ID: 935281959

View in Genome Browser
Species Human (GRCh38)
Location 2:101526057-101526079
Sequence TGTATAATTTAAACTAATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935281953_935281959 3 Left 935281953 2:101526031-101526053 CCTCTCCCCATTGGCTGGGGTCG No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281947_935281959 11 Left 935281947 2:101526023-101526045 CCCTGTACCCTCTCCCCATTGGC No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281948_935281959 10 Left 935281948 2:101526024-101526046 CCTGTACCCTCTCCCCATTGGCT No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281957_935281959 -3 Left 935281957 2:101526037-101526059 CCCATTGGCTGGGGTCGGGTTGT No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281952_935281959 4 Left 935281952 2:101526030-101526052 CCCTCTCCCCATTGGCTGGGGTC No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281945_935281959 12 Left 935281945 2:101526022-101526044 CCCCTGTACCCTCTCCCCATTGG No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281958_935281959 -4 Left 935281958 2:101526038-101526060 CCATTGGCTGGGGTCGGGTTGTA No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data
935281956_935281959 -2 Left 935281956 2:101526036-101526058 CCCCATTGGCTGGGGTCGGGTTG No data
Right 935281959 2:101526057-101526079 TGTATAATTTAAACTAATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935281959 Original CRISPR TGTATAATTTAAACTAATCT CGG Intergenic
No off target data available for this crispr