG - Intergenic
975992223 4:80268563-80268585 AAGTGGGTAAGGCGGTAGGCTGG + Intronic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
977823307 4:101501694-101501716 GAGTGGGTAAGTAAGCCAACAGG + Intronic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
985632642 5:1021996-1022018 AGGTGGAAAATGAGGCCAGCAGG - Intronic
986205361 5:5620022-5620044 ATGGGGCTAAGGAGGTCAGCGGG - Intergenic
986897447 5:12387301-12387323 AAATGGGTTAGGAGGACAGAGGG - Intergenic
990217855 5:53553634-53553656 AAGTGGGTAAGGATGAATGCAGG + Intergenic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
992378424 5:76212651-76212673 ACGTGTTTAAGAAGGCCAGCAGG - Intronic
992789212 5:80198628-80198650 GAGGGGGTAAGGACTCCAGCAGG + Intronic
993280406 5:85919315-85919337 AGGTGGATGAGGAGGCCAGAAGG + Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994420755 5:99525057-99525079 AAGTGGAGGAGGGGGCCAGCAGG - Intergenic
994486288 5:100389257-100389279 AAGTGGAGGAGGGGGCCAGCAGG + Intergenic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997494175 5:134307244-134307266 AAGGGAGCAAGTAGGCCAGCAGG - Intronic
998054790 5:139065268-139065290 AAGTGGGTTTGGTGGCCTGCAGG - Intronic
999191091 5:149747962-149747984 GAGTGGGTGAGGAGCCAAGCAGG + Intronic
1001960482 5:175877703-175877725 AAGATGGTAAGGAGGCCAAGGGG + Intronic
1004182309 6:13391652-13391674 TATTGGGAAAGGATGCCAGCAGG + Intronic
1004585376 6:16994646-16994668 GAGTGGGTCAGGAGGTAAGCAGG + Intergenic
1005358705 6:25009885-25009907 AAGTGGGTTTTGTGGCCAGCAGG + Intronic
1005647245 6:27852579-27852601 AAGTGGGTCATGAGACCAGAAGG + Intronic
1007144024 6:39609233-39609255 ACGTGGGAAAGGAAGCCAGGCGG + Intronic
1010773741 6:79861981-79862003 CATTGGGTACAGAGGCCAGCGGG + Intergenic
1016415014 6:143822893-143822915 AGGAGGGAAAGGAAGCCAGCTGG + Intronic
1016928849 6:149382160-149382182 AAGAGAGTAAGAAGGCCAGGAGG - Intronic
1017635211 6:156436579-156436601 CACTGGGCAAGGAGGCCATCTGG - Intergenic
1019193188 6:170266122-170266144 AAGAGGAGAAGGAGGTCAGCTGG + Intergenic
1020791999 7:12638698-12638720 AAGATGGAAAGGAGACCAGCTGG - Intronic
1022479551 7:30733996-30734018 ATGAGGGTGAGGAGACCAGCTGG - Intronic
1023815201 7:43944034-43944056 GAGTTGGGAAGGAGGCCAGAGGG + Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023915972 7:44589485-44589507 AGGAGGGCAAGGAAGCCAGCGGG + Intergenic
1024568753 7:50706900-50706922 CAGAGGGTTGGGAGGCCAGCGGG - Intronic
1028088481 7:86667984-86668006 AAGTGGGTAGGAAGGAGAGCAGG - Intronic
1029100244 7:98123923-98123945 AAGTGGGAGAGGAGGCCTCCTGG - Intronic
1029558830 7:101289266-101289288 AAGTGGGAAGGGAGGTCGGCTGG - Intergenic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1034395688 7:150823213-150823235 AAGTGAGTAAGGAGCCCACATGG + Intergenic
1035044072 7:155952650-155952672 TAGTGAGTAAGGAGCCCAGGAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1038491963 8:27977767-27977789 AATTAGGTAAGGAGGCCGGAAGG - Intronic
1038830381 8:31051836-31051858 AAGTTGGTAAGGTGTCCAGTGGG + Intronic
1040109285 8:43559439-43559461 AGGTGGGCAAGGAGGCCTGCAGG + Intergenic
1040535841 8:48309143-48309165 AATTGGTGAAGGAGGGCAGCTGG + Intergenic
1041881185 8:62751231-62751253 AGGTGGATAAGGAGCCCAGGTGG - Intronic
1042669942 8:71250391-71250413 AACTGGGAAAGGGGCCCAGCGGG - Intronic
1047432626 8:124805865-124805887 AAGTGGAAAAGGACGCCATCTGG - Intergenic
1047490834 8:125373434-125373456 ATTTGAGTCAGGAGGCCAGCTGG - Intergenic
1047879508 8:129178103-129178125 AAGTGGGAGAGGAAGCCATCAGG - Intergenic
1049680525 8:143915961-143915983 GAGGGGGTGAGGCGGCCAGCAGG + Exonic
1051368172 9:16335900-16335922 AGGAGGGCAAGGAGGCCACCTGG + Intergenic
1051423968 9:16915780-16915802 AAGTGGGATCGGAGGCCAGAAGG - Intergenic
1053191802 9:36077569-36077591 AAATGGGTAAAGAGGCAAGATGG + Intronic
1054870789 9:70045555-70045577 GAGTGGGGAAGGAGGTGAGCTGG - Intronic
1054962106 9:70980386-70980408 GAGAGGCGAAGGAGGCCAGCTGG + Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1060328217 9:122639009-122639031 AAGTGAGTAAGCAGGCAAGCAGG - Intergenic
1062619690 9:137414740-137414762 AGATGGAGAAGGAGGCCAGCAGG + Intronic
1185875965 X:3702638-3702660 ACGAGGGCATGGAGGCCAGCAGG + Intronic
1186519049 X:10189327-10189349 AAGTGGATAATAAAGCCAGCTGG - Intronic
1187267228 X:17746752-17746774 AAGTGGGTGCAGAGGCGAGCTGG + Intronic
1187317233 X:18207120-18207142 AAGTGGGTGCAGAGGCGAGCTGG - Intronic
1189279155 X:39809090-39809112 AAATGAGGAAGGAGGCCCGCAGG + Intergenic
1190106785 X:47566835-47566857 AAGAGGGCATGGAGGCCAACAGG - Intronic
1190766671 X:53480965-53480987 AGGTGGATAGGGAGGCCAGAAGG - Intergenic
1190790716 X:53697333-53697355 ACGAGGGTAGGGAGGCCTGCAGG + Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192547860 X:72028528-72028550 ATCTGGGGAAGGAGGCCAGGCGG - Intergenic
1197700789 X:129598025-129598047 AAGTGGGCTGGGGGGCCAGCAGG - Intergenic
1199472986 X:148215436-148215458 AATGTGGCAAGGAGGCCAGCAGG + Intergenic
1200789615 Y:7287787-7287809 ACGAGGGCATGGAGGCCAGCAGG - Intergenic