ID: 935294044

View in Genome Browser
Species Human (GRCh38)
Location 2:101632801-101632823
Sequence TGCTTACACCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935294036_935294044 9 Left 935294036 2:101632769-101632791 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 935294044 2:101632801-101632823 TGCTTACACCCGGGAGGCGGAGG No data
935294038_935294044 8 Left 935294038 2:101632770-101632792 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 935294044 2:101632801-101632823 TGCTTACACCCGGGAGGCGGAGG No data
935294034_935294044 17 Left 935294034 2:101632761-101632783 CCTGCAGTCCCAGCTACTCGGGA 0: 1449
1: 60147
2: 180850
3: 266363
4: 190637
Right 935294044 2:101632801-101632823 TGCTTACACCCGGGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935294044 Original CRISPR TGCTTACACCCGGGAGGCGG AGG Intergenic
No off target data available for this crispr