ID: 935281960

View in Genome Browser
Species Human (GRCh38)
Location 2:101526061-101526083
Sequence TAATTTAAACTAATCTCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935281958_935281960 0 Left 935281958 2:101526038-101526060 CCATTGGCTGGGGTCGGGTTGTA No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281952_935281960 8 Left 935281952 2:101526030-101526052 CCCTCTCCCCATTGGCTGGGGTC No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281957_935281960 1 Left 935281957 2:101526037-101526059 CCCATTGGCTGGGGTCGGGTTGT No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281948_935281960 14 Left 935281948 2:101526024-101526046 CCTGTACCCTCTCCCCATTGGCT No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281947_935281960 15 Left 935281947 2:101526023-101526045 CCCTGTACCCTCTCCCCATTGGC No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281945_935281960 16 Left 935281945 2:101526022-101526044 CCCCTGTACCCTCTCCCCATTGG No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281953_935281960 7 Left 935281953 2:101526031-101526053 CCTCTCCCCATTGGCTGGGGTCG No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data
935281956_935281960 2 Left 935281956 2:101526036-101526058 CCCCATTGGCTGGGGTCGGGTTG No data
Right 935281960 2:101526061-101526083 TAATTTAAACTAATCTCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935281960 Original CRISPR TAATTTAAACTAATCTCGGT TGG Intergenic
No off target data available for this crispr