ID: 935283794

View in Genome Browser
Species Human (GRCh38)
Location 2:101545589-101545611
Sequence GATTGGGGCAAGCATATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935283794_935283802 29 Left 935283794 2:101545589-101545611 CCAGAAATATGCTTGCCCCAATC No data
Right 935283802 2:101545641-101545663 CCCCTTGCCCACTGCCAAGATGG No data
935283794_935283799 -6 Left 935283794 2:101545589-101545611 CCAGAAATATGCTTGCCCCAATC No data
Right 935283799 2:101545606-101545628 CCAATCAGAAAGGCAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935283794 Original CRISPR GATTGGGGCAAGCATATTTC TGG (reversed) Intergenic
No off target data available for this crispr