ID: 935283802

View in Genome Browser
Species Human (GRCh38)
Location 2:101545641-101545663
Sequence CCCCTTGCCCACTGCCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935283798_935283802 12 Left 935283798 2:101545606-101545628 CCAATCAGAAAGGCAATCTCAGG No data
Right 935283802 2:101545641-101545663 CCCCTTGCCCACTGCCAAGATGG No data
935283797_935283802 13 Left 935283797 2:101545605-101545627 CCCAATCAGAAAGGCAATCTCAG No data
Right 935283802 2:101545641-101545663 CCCCTTGCCCACTGCCAAGATGG No data
935283796_935283802 14 Left 935283796 2:101545604-101545626 CCCCAATCAGAAAGGCAATCTCA No data
Right 935283802 2:101545641-101545663 CCCCTTGCCCACTGCCAAGATGG No data
935283794_935283802 29 Left 935283794 2:101545589-101545611 CCAGAAATATGCTTGCCCCAATC No data
Right 935283802 2:101545641-101545663 CCCCTTGCCCACTGCCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935283802 Original CRISPR CCCCTTGCCCACTGCCAAGA TGG Intergenic
No off target data available for this crispr