ID: 935283977

View in Genome Browser
Species Human (GRCh38)
Location 2:101547143-101547165
Sequence ATGTTTCTGCAGAAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935283977_935283980 26 Left 935283977 2:101547143-101547165 CCATTCTGCTTCTGCAGAAACAT No data
Right 935283980 2:101547192-101547214 AGCATACTCTTCCACTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935283977 Original CRISPR ATGTTTCTGCAGAAGCAGAA TGG (reversed) Intergenic
No off target data available for this crispr