ID: 935287851

View in Genome Browser
Species Human (GRCh38)
Location 2:101581043-101581065
Sequence GTGTTTCAACAGAATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935287845_935287851 11 Left 935287845 2:101581009-101581031 CCAACCTAGATGTTATTGGTGAC No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287838_935287851 30 Left 935287838 2:101580990-101581012 CCCCCCCAAAATTGAATTTCCAA No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287839_935287851 29 Left 935287839 2:101580991-101581013 CCCCCCAAAATTGAATTTCCAAC No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287842_935287851 26 Left 935287842 2:101580994-101581016 CCCAAAATTGAATTTCCAACCTA No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287846_935287851 7 Left 935287846 2:101581013-101581035 CCTAGATGTTATTGGTGACCATC No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287840_935287851 28 Left 935287840 2:101580992-101581014 CCCCCAAAATTGAATTTCCAACC No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287843_935287851 25 Left 935287843 2:101580995-101581017 CCAAAATTGAATTTCCAACCTAG No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data
935287841_935287851 27 Left 935287841 2:101580993-101581015 CCCCAAAATTGAATTTCCAACCT No data
Right 935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935287851 Original CRISPR GTGTTTCAACAGAATGAGGG TGG Intergenic
No off target data available for this crispr