ID: 935292246

View in Genome Browser
Species Human (GRCh38)
Location 2:101620533-101620555
Sequence CTGGGGAAGGCTCTGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935292246_935292255 12 Left 935292246 2:101620533-101620555 CCTCCACACAGAGCCTTCCCCAG No data
Right 935292255 2:101620568-101620590 TCACTCTCCAATCGATTACCTGG No data
935292246_935292259 30 Left 935292246 2:101620533-101620555 CCTCCACACAGAGCCTTCCCCAG No data
Right 935292259 2:101620586-101620608 CCTGGGTGTATTTTTCTTCATGG No data
935292246_935292256 13 Left 935292246 2:101620533-101620555 CCTCCACACAGAGCCTTCCCCAG No data
Right 935292256 2:101620569-101620591 CACTCTCCAATCGATTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935292246 Original CRISPR CTGGGGAAGGCTCTGTGTGG AGG (reversed) Intergenic
No off target data available for this crispr