ID: 935274294

View in Genome Browser
Species Human (GRCh38)
Location 2:101463105-101463127
Sequence CCTGTCATACAGAGGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935274294 Original CRISPR CCTGTCATACAGAGGCTGCA AGG (reversed) Intronic
900094797 1:936011-936033 CCTGTCCCCCAGGGGCTGCATGG + Intronic
900103417 1:972266-972288 CCTGGCATACAGATGCTGTGAGG - Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900560378 1:3302649-3302671 CCAGGCACAGAGAGGCTGCAAGG - Intronic
900791836 1:4685846-4685868 CTGGTCATCCAGAGGCTGCAGGG + Intronic
904640334 1:31922405-31922427 CCTGGGAGACAGAGGTTGCAGGG + Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
909346354 1:74592023-74592045 CCTGTCATGGAGAGCCGGCAGGG - Intronic
912565336 1:110583677-110583699 CTTTTCATAATGAGGCTGCATGG + Intergenic
915586469 1:156846399-156846421 CCTGGCCCACAGAGGCTGGAAGG - Intronic
917931715 1:179826933-179826955 CCTGTCTTTCATAGGCTGGAGGG + Intergenic
920108984 1:203573942-203573964 CCTGTAGGACAGAGGCTGCCTGG + Intergenic
921484124 1:215696440-215696462 TCTGTCACTCAGGGGCTGCATGG + Intronic
922891769 1:229067241-229067263 CTTGTCATACAGAGGAGGAATGG + Intergenic
924273788 1:242363963-242363985 CCTCTCCTTCAGAGACTGCAAGG - Intronic
1062965745 10:1606482-1606504 CCTTTCAGACAGAGGCTGATTGG + Intronic
1063492215 10:6474931-6474953 TCTGTCTTACAAAGTCTGCAGGG - Intronic
1064881325 10:20057692-20057714 CTTTTCAGACAGATGCTGCAGGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067450098 10:46376771-46376793 CCTGACATCCTGAGGCTGCCTGG - Intronic
1067587145 10:47482992-47483014 CCTGACATCCTGAGGCTGCCTGG + Intronic
1067634204 10:47990759-47990781 CCTGACATCCTGAGGCTGCCTGG + Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1072732966 10:97860426-97860448 GCTGGGAGACAGAGGCTGCAGGG - Intronic
1073130491 10:101185768-101185790 CCTGTCCTCCAGATGCTACAGGG - Intergenic
1073821815 10:107272876-107272898 CCTGTTTTTAAGAGGCTGCATGG + Intergenic
1074798634 10:116976235-116976257 CCAGTTGTTCAGAGGCTGCATGG - Intronic
1075397559 10:122138951-122138973 CCTGGTTTACAGAGGCTACAGGG - Intronic
1075980127 10:126731111-126731133 TCTGTCACAGAGATGCTGCAAGG + Intergenic
1076110512 10:127855960-127855982 CCTGTCAGACAGACACAGCAGGG + Intergenic
1078320965 11:10334206-10334228 CCTGTGCTACAGAGGCTGGAAGG - Intronic
1085779823 11:79397856-79397878 ACTGTCAAATAGAGGTTGCATGG + Intronic
1086228855 11:84544743-84544765 CCTGGCATACAGTGGCTGCTTGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090078046 11:123591728-123591750 CCTGGCTTCGAGAGGCTGCATGG + Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091337734 11:134785212-134785234 CATGTCACACTGAGGCTGGATGG + Intergenic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1092268895 12:7006292-7006314 CCTGGAAGACAGAGGTTGCAGGG - Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1094737594 12:33252732-33252754 CCTGTTATACAGAGACTGTTTGG - Intergenic
1096589422 12:52647755-52647777 CGCGTGATCCAGAGGCTGCAGGG - Exonic
1097178458 12:57156991-57157013 CATGTCAGACAGAGGCAGCCGGG - Intronic
1098902052 12:76120467-76120489 CATGTCCTTCAGAGGCTGCAAGG + Intergenic
1101623820 12:106418668-106418690 CCTGTCTTAAACAGGCTGAAAGG + Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1103788828 12:123454760-123454782 CCTGTGAGGCAGAGGTTGCAGGG - Intergenic
1104595142 12:130115642-130115664 CCTGCCATACAGAGGCGGCCTGG + Intergenic
1106863182 13:33933954-33933976 ACTGGCAGACAGAGACTGCAGGG + Intronic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1109191353 13:59327743-59327765 CCAGGCATACAGTGGCTTCAGGG - Intergenic
1109280493 13:60349918-60349940 CCCGTCAGGCTGAGGCTGCAGGG + Intergenic
1111880771 13:93954388-93954410 CCTGGAAGACAGAGGTTGCATGG - Intronic
1113422049 13:110178440-110178462 CCTGTCATTGAGAGTCAGCAAGG + Intronic
1115772533 14:36680812-36680834 CCTGTCAGGCAGAGGCTGTTCGG + Intronic
1118064849 14:62179811-62179833 ACTGGCACACAGAGTCTGCAAGG - Intergenic
1118094273 14:62518930-62518952 CCTGTCATAATGATGCTGGAAGG - Intergenic
1119205298 14:72789430-72789452 CCTCTCCTACAGAGGCAGCGTGG - Intronic
1122066324 14:99176313-99176335 CCTGCCTGACAGGGGCTGCAGGG + Intronic
1122706109 14:103623021-103623043 CCTGGGAGACAGAGGTTGCAGGG - Intronic
1122788197 14:104173581-104173603 CCTGTCATCCAGTGGCTCCTGGG + Intronic
1125181961 15:36888222-36888244 CCTGTCACCCAGAGTCTGCCCGG + Intergenic
1125706863 15:41745678-41745700 CCTGAGATGTAGAGGCTGCAGGG - Intronic
1126353970 15:47775422-47775444 CCCGGGATACAGAGGTTGCAGGG - Intergenic
1129524065 15:76203055-76203077 GCTGACCTACAGAGGGTGCAGGG - Intronic
1129921030 15:79319318-79319340 CCTGTAATGCAGAGGCAGAAGGG + Intronic
1130515132 15:84620739-84620761 GCTGGCATCCAGAGGCTCCAGGG + Exonic
1132344652 15:101100977-101100999 GCTGTCAGACACAGGCTCCAGGG + Intergenic
1132344664 15:101101036-101101058 GCTGTCAGACACAGGCTCCATGG + Intergenic
1135307815 16:21381979-21382001 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1135391830 16:22100182-22100204 TTTGTCTTGCAGAGGCTGCAGGG + Exonic
1136304560 16:29361099-29361121 CCTGCCACACAGAGGTTGCAGGG - Intergenic
1136504900 16:30696849-30696871 CCCGGGAGACAGAGGCTGCAGGG + Intergenic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1140881797 16:79205132-79205154 CCTGTCATTTAAAAGCTGCATGG + Intronic
1142278486 16:89135540-89135562 CCTGTCACAGAGAGGCTTCTAGG - Intronic
1143131260 17:4678933-4678955 TCTGTCATGCAGAGGCTCCAGGG - Intronic
1148400661 17:47357195-47357217 CCTGTCCCACAGAGCCTGCAAGG + Intronic
1150043811 17:61891217-61891239 CCCGGCAGACAGAGGTTGCAGGG + Intronic
1150061898 17:62075769-62075791 ACTGTGATACAGAGTGTGCAGGG + Intergenic
1150910864 17:69385985-69386007 CCTGCCATAAAGAGAATGCATGG - Intergenic
1151256339 17:72879701-72879723 CCTGTCACTCAGCAGCTGCAGGG - Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1160843017 19:1154836-1154858 CCTGTCCCTCAGAGGCAGCAGGG + Intronic
1162051895 19:8039285-8039307 CTTTTCATTCAGAGGCTTCAGGG - Intronic
1162782524 19:13013703-13013725 CATGTGAGACAGAGGCTGAATGG + Intronic
1163221445 19:15924427-15924449 CCTGTCATGTAGACGCTACATGG - Intronic
1164230647 19:23284745-23284767 ACTGTCACACACAGGCTGGAGGG + Intergenic
1164932735 19:32187829-32187851 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1165080779 19:33304754-33304776 GTTGTCACACAGAGGCTGCTGGG + Intergenic
1165142116 19:33705807-33705829 GCTGTGACACAGAGGCAGCAGGG - Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
925380395 2:3421021-3421043 CCTGCCTGACAGAGACTGCAAGG - Intronic
926398640 2:12471805-12471827 CCTGGAAGACAGAGGTTGCAAGG - Intergenic
931600511 2:63998355-63998377 CAAGACATAAAGAGGCTGCATGG - Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
932816953 2:74869698-74869720 CCTGTCATAAAAAGGCTCAAAGG - Intronic
932948739 2:76268350-76268372 CCTGTCATCCAGATGCTGTGAGG + Intergenic
935274294 2:101463105-101463127 CCTGTCATACAGAGGCTGCAAGG - Intronic
935356778 2:102208673-102208695 CCTGTCCTGCATAGGCAGCAGGG - Intronic
935875235 2:107499182-107499204 CCTGTCCAAGAGAGGCTGTATGG + Intergenic
935947068 2:108296314-108296336 CATGTCATACAGAGGCACCCTGG + Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
941230985 2:162912501-162912523 CCTGCAAGTCAGAGGCTGCAGGG + Intergenic
941640121 2:167978181-167978203 CTTGGCAGACAGAGGCTGCATGG + Intronic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
944686003 2:202118366-202118388 CCTGTACTACAGAGGCTAGAAGG + Intronic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
947140276 2:227013965-227013987 CCTGTCATGAAAAGGATGCATGG + Intronic
947318919 2:228895535-228895557 CATGTCATAAAGAGGCAACAAGG - Intronic
947327530 2:228994137-228994159 CCTGTCCTAGAGAGGCAGGAAGG - Intronic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
948182124 2:235990334-235990356 CCTGACCCACAGAGGCTGCAGGG - Intronic
948381165 2:237550888-237550910 CCAGTCATACAGAGGACACAAGG - Intronic
1171038733 20:21739910-21739932 GCTGTCTCACAGAGCCTGCAGGG + Intergenic
1172327825 20:34050713-34050735 GATCTCATACAGAGGCTGCTGGG + Intronic
1173225079 20:41157833-41157855 CCTGTCACAAAGAGCCTTCAAGG + Intronic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1178578240 21:33814377-33814399 CCTGTCAGACAGAAACTGCTGGG + Intronic
1179112627 21:38460601-38460623 CTTTTCATTCAGAGTCTGCAAGG + Intronic
1181736290 22:24884223-24884245 GCAGTGATGCAGAGGCTGCAGGG + Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184972616 22:48037228-48037250 CCTGGGCTACAGGGGCTGCAAGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953555922 3:43946788-43946810 CCTCTCAGACACAGGCTCCAGGG - Intergenic
954318385 3:49813609-49813631 CCTGCCATGCAGAGGATTCAGGG - Exonic
958185203 3:90110996-90111018 CTTGTCAGACAGTGGGTGCAGGG - Intergenic
961645926 3:128392782-128392804 CCTGGCACACACAGGCTGCTCGG + Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962469299 3:135691176-135691198 CCTGCCACACCTAGGCTGCATGG + Intergenic
964758133 3:160107278-160107300 CCAGTCACACAGGGGCTACATGG + Intergenic
967246701 3:187494174-187494196 GCTTTCATACAAAGGATGCACGG + Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968483930 4:849766-849788 CCTGTCACCCATAGGCTGCGGGG - Exonic
968821215 4:2853182-2853204 CCTGGGAGACAGAGGTTGCAGGG - Intronic
968997195 4:3953317-3953339 CCTGACATTCAGATGCCGCAGGG + Intergenic
970498352 4:16651214-16651236 CCTGTCTTTCAGTGGTTGCAGGG + Intronic
971913007 4:32821173-32821195 CCTGGGAAACAAAGGCTGCAGGG - Intergenic
972820293 4:42694222-42694244 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
973586373 4:52396077-52396099 CCTGTCCTTCAGTGGCTGAATGG - Intergenic
973650696 4:52994457-52994479 CCTGTCAAATAGAGGGTGGACGG + Intronic
978010482 4:103676161-103676183 CCTGTGAGCCAGAAGCTGCAAGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
983719678 4:170833953-170833975 CCTTTAATTCAGAGGCAGCAAGG + Intergenic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
986053607 5:4113590-4113612 CCTGTCCCAAAGAGGATGCAAGG + Intergenic
986368503 5:7058484-7058506 CCTGTCCTCCAGATGCTACAGGG - Intergenic
987999430 5:25330462-25330484 CCTGGCATTCAGGGGCTGCCTGG - Intergenic
991606760 5:68410056-68410078 CATGTCACACAGGGGCTGAATGG - Intergenic
994877908 5:105449140-105449162 CTTGTCATACAAAAGCTGCCTGG - Intergenic
995781930 5:115785888-115785910 CCTGACATTCAGAGACTGCCGGG - Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997603804 5:135158188-135158210 TCTGACATACAGAGGCCTCATGG + Intronic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001919798 5:175590912-175590934 CCTTTCATGCAGAGGCTGCTAGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002607503 5:180391708-180391730 CCTGTCTTAAGGAGGCTGCCAGG + Intergenic
1003351870 6:5325392-5325414 CCTGCCATCCAGTGGCGGCAGGG + Intronic
1004135050 6:12957871-12957893 CCTGGCACCGAGAGGCTGCATGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005756094 6:28926017-28926039 CCTGGGAGACAGAGGTTGCAGGG + Intergenic
1006373430 6:33659061-33659083 GCTGGCATGCAGAGGCTGCCCGG - Exonic
1007086098 6:39146761-39146783 CCTGTCTTACAAGGGCTGGAAGG - Intergenic
1007191436 6:40022269-40022291 CTTGCCATACAGAGCCTGAATGG - Intergenic
1007411344 6:41663753-41663775 CCCGAGAAACAGAGGCTGCAAGG + Intergenic
1011439392 6:87371409-87371431 CATGTCATACAGTTGTTGCAAGG - Intronic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1017281221 6:152628264-152628286 AATGTGATGCAGAGGCTGCAAGG - Exonic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019735344 7:2647508-2647530 CGAGCCGTACAGAGGCTGCAGGG + Exonic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1021789752 7:24192959-24192981 ACAGTCATACAGAGTGTGCAGGG - Intergenic
1022822648 7:33976226-33976248 CCTGGGAGTCAGAGGCTGCAGGG - Intronic
1023095351 7:36654624-36654646 CCTGTGATATACATGCTGCAGGG - Intronic
1023721777 7:43103252-43103274 CCCAGGATACAGAGGCTGCAGGG - Intergenic
1025988968 7:66480613-66480635 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1027211931 7:76156631-76156653 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1028223547 7:88223462-88223484 TCTCTCATACAGAGACTGTATGG - Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1031796940 7:126186504-126186526 GCTGTCCCACAGAGCCTGCAGGG + Intergenic
1033796881 7:144855965-144855987 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1036474267 8:9078845-9078867 CTTGTCCTACAGAGACTACAGGG + Intronic
1037621446 8:20566934-20566956 CCCGTCAGACAGAGCCTGCAGGG + Intergenic
1037740877 8:21608312-21608334 CTTGCCATAAAGTGGCTGCAGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038409652 8:27348324-27348346 CCTGTCATGCAGAGGAAACAGGG - Intronic
1038913861 8:31997832-31997854 CCTATCATACATGGGTTGCAAGG - Intronic
1038921513 8:32090394-32090416 CCTGTGAGGCGGAGGCTGCAGGG - Intronic
1045645133 8:104290543-104290565 CCTGTCCTCCAGATGCTACAGGG + Intergenic
1046503985 8:115113761-115113783 GCAGTTATACAGAGGTTGCAAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1049267125 8:141674130-141674152 CCTGTCTGCCAGGGGCTGCAGGG + Intergenic
1049312142 8:141938876-141938898 CCTGTGAGTCAGAGGCTGCTGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1059434945 9:114270575-114270597 CCTGGCACACAGTGGGTGCATGG - Intronic
1060226559 9:121794937-121794959 CCTGTCCTCGAGATGCTGCAGGG + Intergenic
1060757880 9:126226044-126226066 CCTGTGTCACAGAGCCTGCAAGG - Intergenic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061868367 9:133506979-133507001 TCCGTCGTACAAAGGCTGCAGGG + Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1189896159 X:45658784-45658806 CCTGTATTTCAGAGGATGCATGG + Intergenic
1193761053 X:85466026-85466048 CATTTCATACAATGGCTGCAGGG + Intergenic
1193989637 X:88290422-88290444 GCTGTCATACAGAATCTACAAGG + Intergenic
1194764049 X:97828765-97828787 TCTCTCTTACAGAGGCTGTAGGG - Intergenic
1197308427 X:124872788-124872810 TCTGTCTTACAGAGGAAGCAAGG - Intronic
1197916704 X:131543511-131543533 CCTGACATAGAGTGGGTGCAAGG - Intergenic
1198616822 X:138466997-138467019 GCTTTCATACCGAGGATGCAGGG + Intergenic
1200177988 X:154131505-154131527 CCTGAGAGACAGAGGTTGCAGGG - Intergenic
1200875758 Y:8153061-8153083 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202239729 Y:22754114-22754136 CCTTCCAGACAGAGACTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202478068 Y:25282241-25282263 CCTTCCAGACAGAGACTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic