ID: 935275635

View in Genome Browser
Species Human (GRCh38)
Location 2:101473816-101473838
Sequence AACATCCCATCCTGGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935275632_935275635 -4 Left 935275632 2:101473797-101473819 CCTAAGCTTTAAATTAGGAAACA 0: 1
1: 0
2: 4
3: 27
4: 310
Right 935275635 2:101473816-101473838 AACATCCCATCCTGGATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935275635 Original CRISPR AACATCCCATCCTGGATCTA GGG Intronic
905336870 1:37250698-37250720 AACAAACCATCCTGGCTCTTAGG - Intergenic
909231273 1:73093535-73093557 AACATGTCATCTTGGAGCTATGG + Intergenic
909793728 1:79705969-79705991 AACAGCCCATGCAGCATCTATGG - Intergenic
915816174 1:158968007-158968029 AAAATACCATTCTGGATATAGGG + Intronic
920154197 1:203934907-203934929 AAATTCCCTTCCTGTATCTAAGG - Intergenic
921524979 1:216206344-216206366 ACCTTCCCATCCTGGGTCCATGG - Intronic
923319984 1:232822057-232822079 AACCTCACATCTTGGGTCTAAGG + Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066608943 10:37214802-37214824 CAGATCCCAGCCTGGATCTGTGG + Intronic
1073330880 10:102669221-102669243 AACAGCCCATCCTGGACCAAGGG - Intergenic
1074890706 10:117734881-117734903 AACATTCCATCCTGGAACATCGG - Intergenic
1076861873 10:133141628-133141650 AGCATCCCAGCCGGGCTCTAAGG + Intergenic
1081527548 11:43936925-43936947 ATCATCCCCTCCTGGGTCTTGGG - Intronic
1092059330 12:5535753-5535775 AACATCACATCCTATAGCTACGG - Intronic
1100368636 12:93944348-93944370 CATATCCCGTCCTGGATCTGAGG - Intergenic
1101269134 12:103124437-103124459 AACAACCCATCCAGGTTCTAGGG - Intergenic
1101965278 12:109278263-109278285 AACAGAACATCCTGGCTCTAGGG + Exonic
1102536500 12:113585442-113585464 AACATCCCTACCTGGAACTCAGG - Intergenic
1104340652 12:127945642-127945664 ATCATACCATCCTTGATTTAGGG + Intergenic
1104736702 12:131139614-131139636 AACATCCCCTCCTGGTGCTGCGG - Exonic
1104803759 12:131572070-131572092 CACATCACAGCCTGGCTCTAGGG + Intergenic
1105964766 13:25373765-25373787 ATCATCTCCTCTTGGATCTATGG - Intronic
1113190983 13:107745675-107745697 ACCATATCACCCTGGATCTATGG - Intronic
1116265901 14:42689650-42689672 ATCATTCTATCATGGATCTAAGG - Intergenic
1120402171 14:84045516-84045538 AAACTCCCATCCTGGATCCCAGG + Intergenic
1122422823 14:101588184-101588206 AAAATCCCTTCCTGGGCCTAAGG + Intergenic
1128315332 15:66656100-66656122 AACCTGACATCCAGGATCTAAGG + Intronic
1128447878 15:67780826-67780848 GCCATCCCACCCTGGATGTATGG + Intronic
1128587589 15:68863564-68863586 AAGATCACATCCTGGAACCAAGG - Intronic
1129561712 15:76577560-76577582 AAAATACCATCCAGGAGCTAGGG - Intronic
1131526867 15:93159654-93159676 AACATCACTTACTGGATGTACGG - Intergenic
1137972838 16:53002602-53002624 AACATCCCATCATGTACCTATGG + Intergenic
1144478474 17:15609625-15609647 AACAACACCTCCTCGATCTATGG + Intronic
1144919817 17:18754086-18754108 AACAACACCTCCTCGATCTATGG - Intronic
1148220922 17:45861147-45861169 AGCATCCCATCCTGGATGGATGG + Intergenic
1150512832 17:65774709-65774731 TACATGCCATCCTGGAACCAGGG + Intronic
1153126382 18:1796694-1796716 AAAATCCTATCCTGGAGCAACGG - Intergenic
1154113338 18:11589565-11589587 TATATCCCATCCTTGATCTGTGG - Intergenic
1158886592 18:61833797-61833819 ATCACCCCATTCTAGATCTATGG - Intronic
1161391656 19:4024279-4024301 AAAACCCCATCCTGGGTCTCAGG + Intronic
1162087235 19:8256171-8256193 AACCTCCCACCCTGGGTCTGCGG - Intronic
1168494111 19:56836234-56836256 AGCATCCCATCCAGGATGAATGG + Intronic
927347731 2:22066202-22066224 AACCTTCCCTCCTGGATTTAAGG + Intergenic
930031998 2:47064038-47064060 AACATCCCTTATTGCATCTAGGG - Intronic
933085513 2:78049941-78049963 GTAATACCATCCTGGATCTAGGG - Intergenic
935275635 2:101473816-101473838 AACATCCCATCCTGGATCTAGGG + Intronic
937006975 2:118525848-118525870 TCCATCCCAGCCTGCATCTATGG + Intergenic
943798879 2:192032928-192032950 ACCATACCATCCTGAATCTTAGG - Intronic
944217165 2:197267998-197268020 GAGATCCCATTCTGGATCCAAGG - Intronic
1168945264 20:1749124-1749146 AATATACCATTCTGGATATAGGG + Intergenic
1172585944 20:36084698-36084720 AATAACTCATCCTGGATTTAGGG - Intergenic
1172943598 20:38671502-38671524 GGCTTCCCTTCCTGGATCTAAGG + Intergenic
1174134487 20:48369727-48369749 AGCATCTCACCCTGGCTCTACGG - Intergenic
1175968384 20:62671397-62671419 ATGAGACCATCCTGGATCTAAGG - Intronic
1179924535 21:44527107-44527129 AAAGTCACATCCTGGATTTAGGG + Intronic
1181919800 22:26311794-26311816 AAGTTCCCATTCTGGATGTAGGG - Exonic
1183328361 22:37206448-37206470 AACATCCCATCATGGGCCTGTGG + Exonic
949275388 3:2273994-2274016 AACAACCCATGTTGGATCTTAGG + Intronic
961146002 3:124593774-124593796 AACCTCCCTTACTGGATCTTTGG - Intronic
966626583 3:182023432-182023454 AACATCTCATTCTGGAAATAAGG - Intergenic
969276938 4:6142174-6142196 CTCATTCCATCCTGGATTTAGGG + Intronic
976839641 4:89416833-89416855 AACTTCCCAGAATGGATCTATGG + Intergenic
977232632 4:94469719-94469741 AACATACCAGCCTGGAGATATGG - Intronic
981691482 4:147514283-147514305 CACAACCCATCCTGAATATAGGG + Intronic
986199112 5:5565365-5565387 AAAATCCCAGCATGGATCTGTGG - Intergenic
986441613 5:7787374-7787396 ATAATATCATCCTGGATCTAGGG - Intronic
987522877 5:19010008-19010030 AAAATCACAGCCTGGAGCTATGG + Intergenic
988230503 5:28472097-28472119 AAAATCCCATCCTTAATCAAGGG - Intergenic
996510392 5:124309529-124309551 AAGATCCCATCCAGGATCAGGGG - Intergenic
996800438 5:127396974-127396996 CAGATCCCAGCCTGAATCTAAGG + Intronic
998032795 5:138886683-138886705 AACATTTCACCATGGATCTAAGG - Intronic
1002685455 5:181005798-181005820 TACATCGCATGCTGGATATAGGG - Exonic
1008836710 6:55841153-55841175 ACCATCCCACCCTGCATCCATGG + Intronic
1011680574 6:89779456-89779478 AGAAACCCATCCTGGATTTATGG + Intronic
1015498157 6:133902392-133902414 AAGATCCCTCCCTGTATCTAAGG + Intergenic
1018025354 6:159801055-159801077 GACATCCCATCCCGGCACTATGG - Intronic
1020029052 7:4920243-4920265 ACCATCTCTGCCTGGATCTACGG - Exonic
1021913538 7:25409546-25409568 ATCTTCCCATCCTGGCCCTATGG - Intergenic
1022879177 7:34567799-34567821 AACATCCACTCCTGAACCTATGG - Intergenic
1023596033 7:41830179-41830201 AACATGCCATCCTGAATTTTAGG + Intergenic
1025263760 7:57439539-57439561 AACAGGCCATGCTGGGTCTAAGG - Intergenic
1034274255 7:149817142-149817164 AACATGGCATCCTGGAACTCTGG - Intergenic
1037565529 8:20115074-20115096 AACATCCCATCTCGGATGGAGGG - Intergenic
1047232968 8:123012961-123012983 AACATCCCAGTCTGTATCTTGGG - Intergenic
1048487700 8:134864016-134864038 AACATCACATTCTGGATTTGGGG + Intergenic
1052170789 9:25393768-25393790 AATGTCCCATTCTGGATCTTAGG + Intergenic
1053597577 9:39578550-39578572 AACATACTATCGTTGATCTATGG - Intergenic
1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG + Intronic
1189282974 X:39832235-39832257 AACTTCACATACTGGATTTAAGG + Intergenic
1190337400 X:49270510-49270532 GAGATCCCATCCTGGATCCGGGG + Exonic
1192048296 X:67699756-67699778 AACATCACATCCTTGACCTTAGG + Intronic
1193989221 X:88285251-88285273 AAAATCCCATCCAGGAACTAAGG - Intergenic
1197168943 X:123409989-123410011 AGCATCCCCACCTGGCTCTAAGG + Intronic