ID: 935283799

View in Genome Browser
Species Human (GRCh38)
Location 2:101545606-101545628
Sequence CCAATCAGAAAGGCAATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935283794_935283799 -6 Left 935283794 2:101545589-101545611 CCAGAAATATGCTTGCCCCAATC No data
Right 935283799 2:101545606-101545628 CCAATCAGAAAGGCAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935283799 Original CRISPR CCAATCAGAAAGGCAATCTC AGG Intergenic
No off target data available for this crispr