ID: 935281952

View in Genome Browser
Species Human (GRCh38)
Location 2:101526030-101526052
Sequence GACCCCAGCCAATGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935281952_935281960 8 Left 935281952 2:101526030-101526052 CCCTCTCCCCATTGGCTGGGGTC No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281952_935281959 4 Left 935281952 2:101526030-101526052 CCCTCTCCCCATTGGCTGGGGTC No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935281952 Original CRISPR GACCCCAGCCAATGGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr